©The Author(s) 2025.
World J Gastroenterol. Jun 28, 2025; 31(24): 104437
Published online Jun 28, 2025. doi: 10.3748/wjg.v31.i24.104437
Published online Jun 28, 2025. doi: 10.3748/wjg.v31.i24.104437
Table 2 Oligonucleotides used in this study: MicroRNA mimics
| Name | Sequence (5' to 3') | Sense | Spices | Application |
| miR-10a mimic | UACCCUGUAGAUCCGAAUUUGUG | Sense | Mouse/human | In vivo |
| TTAUGGGACAUCUAGGCUUAAAC | Antisense | |||
| miR-10b mimic | UACCCUGUAGAACCGAAUUUGUG | Sense | Mouse/human | In vivo |
| TTAUGGGACAUCUUGGCUUAAAC | Antisense |
- Citation: Baek G, Singh R, Ha SE, Cho H, Padmanabhan S, Vishwanath V, Kim MS, Seon D, You J, Lee MY, Ro S. miR-10a-5p and miR-10b-5p restore colonic motility in aged mice. World J Gastroenterol 2025; 31(24): 104437
- URL: https://www.wjgnet.com/1007-9327/full/v31/i24/104437.htm
- DOI: https://dx.doi.org/10.3748/wjg.v31.i24.104437