©2007 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 14, 2007; 13(46): 6254-6258
Published online Dec 14, 2007. doi: 10.3748/wjg.v13.i46.6254
Published online Dec 14, 2007. doi: 10.3748/wjg.v13.i46.6254
Table 1 Sequences and localization of primers used for Amplification of cDNA of MLH1
| Sense | Antisense |
| MLH1-1F (1-18) | MLH1-5R (2198-2175) |
| CTTGGCTCTTCTGGCGCC | GAGCGCAAGGCTTTATAGACAATG |
| MLH1-4F (1333-1353) | MLH1-6R (2484-2459) |
| GCTGAAGTGGCTGCCAAAAAT | TATGTTAAGACACATCTATTTATTTA |
- Citation: Wang CF, Zhou XY, Zhang TM, Xu Y, Cai SJ, Shi DR. Two novel germline mutations of MLH1 and investigation of their pathobiology in hereditary non-polyposis colorectal cancer families in China. World J Gastroenterol 2007; 13(46): 6254-6258
- URL: https://www.wjgnet.com/1007-9327/full/v13/i46/6254.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i46.6254