Copyright
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Feb 7, 2005; 11(5): 649-655
Published online Feb 7, 2005. doi: 10.3748/wjg.v11.i5.649
Published online Feb 7, 2005. doi: 10.3748/wjg.v11.i5.649
Primer | Direction | Length | Position (nt) | 5’-sequence-3’ |
A1762/G1764For | + | 34 | 1748-1781 | aggagattagttaaaggtctttgtactaggaggc |
1896/1899Rev | - | 20 | 1895-1876 | aaagccacccaaggcacagc |
A1896For | + | 31 | 1876-1906 | gctgtgccttgggtggctttagggcatggac |
A1899For | + | 34 | 1876-1909 | gctgtgccttgggtggctttgggacatggacatt |
A1896A1899For | + | 34 | 1876-1909 | gctgtgccttgggtggctttaggacatggacatt |
PS5For | + | 20 | 1260-1279 | gccgatccatactgcggaac |
PS4Rev | - | 20 | 2386-2405 | gagaccttcgtctgcgaggc |
-
Citation: Wang Y, Wei L, Jiang D, Cong X, Fei R, Xiao J, Wang Y.
In vitro resistance to interferon of hepatitis B virus with precore mutation. World J Gastroenterol 2005; 11(5): 649-655 - URL: https://www.wjgnet.com/1007-9327/full/v11/i5/649.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i5.649