BPG is committed to discovery and dissemination of knowledge
Rapid Communication
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 7, 2005; 11(45): 7142-7147
Published online Dec 7, 2005. doi: 10.3748/wjg.v11.i45.7142
Table 1 Oligonucleotide primers used for amplification of total DNA extracted from human blood samples and total chromosomal DNA recovered from selected bacterial strains
Primer designateSequences of (+) and (-) primers (nucleotide)Gene targetSize of amplicon (bp)
BG-1 (+ strand)5’CTT TGC CTG GTT TCC GGC ACC AGA A- 3’ (201-225)b-Galactosidase gene of E coli762
BG-4 (- strand)5’AAC CAC CGC ACG ATA GAG ATT CGG G- 3’ (983-939)
BD-1 (+ strand)5’AGT TTG ATC CTG GCT GAG- 3’ (8-27)DNA coding for 16S rRNA798
BD-2 (- strand)5’GGA CTA CCA GGG TAT CTA AT- 3’ (805-787)
BFR-1 (+ strand)5’ACT CTT TGT ATC CCG ACG ATT-3’ (484-504)Glutamine synthase gene of Bacteroides spp.581
BFR-2 (- strand)5’GAG GTT GAT GCC TGT ATC GGT-3’ (1 065-1 045)
F3 (+ strand)5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG-3’Variable V3 region of 16S rRNA233
Rev-2 (- strand)5’ATTACCGCGGCTGCTGG-3’


Write to the Help Desk