Herpes simplex virus type 1 in peptic ulcer disease: An inverse association with Helicobacter pylori

Table 1 Characteristics and nucleotide base sequences of primers used for nested PCR and control assays

Gene target	GenBankaccession number	Productsize (bp)	Sequences1	Tm(°C)
			Outer sense agcagcgactctgaggcggagaccg	69.1
		450
			Outer antisense tgcgggtctgggggtcgttcacga	71.4
HSV-1: RL2	X14112		Inner sense cccggcagttgcgggggcgc	73.4
		110
			Inner antisense aaggtgtcgcagcggcaggtg	60.8
b-actin			Forward gtgatctccttctgcatcc	53.2
		200		52.7
			Reverse ctcttccagccttccttc

T_m, melting temperature.

¹Sequences shown are in the 5’ to 3’ direction.