BPG is committed to discovery and dissemination of knowledge
Brief Reports
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Nov 14, 2005; 11(42): 6644-6649
Published online Nov 14, 2005. doi: 10.3748/wjg.v11.i42.6644
Table 1 Characteristics and nucleotide base sequences of primers used for nested PCR and control assays
Gene targetGenBankaccession numberProductsize (bp)Sequences1Tm(°C)
Outer sense agcagcgactctgaggcggagaccg69.1
450
Outer antisense tgcgggtctgggggtcgttcacga71.4
HSV-1: RL2X14112Inner sense cccggcagttgcgggggcgc73.4
110
Inner antisense aaggtgtcgcagcggcaggtg60.8
b-actinForward gtgatctccttctgcatcc53.2
20052.7
Reverse ctcttccagccttccttc


Write to the Help Desk