BPG is committed to discovery and dissemination of knowledge
Colorectal Cancer
©The Author(s) 2004.
World J Gastroenterol. Sep 15, 2004; 10(18): 2643-2646
Published online Sep 15, 2004. doi: 10.3748/wjg.v10.i18.2643
Table 2 Sequence of primers and program of PCR for ChIPs
PrimersSense (5’→3’)Antisense (5’→3’)Size of product and PCR conditionGenBank accession number
γ-actinGGACCTGGCGTGGCCATCTCC153 bp 95 °C 5 min 95 °C 1 min,
TGGCCGGGACCTGCTCGAA56 °C 1 min, 72 °C 1 min, 35 cycles
p21WAF1 (P1)CGTGGTGGTGGTCTGTCTGCA296 bp 95 °C 5 min 95 °C 1 min,U24170
GAGCTAGACCTTCGCTCCT58 °C 1 min, 72 °C 1 min, 35 cycles
p21WAF1 (P2)GGTTGTATACTCTCACCTCCT128 bp 95 °C 5 min 95 °C 1 min,U24170
TCAGGGCCGCTGAGTGC58 °C 1 min, 72 °C 1 min, 35 cycles


Write to the Help Desk