Pregnant women are occasionally misdiagnosed with gestational diabetes (GDM) when they may have glucokinase monogenic diabetes (GCK-MODY). Differentiating between GCK-MODY and GDM is critical due to the distinct treatment strategies required during and after pregnancy. Since pregnancy often elicits the first glucose tolerance test, it provides a unique opportunity to identify individuals with GCK-MODY. However, testing all pregnant women with GDM for GCK-MODY is expensive, and the use of clinical criteria is warranted. An Irish study suggested using a combined criteria of a pre-pregnancy body mass index (BMI) <25 kg/m2 and fasting glucose ≥5.5 mmol/L to differentiate GCK-MODY from GDM. Therefore, we aimed to identify women with GCK-MODY during pregnancy using these combined criteria in a Danish population of women with GDM. Additionally, we aimed to screen for other MODY subtypes.

We recruited women from the Central Denmark Region diagnosed with GDM between April 2019 and December 2022. Women meeting the criteria of pre-pregnancy BMI <25 kg/m2 and fasting glucose ≥5.5 mmol/L were offered screening for MODY (17 known genetic variants) using Illumina's Next Generation Sequencing.

Of the 1270 women with GDM, 46 met the MODY screening criteria. Of these, 41 were offered MODY screening, 34 participated and 1 woman was identified with MODY (MODY 8-CEL variant).

The current Danish GDM screening guidelines do not apply with recommending the use of pre-pregnancy BMI <25 kg/m2 and fasting glucose ≥5.5 mmol/L as criteria for identifying women with GCK-MODY among women with GDM in the Danish population.

Monogenic diabetes is a group of diseases that encompasses a growing number of genetic abnormalities affecting pancreatic function/development leading to glycemic dysregulation. This includes conditions that have historically been referred to as maturity onset diabetes of the young or MODY in addition to neonatal diabetes mellitus. While recognition of a genetic or inherited form of diabetes has been known for decades, advances in molecular genetic testing have resulted in identification of specific forms of monogenic diabetes. Despite this, these genetic forms of diabetes remain widely underreported. It is important to be able to identify genetic forms of diabetes as treatment, monitoring for microvascular and macrovascular complications, and overall management varies for the different forms of monogenic diabetes. Furthermore, the identification of a specific monogenic form of diabetes can significantly impact the person's quality of life and other family members, as well as health care costs. This article highlights the identification, treatment, and management for various forms of monogenic diabetes and addresses some unmet needs in caring for people with monogenic forms of diabetes.

Type 2 diabetes mellitus (T2DM) is increasingly affecting people aged 15-34, posing a serious public health challenge due to its faster progression and higher complication risks. This study examines the global, regional, and national burden of early-onset T2DM from 1990 to 2021, emphasizing trends and disparities across different sociodemographic contexts.

Using data from the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2021, we analyzed incidence, prevalence, mortality, disability-adjusted life years (DALYs), years lived with disability (YLDs), and years of life lost (YLLs) in people aged 15-34. Stratifications included age, sex, and the Socio-Demographic Index (SDI). Joinpoint regression significant temporal shifts, and decomposition analysis attributed changes in T2DM burden to factors such as prevalence, population growth, aging, and case fatality rates. Inequality was assessed with the Slope Index of Inequality and Concentration Index.

From 1990 to 2021, early-onset T2DM incidence and prevalence rose significantly worldwide, especially in high-SDI regions. Although global mortality and DALYs appeared relatively stable, low-SDI regions showed worrisome increases. Rising T2DM prevalence was the principal driver of mortality and DALYs, notably in low- and middle-SDI regions. Inequality analyses indicated widening disparities, with higher incidence and prevalence in high-SDI countries and more severe outcomes in low-SDI countries.

The global burden of early-onset T2DM among youths is escalating, with significant disparities across different sociodemographic levels. The findings underscore the urgent need for targeted public health interventions. Future research should focus on the underlying factors driving these trends and explore strategies for effective prevention and management of early-onset T2DM.

Type 2 diabetes mellitus (T2DM) encompasses a range of clinical manifestations, with uncontrolled diabetes leading to progressive or irreversible damage to various organs. Numerous genes associated with monogenic diabetes, exhibiting classical patterns of inheritance (autosomal dominant or recessive), have been identified. Additionally, genes involved in complex diabetes, which interact with environmental factors to trigger the disease, have also been discovered. These genetic findings have raised hopes that genetic testing could enhance diagnostics, disease surveillance, treatment selection, and family counseling. However, the accurate interpretation of genetic data remains a significant challenge, as variants may not always be definitively classified as either benign or pathogenic. Research to date, however, indicates that periodic reevaluation of genetic variants in diabetes has led to more consistent findings, with biases being steadily eliminated. This has improved the interpretation of variants across diverse ethnicities. Clinical studies suggest that genetic risk information may motivate patients to adopt behaviors that promote the prevention or management of T2DM. Given that the clinical features of certain monogenic diabetes types overlap with T2DM, and considering the significant role of genetic variants in diabetes, healthcare providers caring for prediabetic patients should consider genetic testing as part of the diagnostic process. This review summarizes current knowledge of the most common genetic variants associated with T2DM, explores novel therapeutic targets, and discusses recent advancements in the pharmaceutical management of uncontrolled T2DM.

The case of a 22-year-old male patient who presented with acute on chronic hyperglycemia in known MODY ("maturity onset diabetes of the young") 12 (ABCC8 gene) after 11 months of treatment cessation is reported. To emphasize the importance of the awareness of this therapeutically important entity of diabetes, the essential facts of this inherited disease are summarized.

MODY, or maturity-onset diabetes of the young, is a group of monogenic diseases characterized by autosomal dominant inheritance of a non-insulin-dependent form of diabetes that classically manifests in adolescence or in young adults under 25 years of age. MODY is a rare cause of diabetes, accounting for 1% of all cases, and is often misdiagnosed as type 1 or type 2 diabetes. It is of great importance to accurately diagnose MODY, as this allows for the most appropriate treatment of patients and facilitates early diagnosis for them and their families. This disease has a high degree of phenotypic and genetic polymorphism. The most prevalent forms of the disease are attributed to mutations in three genes: GCK (MODY 2) and (HNF)1A/4A (MODY 3 and MODY 1). The remaining MODY subtypes, which are less prevalent, have been identified by next generation sequencing (NGS) in the last decade. Mutations in the GCK gene result in asymptomatic, stable fasting hyperglycemia, which does not require specific treatment. Mutations in the HNF1A and HNF4A genes result in pancreatic β-cell dysfunction, which in turn causes hyperglycemia. This often leads to diabetic angiopathy. The most commonly prescribed drugs for the treatment of hyperglycemia are sulfonylurea derivatives. Nevertheless, with advancing age, some patients may require insulin therapy due to the development of resistance to sulfonylurea drugs. The strategy of gene therapy for monogenic forms of MODY is still an experimental approach, and it is unlikely to be widely used in the clinic due to the peculiarities of MODY structure and the high genetic polymorphism and clinical variability even within the same form of the disease. Furthermore, there is a lack of clear gene-phenotypic correlations, and there is quite satisfactory curability in the majority of patients. This review presents the main clinical and genetic characteristics and mutation spectrum of common and rarer forms of MODY, with a detailed analysis of the field of application of AVV vectors in the correction of hyperglycemia and insulin resistance.

Introduction: Gene therapy has emerged as a promising frontier in the management of diabetes, offering innovative approaches to address both type 1 and type 2 diabetes. This narrative review examines the advancements in gene therapy applications, focusing on both animal and human studies, and includes a total of 11 studies in adherence to PRISMA guidelines. These studies utilize various viral vectors, such as adeno-associated virus (AAV) and lentivirus, to deliver genes that regulate insulin production and enhance angiogenesis. This review aims to synthesize recent advancements in gene therapy for both type 1 and type 2 diabetes and its complications, and to explore the evolving role of pharmacists in this emerging field. Methods: A comprehensive search was conducted to identify relevant studies on gene therapy for diabetes. Databases such as PubMed, the Cochrane Database of Systematic Reviews, the Cochrane Central Register of Controlled Trials, and Google Scholar were queried using keywords such as "Diabetes", "gene therapy", "Type 1 diabetes", and "Type 2 diabetes". Both animal and human studies were included to provide a broad perspective on the advancements in this field. Results: Animal model studies have shown promising results, including sustained insulin production, improved glucose homeostasis, and enhanced wound healing. Human studies, though fewer in number, have reported significant advancements. Patients with diabetic neuropathy treated with plasmid VEGF and recombinant adeno-associated virus (rAAV) showed improvements in neuropathic symptoms and glycemic control. Other studies involving intramuscular injections of VM202 and bicistronic VEGF165/HGF plasmid have reported pain reduction, improved healing of ischemic lesions, and increased angiogenesis. Conclusions: Despite these encouraging results, limitations such as small sample sizes, short follow-up periods, and the necessity for more extensive clinical trials persist. Diabetes is a metabolic syndrome that requires the collaboration of a multidisciplinary team to assist in several aspects of implementing successful gene therapy. Several healthcare providers and policy makers may play a crucial role in patient education, counseling, and the management of gene therapy treatments.

Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.

To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.

A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.

All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.

This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.

Given the contemporary understanding of diabetes genetics, the term "maturity-onset diabetes of the young (MODY)" warrants renaming. I propose adopting the term "monogenic diabetes" in conjunction with the specific gene name.

There are no established methods to identify children with atypical diabetes for further study. We aimed to develop strategies to systematically ascertain cases of atypical pediatric diabetes using electronic medical records (EMR).

We tested two strategies in a large pediatric hospital in the USA. Strategy 1: we designed a questionnaire to rule out typical diabetes and applied it to the EMR of 100 youth with diabetes. Strategy 2: we built three electronic queries to generate reports of three atypical pediatric diabetes phenotypes: unknown type, type 2 diabetes (T2D) diagnosed <10 years old and autoantibody-negative type 1 diabetes (AbNegT1D).

Strategy 1 identified six cases (6%) of atypical diabetes (mean diagnosis age=11±2.6 years, 16.6% men, 33% non-Hispanic white (NHW) and 66.6% Hispanic). Strategy 2: unknown diabetes type: n=68 (1%) out of 6676 patients with diabetes; mean diagnosis age=12.6±3.3 years, 32.8% men, 23.8% NHW, 47.6% Hispanic, 25.4% African American (AA), 3.2% other. T2D <10 years old: n=64 (6.6%) out of 1142 patients with T2D; mean diagnosis age=8.6±1.6 years, 20.3% men, 4.7% NHW, 65.6% Hispanic, 28.1% AA, 1.6% other. AbNegT1D: n=38 (5.6%) out of 680 patients with new onset T1D; mean diagnosis age=11.3±3.8 years; 57.9% men, 50% NHW, 19.4% Hispanic, 22.3% AA, 8.3% other.

In sum, we identified 1%-6.6% of atypical diabetes cases in a pediatric diabetes population with high racial and ethnic diversity using systematic review of the EMR. Better identification of these cases using unbiased approaches may advance precision diabetes.

The applicability of the MODY risk calculator (Shields et al) to non- White European populations remains unknown.

We aimed to test its real-world application in Hispanic youth.

We conducted a retrospective chart review of Hispanic youth (<23 years) with diabetes (n=2033) in a large pediatric tertiary care center in the U.S. We calculated MODY probability for all subjects, splitting them into two cohorts based on the original model: Individuals who were started on insulin within 6 months of diabetes diagnosis (Cohort 1) and those who were not (Cohort 2).

Cohort 1 consisted of 1566 individuals (median age [25p, 75p]: 16 [13, 19] years, 49% female), while Cohort 2 comprised 467 youth (median age [25p, 75p]: 17 [15, 20] years, 62% female). The mean MODY probability was 5.9% and 61.9% in Cohort 1 and Cohort 2, respectively. The mean probability for both cohorts combined was 18.8% suggesting an expected 382 individuals with MODY, which is much higher than previous estimations (1-5%; i.e. 20-102 individuals in this cohort). A total of 18 individuals tested positive for MODY among the limited number of individuals tested based on clinical suspicion and genetic testing availability (n=44 out of 2033 tested, [2.2% of overall cohort]).

The MODY risk calculator likely overestimates the probability of MODY in Hispanic youth, largely driven by an overestimation in those not early-insulin treated (predominantly young-onset type 2 diabetes). The calculator needs updating to improve its applicability in this population. In addition, further research to help better identify MODY in Hispanic youth.

Individuals with maturity-onset diabetes of the young (MODY) are often misdiagnosed as type 1 or type 2 diabetes and receive inappropriate care. We aimed to investigate the characteristics and treatment of all MODY types in a multicenter, real-world setting.

Individuals with MODY from the diabetes prospective follow-up (DPV) registry were studied. We compared clinical parameters during the first year of diabetes and the most recent treatment year after MODY diagnosis.

A total of 1640 individuals were identified with GCK-MODY (n = 941) and HNF1A-MODY (n = 417) as the most frequent types. Among these, 912 individuals were available with information during the first and the most recent treatment year (median duration of follow-up: 4.2 years [2.6-6.6]). Positive beta cell autoantibodies were present in 20.6% (15.2% IAA). Median age at diagnosis ranged from 9.9 years in GCK-MODY (Q1-Q3: 6.2-13.1 years) and INS-MODY (2.7-13.7 years) to 14.3 years (5.0-17.1) in KCNJ11-MODY. Frequency of oral antidiabetic agents (OAD) use increased and insulin decreased in HNF4A-MODY (OAD: 18% to 39%, insulin: 34% to 23%) and in HNF1A-MODY (OAD: 18% to 31%, insulin: 35% to 25%). ABCC8-MODY was characterized by a decrement in nonpharmacological treatment (26% to 16%) and "insulin only" treatment (53% to 42%), while the proportion of individuals treated with OAD but no insulin increased from 0% to 21%.

Our results indicate that some teams caring for individuals with MODY are hesitant with regard to current recommendations. Registries are an essential source of information and provide a basis for discussing treatment guidelines for MODY.

Bacterial pneumonia is one of the most common causes of acute respiratory distress syndrome. In fulminant cases, when mechanical ventilation fails, veno-venous extracorporeal membrane oxygenation is required. However, this method is still associated with significant mortality and a wide range of potential complications. However, there are now many case reports of good outcomes even in patients with prolonged extracorporeal oxygenation, as in our rather complicated case report.

Our case report describes a complicated but successful treatment of a severe, devastating bacterial pneumonia in a 39-year-old European polymorbid woman with a rare form of diabetes mellitus, which had been poorly compensated for a long time with limited compliance, in the context of a combined immunodeficiency that strongly influenced the course of the disease. The patient's hospitalization required a total of 30 days of veno-venous extracorporeal membrane oxygenation therapy and more than 50 days of mechanical ventilation. Numerous complications, particularly bleeding, required seven chest drains, two extracorporeal membrane oxygenation circuit changes, and one surgical revision. The patient's mental state required repeated psychiatric intervention.

It is possible that even the initially severely damaged lung parenchyma can develop its regenerative potential if suitable conditions are provided for this process, including a sufficiently long period of extracorporeal membrane oxygenation. We believe that this case report may also contribute to the consideration of the indications and contraindications of extracorporeal support. The authors also discuss the limitations and risks of prolonged veno-venous extracorporeal membrane oxygenation support and periprocedural anticoagulation strategies.

The incidence and prevalence of type 2 diabetes mellitus (T2DM) in young individuals (aged <40 years) have significantly increased in recent years, approximating two to threefold increase in the respective rates. Numerous risk factors including severe obesity, family history, ethnicity, maternal diabetes or gestational diabetes, and female sex contribute to a younger age of onset. In terms of pathogenesis, impaired insulin secretion is the key operating mechanism, alongside with ectopic adiposity-related insulin resistance. T2DM diagnosis in a young adult requires the exclusion of type 1 diabetes mellitus (T1DM), latent autoimmune diabetes of adults (LADA) and maturity-onset diabetes of the young (MODY). The establishment of such diagnosis is critical for prognosis, because early-onset T2DM is associated with rapid deterioration in pancreatic β-cell secretory function leading to earlier initiation of insulin therapy. Furthermore, mortality and lifetime risk of developing complications, especially microvascular, is increased in these patients compared to both later-onset T2DM and T1DM patients; also, the latter are often developed earlier in the course of disease. The management of early-onset T2DM follows the same guidelines as in later-onset T2DM; yet patients aged 18-39 years are underrepresented in the big clinical trials on which the development of guidelines is based. Finally, young people with T2DM face significant challenges associated with social determinants, which compromise their adherence to therapy and induce diabetes distress. Future research focusing on the pathogenesis of β-cell decline and complications, as well as on specific treatment shall lead to better understanding and management of early-onset T2DM.

Type 2 diabetes (T2DM) incidence and prevalence are increasing in pediatrics. All children aged > 10 years or postpubertal should be screened in primary care for T2DM if they are overweight with one risk factor or have signs of insulin resistance or associated conditions. Classifying pediatric diabetes is challenging. An accurate, timely diagnosis is critical to optimize care, as children with T2DM are at risk for more severe disease as adults. We describe a 10-year-old female referred to endocrine following abnormal laboratory results in primary care. Despite the initial presentation of diabetic ketoacidosis, the child was diagnosed with T2DM.

Maturity-onset diabetes of the young (MODY) represents the most frequent form of monogenic diabetes mellitus (DM), currently classified in 14 distinct subtypes according to single gene mutations involved in the differentiation and function of pancreatic β-cells. A significant proportion of MODY has unknown etiology, suggesting that the genetic landscape is still to be explored. Recently, novel potentially MODY-causal genes, involved in the differentiation and function of β-cells, have been identified, such as RFX6, NKX2.2, NKX6.1, WFS1, PCBD1, MTOR, TBC1D4, CACNA1E, MNX1, AKT2, NEUROG3, EIF2AK3, GLIS3, HADH, and PTF1A. Genetic and clinical features of MODY variants remain highly heterogeneous, with no direct genotype-phenotype correlation, especially in the low-penetrant subtypes. This is a narrative review of the literature aimed at describing the current state-of-the-art of the novel likely MODY-associated variants. For a deeper understanding of MODY complexity, we also report some related controversies concerning the etiological role of some of the well-known pathological genes and MODY inheritance pattern, as well as the rare association of MODY with autoimmune diabetes. Due to the limited data available, the assessment of MODY-related genes pathogenicity remains challenging, especially in the setting of rare and low-penetrant subtypes. In consideration of the crucial importance of an accurate diagnosis, prognosis and management of MODY, more studies are warranted to further investigate its genetic landscape and the genotype-phenotype correlation, as well as the pathogenetic contribution of the nongenetic modifiers in this cohort of patients.

Maturity-onset diabetes of the young (MODY) is a spectrum of clinically heterogenous forms of monogenic diabetes mellitus characterized by autosomal dominant inheritance, onset at a young age, and absence of pancreatic islets autoimmunity. This rare form of hyperglycemia, with clinical features overlapping with type 1 and type 2 diabetes mellitus, has 14 subtypes with differences in prevalence and complications occurrence which tailor therapeutic approach. MODY phenotypes differ based on the gene involved, gene penetrance and expressivity. While MODY 2 rarely leads to diabetic complications and is easily managed with lifestyle interventions alone, more severe subtypes, such as MODY 1, 3, and 6, require an individualized treatment approach to maintain a patient's quality of life and prevention of complications. This review summarizes current evidence on the presentation, diagnosis, and management of MODY, an example of a genetic cause of hyperglycemia that calls for a precision medicine approach.

Maturity-onset diabetes of the young (MODY) is part of the heterogeneous group of monogenic diabetes (MD) characterized by the non-immune dysfunction of pancreatic β-cells. The diagnosis of MODY still remains a challenge for clinicians, with many cases being misdiagnosed as type 1 or type 2 diabetes mellitus (T1DM/T2DM), and over 80% of cases remaining undiagnosed. With the introduction of modern technologies, important progress has been made in deciphering the molecular mechanisms and heterogeneous etiology of MD, including MODY. The aim of our study was to identify genetic variants associated with MODY in a group of patients with early-onset diabetes/prediabetes in whom a form of MD was clinically suspected. Genetic testing, based on next-generation sequencing (NGS) technology, was carried out either in a targeted manner, using gene panels for monogenic diabetes, or by analyzing the entire exome (whole-exome sequencing). GKC-MODY 2 was the most frequently detected variant, but rare forms of KCNJ11-MODY 13, specifically, HNF4A-MODY 1, were also identified. We have emphasized the importance of genetic testing for early diagnosis, MODY subtype differentiation, and genetic counseling. We presented the genotype-phenotype correlations, especially related to the clinical evolution and personalized therapy, also emphasizing the particularities of each patient in the family context.

(1) Background and objectives: Maturity-onset diabetes of the young (MODY) is a group of diabetes caused by gene defects related to insulin secretion. MODY1, MODY2, and MODY3 are the most common and account for approximately 80% of all cases. Other types are relatively rare. This study describes the clinical, analytical, and genetic characteristics of a patient with MODY10, and diabetic nephropathy, retinopathy, and functional hypogonadism diagnosis. (2) Materials and methods: A clinical case was analyzed and whole exome generation sequencing (WES) was used to detect mutations related to a monogenic variant. (3) Results: A seventeen-year-old male patient, who was diagnosed with apparent type 1 diabetes at the age of eight was started with insulin therapy. He came to the emergency room with glycemic decompensation, facial, and lower limb edema. During his evaluation, he had near-nephrotic range proteinuria of 2902 mg/24 h, a kidney ultrasound showing mild pyelocalyceal dilation, proliferative diabetic retinopathy, and was also diagnosed with functional hypogonadotropic hypogonadism. These comorbidities improved with adequate glycemic control. WES showed missense variant c.94G>A (p.Gly32Ser) in the INS gene, according to Clinvar corresponding to MODY10. It was a "de novo" variant not reported in his parents. (4) Conclusions: Monogenic diabetes (MD) is rare and MODY10 is among the less frequent types. MODY should be suspected in patients with type 1 phenotype with negative autoimmunity even in the absence of a family history of diabetes. To the best of our knowledge, we present here the first patient with these phenotypic traits of MODY10 reported in Latin America.

Childhood-onset obesity has emerged as a major public healthcare challenge across the globe, fueled by an obesogenic environment and influenced by both genetic and epigenetic predispositions. This has led to an exponential rise in the incidence of type 2 diabetes mellitus in children and adolescents. The looming wave of diabetes-related complications in early adulthood is anticipated to strain the healthcare budgets in most countries. Unless there is a collective global effort to curb the devastation caused by the situation, the impact is poised to be pro-found. A multifaceted research effort, governmental legislation, and effective social action are crucial in attaining this goal. This article delves into the current epidemiological landscape, explores evidence concerning potential risks and consequences, delves into the pathobiology of childhood obesity, and discusses the latest evidence-based management strategies for diabesity.

Classifying diabetes at diagnosis is crucial for disease management but increasingly difficult due to overlaps in characteristics between the commonly encountered diabetes types. We evaluated the prevalence and characteristics of youth with diabetes type that was unknown at diagnosis or was revised over time. We studied 2073 youth with new-onset diabetes (median age [IQR] = 11.4 [6.2] years; 50% male; 75% White, 21% Black, 4% other race; overall, 37% Hispanic) and compared youth with unknown versus known diabetes type, per pediatric endocrinologist diagnosis. In a longitudinal subcohort of patients with data for ≥ 3 years post-diabetes diagnosis (n = 1019), we compared youth with steady versus reclassified diabetes type. In the entire cohort, after adjustment for confounders, diabetes type was unknown in 62 youth (3%), associated with older age, negative IA-2 autoantibody, lower C-peptide, and no diabetic ketoacidosis (all, p < 0.05). In the longitudinal subcohort, diabetes type was reclassified in 35 youth (3.4%); this was not statistically associated with any single characteristic. In sum, among racially/ethnically diverse youth with diabetes, 6.4% had inaccurate diabetes classification at diagnosis. Further research is warranted to improve accurate diagnosis of pediatric diabetes type.

Genome-wide association studies (GWAS) have facilitated a substantial and rapid increase in the number of confirmed genetic susceptibility variants for complex diseases. Approximately 700 variants predisposing individuals to the risk for type 2 diabetes have been identified through GWAS until 2023. From 2018 to 2022, hundreds of type 2 diabetes susceptibility loci with smaller effect sizes were identified through large-scale GWAS with sample sizes of 200,000 to >1 million. The clinical translation of genetic information for type 2 diabetes includes the development of novel therapeutics and risk predictions. Although drug discovery based on loci identified in GWAS remains challenging owing to the difficulty of functional annotation, global efforts have been made to identify novel biological mechanisms and therapeutic targets by applying multi-omics approaches or searching for disease-associated coding variants in isolated founder populations. Polygenic risk scores (PRSs), comprising up to millions of associated variants, can identify individuals with higher disease risk than those in the general population. In populations of European descent, PRSs constructed from base GWAS data with a sample size of approximately 450,000 have predicted the onset of diseases well. However, European GWAS-derived PRSs have limited predictive performance in non-European populations. The predictive accuracy of a PRS largely depends on the sample size of the base GWAS data. The results of GWAS meta-analyses for multi-ethnic groups as base GWAS data and cross-population polygenic prediction methodology have been applied to establish a universal PRS applicable to small isolated ethnic populations.

Variations in several nuclear genes predisposing humans to the development of MODY diabetes have been very well characterized by modern genetic diagnostics. However, recent reports indicate that variants in the mtDNA genome may also be associated with the diabetic phenotype. As relatively little research has addressed the entire mitochondrial genome in this regard, the aim of the present study is to evaluate the genetic variations present in mtDNA among individuals susceptible to MODY diabetes. In total, 193 patients with a MODY phenotype were tested with a custom panel with mtDNA enrichment. Heteroplasmic variants were selected for further analysis via further sequencing based on long-range PCR to evaluate the potential contribution of frequent NUMTs (acronym for nuclear mitochondrial DNA) insertions. Twelve extremely rare variants with a potential damaging character were selected, three of which were likely to be the result of NUMTs from the nuclear genome. The variant m.3243A>G in MT-TL1 was responsible for 3.5% of MODY cases in our study group. In addition, a novel, rare, and possibly pathogenic leucine variant m.12278T>C was found in MT-TL2. Our findings also found the MT-CO1 gene to be over-represented in the study group, with a clear phenotype-genotype correlation observed in one family. Our data suggest that heteroplasmic variants in MT-COI and MT-TL2 genes may play a role in the pathophysiology of glucose metabolism in humans.

Maturity onset diabetes of the young (MODY) describes a group of non-autoimmune forms of diabetes that are characterized by mostly autosomal dominant, monogenic mutations resulting in decreased beta cell function in the pancreas. MODY accounts for roughly 1% to 5% of diabetes cases, and the optimal treatment for each MODY depends on the causative mutation. This article provides a review of MODY to aid providers with knowing what aspects of the history and physical exam should prompt further investigation for this group of conditions.

Diabetes mellitus is a globally significant disease that can lead to systemic complications, particularly vascular damage, including cardiovascular and cerebrovascular diseases of relevance. The physiological changes resulting from the imbalance in blood glucose levels play a crucial role in initiating vascular endothelial damage. Elevated glucose levels can also penetrate the central nervous system, triggering diabetic encephalopathy characterized by oxidative damage to brain components and activation of alternative and neurotoxic pathways. This brain damage increases the risk of ischemic stroke, a leading cause of mortality worldwide and a major cause of disability among surviving patients. The aim of this review is to highlight important pathways related to hyperglycemic damage that extend to the brain and result in vascular dysfunction, ultimately leading to the occurrence of a stroke. Understanding how diabetes mellitus contributes to the development of ischemic stroke and its impact on patient outcomes is crucial for implementing therapeutic strategies that reduce the incidence of diabetes mellitus and its complications, ultimately decreasing morbidity and mortality associated with the disease.

Diabetes is a chronic disorder with a complex pathogenetic background including monogenic, polygenic, and environmental causes.

The aim of the present paper is to share the information related to genetic and clinical data of large pediatric diabetes cohort.

The present study retrospectively analyzes genetic and clinical findings of subjects diagnosed with diabetes under the age of 18 year and are in follow-up in a pediatric diabetes referral center.

Out of 1205 children with diabetes (902 treated with insulin) 246 underwent genetic tests on the basis of clinical selection criteria since 2007.

One hundred and ten variants related to diabetes were found in 89 of them. Age at presentation was 9.5±4.02 years (F/M 44/45). In total 49 pathogenic and likely pathogenic, 11 "hot and warm" of unknown significance variants were found in fourteen MODY and fifteen non-MODY genes according to criteria developed by American College of Medical Genetics. Thirty novel mutations were found. GCK (26.6%) and ABCC8 (10%) were two most frequently affected genes. Antibody testing revealed negative results in 80% of cases.

Genetic interpretation in selected cases is important to understand the nature of the disease better. Improvement in testing opportunity and awareness might increase the prevalence of genetically explained diabetes cases. The distribution of subtypes differs between countries and even regions of the same country.

Maturity Onset Diabetes of the Young (MODY) is a monogenic form of diabetes which is detected by genetic testing. We looked at clinical and biochemcial variables that could help detect possible MODY among Asian Indians with youth-onset diabetes. From the diabetes electronic medical records of a diabetes care centre in Chennai in southern India, demographic, anthropometric, and biochemical details of 34 genetically confirmed MODY participants were extracted. They were compared with patients with type 1 diabetes (T1D) (n = 1011) and type 2 diabetes (T2D) (n = 1605), diagnosed below 30 years of age. Clinical and biochemical variables including body mass index (BMI), glycated hemoglobin, HDL cholesterol, and C-peptide (fasting and stimulated) were analyzed to determine whether cut points could be derived to identify individuals who could be sent for genetic testing to diagnose or rule out MODY in this ethnic group. The age at diagnosis was higher for T2D (26.5 ± 4.0 years) compared to T1D (18.2 ± 6.1 years) and MODY (17.8 ± 6.0 years). Individuals with MODY had BMI, glycated hemoglobin, total cholesterol, triglycerides, HDL cholesterol, and C-peptide levels which were intermediate between T1D and T2D. The identified probable parameters and their cut points to identify cases for MODY genetic screening were BMI 21.2-22.7 kg/m2, glycated hemoglobin 7.2-10%, HDL cholesterol 43-45 mg/dl, fasting C -peptide, 1.2-2.1 ng/ml and stimulated C-peptide, 2.1-4.5 ng/ml. Asian Indians with MODY have clinical features that are intermediate between T1D and T2D and selected biochemical parameters, especially stimulated C peptide cut points were the most useful to diagnose MODY.

Classifying diabetes at diagnosis is crucial for disease management but increasingly difficult due to overlaps in characteristics between the commonly encountered diabetes types. We evaluated the prevalence and characteristics of youth with diabetes type that was unknown at diagnosis or was revised over time. We studied 2073 youth with new-onset diabetes (median age [IQR]=11.4 [6.2] years; 50% male; 75% White, 21% Black, 4% other race; overall, 37% Hispanic) and compared youth with unknown versus known diabetes type, per pediatric endocrinologist diagnosis. In a longitudinal subcohort of patients with data for ≥3 years post-diabetes diagnosis (n=1019), we compared youth with unchanged versus changed diabetes classification. In the entire cohort, after adjustment for confounders, diabetes type was unknown in 62 youth (3%), associated with older age, negative IA-2 autoantibody, lower C-peptide, and no diabetic ketoacidosis (all, p<0.05). In the longitudinal subcohort, diabetes classification changed in 35 youth (3.4%); this was not statistically associated with any single characteristic. Having unknown or revised diabetes type was associated with less continuous glucose monitor use on follow-up (both, p<0.004). In sum, among racially/ethnically diverse youth with diabetes, 6.5% had imprecise diabetes classification at diagnosis. Further research is warranted to improve accurate diagnosis of pediatric diabetes type.

Diabetes care is often difficult without a proper collaboration between the patient and the care provider as the disease is mostly self-managed by patients through adjustments in their lifestyles, and medication doses to optimise glycaemic control. Most clinical guidelines on the management of diabetes mellitus (DM) provide only broad principles on diabetes care, and the blind follow-up of such principles without a proper review and consideration of patient characteristics often results in inadequate glycaemic control and diabetes complications consequently. Therefore, a proper understanding of the pathobiology, clinical situation, and comorbidities of the individual case is of paramount importance to tailoring the most appropriate management strategy in real-world diabetes care. With the aid of five unique cases of DM [(1) Medically managed type 2 diabetes mellitus (T2DM) with severe obesity; (2) Management of T2DM with unreliable glycated haemoglobin (HbA1c); (3) Obesity in a patient with type 1 diabetes mellitus (T1DM); and (4) Late diagnosis and subsequent management of monogenic diabetes and 5. Sudden worsening of well-controlled T2DM)] we elaborate on the importance of individualised diabetes care and the practicalities in these situations. The review also provides an evidence update on the management of different forms of DM to guide physicians in optimising the care of their patients in day-to-day clinical practice.