RAD51 135G>C genetic polymorphism and the risk of prostate cancer

Table 1 Details of single nucleotide polymorphism analyzed

Gene	Polymorphism	Other names	SNP position	Chromosome	Method
RAD51	Rs1801320	c.-98G>C, G135C	UTR-5, Exon	15:40695330	PCR-RFLP

PCR-RFLP: Polymerase chain reaction-restriction fragment length polymorphism; SNP: Single nucleotide polymorphism.

Table 2 Details of polymerase chain reaction-restriction fragment length polymorphism of the studied single nucleotide polymorphism

SNP	Primer sequences	Annealing temperature (°C)	Product size (bp)	Enzyme	Genotype	Fragment sizes (bp)
Rs1801320	(F)5’TGGGAACTGCAACTCATCTGG3’, (R)5’GCGCTCCTCTCTCCAGCAG3’	65	157	BstNI	GG	7186
					GC	7186157
					CC	157

SNP: Single nucleotide polymorphism.

Table 3 Distribution of genotype frequency in RAD51 (rs1801320) among prostate cancer patients and controls, n (%)

	Genotype	Cases	Controls	P, χ2d value
RAD51 Rs1801320	GG	2 (4)	38 (76)	1.377 × 10-12, 54.62
	GC	35 (70)	7 (14)
	CC	13 (26)	5 (10)

Table 4 Association of prostate-specific antigen with genotype in prostate cancer patients

Genotype (n)	PSA level (μg/L) (median, IQR)	P, test statistic H
CC (13)	55, 106.5	P = 0.4, H = 1.84 at 95%CI (0-5.99)
GC (35)	51, 86.83
GG (2)	296.56, 403.69

CI: Confidence interval; PSA: Prostate-specific antigen.

Table 5 Association of prostate-specific antigen with allele in prostate cancer patients

Allele	PSA level ( μg/L )			Total	P value, χ2d value
	< 4	4-10	> 10
G	3	3	33	39	0.818167, 0.40
C	7	5	49	61
Total	10	8	82	100

PSA: Prostate-specific antigen.

Table 6 Association of genotype with staging in prostate cancer patients

Stage	Genotype			Total	P, χ2d value
	CC	GC	GG
A	2	8	0	10	0.649885, 4.2
B	1	1	0	2
C	4	18	1	23
D	6	8	1	15
Total	13	35	2	50

Table 7 Association of allele with staging in cases

Stage	Allele		Total	P value, χ2d value
	G	C
A	8	12	20	0.769677, 1.13
B	1	3	4
C	20	26	46
D	10	20	30
Total	39	61	100

Table 8 Association of genotype with Gleason’s score

Gleason’s score	Genotype			Total	P, χ2d value
	CC	GC	GG
≤ 7	10	19	0	29	0.087551, 4.87
> 7	3	16	2	21
Total	13	35	2	50

Table 9 Association of allele frequency with Gleason’s score

Gleason’s score	Allele		Total	P, χ2d value
	G	C
≤ 7	19	39	58	0.132648, 2.26
> 7	20	22	42
Total	39	61	100

Table 10 Odds ratio of genotypes and alleles and corresponding statistical values

Genotype/allele	OR	95%CI	Z-statistic	P
GG	0.0132	0.0028-0.0624	5.45	< 0.0001
GC	14.33	5.26-39.04	5.21	< 0.0001
CC	3.16	1.03-9.69	2.02	0.0438
C	7.64	3.95-14.75	6.05	< 0.0001
G	0.13	0.07-0.25	6.05	< 0.0001

CI: Confidence interval; OR: Odds ratio.

Table 11 Summary of literature reports regarding the association of RAD51 135G>C polymorphism with prostate cancer

Ref.	Years	Population	Cases (%)			Controls (%)
			GG	GC	CC	GG	GC	CC
Cypriano et al[4]	2017	Brazillian	76.4	21.8	1.8	78.5	20	1.5
Nowacka-Zawisza et al[8]	2015	Polish	65.3	26.7	8	79.6	17.1	3.3
Dhillon et al[15]	2009	Australian	83.6	15.5	0.9	90.2	9.8	0
Al-Zoubi et al[16]	2018	Jordanian	92.5	1.3	6.2	88	10	2