Tuf mRNA rather than 16S rRNA is associated with culturable Staphylococcus aureus

Table 1 Primers and probes used in this study

Gene	Forward primer 5'-3'	Reverse primer 5'-3'	Probe 5'-3'	Ref.
tuf	tcctggttcaattacaccacatactg	ggaaatagaattgtggacgatagtttga	FAM-tgataatacrtawacttctgc-BHQ1	[24]
16S	acggtcttgctgtcactta	tacacatatgttcttccctaataa	VIC-gtaacggcttaccaaggc-BHQ1	[22]

Table 2 Plate counts of Staphylococcus aureus samples with or without flucloxacillin treatment from Todd Hewitt broth

	Flucloxacillin	Yes		No
		Average	SD	Average	SD
Days	0	290	14	330	28
	1	255	7	Infinity	ND
	3	0	0	Infinity	ND
	6	0	0	Infinity	ND

Numbers represent colony forming units/mL. Infinity: Uncountable plate due to large amount of colonies; ND: Not determined.

Table 3 Plate counts of Staphylococcus aureus with or without flucloxacillin treatment from Todd Hewitt broth, fresh whole blood (1 h) and remnant whole blood (1 d)

		TH broth		Fresh whole blood		Remnant whole blood
Flucloxacillin		Yes	No	Yes	No	Yes	No
Days	0	20	22	10	4	3	6
	1	14	Infinity	2	3	1	1
	3	0	Infinity	2	1	0	3
	6	0	Infinity	1	0	0	0

Numbers represent colony forming units/mL. Infinity: Uncountable plate due to large amount of colonies; TH: Todd Hewitt.