Heart failure (HF) is a leading cause of mortality among patients with cardiovascular disease and is often associated with myocardial apoptosis and endoplasmic reticulum stress (ERS). While hydrogen has demonstrated potential in reducing oxidative stress and ERS, recent evidence suggests that magnesium may aid in hydrogen release within the body, further enhancing these protective effects. This study aimed to investigate the cardioprotective effects of magnesium in reducing apoptosis and ERS through hydrogen release in a rat model of isoproterenol (ISO)-induced HF. Magnesium was administered orally to ISO-induced HF rats, which improved cardiac function, reduced myocardial fibrosis and cardiac hypertrophy, and lowered the plasma levels of creatine kinase-MB, cardiac troponin-I, and N-terminal B-type natriuretic peptide precursor in ISO-induced HF rats. It also inhibited cardiomyocyte apoptosis by upregulating B-cell lymphoma-2, downregulating Bcl-2-associated X protein, and suppressing ERS markers (glucose-related protein 78, activating transcription factor 4, and C/EBP-homologous protein). Magnesium also elevated hydrogen levels in blood, plasma, and cardiac tissue, as well as in artificial gastric juice and pure water, where hydrogen release lasted for at least four hours. Additionally, complementary in vitro experiments were conducted using H9C2 cardiomyocyte injury models, with hydrogen-rich culture medium as the intervention. Hydrogen-rich culture medium improved the survival and proliferation of ISO-treated H9C2 cells, reduced the cell surface area, inhibited apoptosis, and downregulated ERS pathway proteins. However, the protective effects of hydrogen were negated by tunicamycin (an inducer of ERS) in H9C2 cells. In conclusion, magnesium exerts significant cardioprotection by mitigating ERS and apoptosis through hydrogen release effects in ISO-induced HF.

Exogenous or endogenous factors such as hypoxia, nutritional deficiencies, acidic microenvironments and their own high metabolic demands usually lead to tumor endoplasmic reticulum dysfunction and trigger endoplasmic reticulum stress (ERS). ERS sensors intercept such stress signals, which subsequently initiate the unfolded protein response (UPR), enabling tumor cells to adapt robustly in the hostile environment. Many studies have found that the ERS response affects a variety of tumor-infiltrating immune cells and suppresses their anti-tumor responses through different mechanisms. Given that glioblastoma (GBM) are immunosuppressive "cold tumors" with a poor prognosis. This paper not only discusses the promotion of GBM growth by ERS response, but also reviews the mechanisms by which ERS response promotes an immunosuppressive microenvironment.

Inflammation-induced oligodendrocyte death and CNS demyelination are key features of multiple sclerosis (MS). Inflammation-triggered endoplasmic reticulum (ER) stress and oxidative stress promote tissue damage in MS and in its preclinical animal model, experimental autoimmune encephalitis (EAE). Compound AA147 is a potent activator of the ATF6 signaling arm of the unfolded protein response (UPR) that can also induce antioxidant signaling through activation of the NRF2 pathway in neuronal cells. Previous work showed that AA147 protects multiple tissues against ischemia/reperfusion damage through ATF6 and/or NRF2 activation; however, its therapeutic potential in neuroinflammatory disorders remains unexplored. Here, we demonstrate that AA147 ameliorated the clinical symptoms of EAE and reduced ER stress, oligodendrocyte loss, and demyelination. Additionally, AA147 suppressed T cells in the CNS without altering the peripheral immune response. Importantly, AA147 significantly increased the expressions of Grp78, an ATF6 target gene, in oligodendrocytes, while enhancing levels of Grp78 as well as Ho-1, an NRF2 target gene, in microglia. In cultured oligodendrocytes, AA147 promoted nuclear translocation of ATF6, but not NRF2. Intriguingly, AA147 altered the microglia activation profile, possibly by triggering the NRF2 pathway. AA147 was not therapeutically beneficial during the acute EAE stage in mice lacking ATF6 in oligodendrocytes, indicating that protection primarily involves ATF6 activation in these cells. Overall, our results suggest AA147 as a potential therapeutic opportunity for MS by promoting oligodendrocyte survival and regulating microglia status through distinct mechanisms.

FAT atypical cadherin 1 (FAT1) is prevalently expressed in non-small cell lung cancer (NSCLC) tissues and is associated with poor prognosis in patients. Using data from the PRISM Repurposing drug sensitivity database, we observed that among compounds related to protein homeostasis, the valosin-containing protein (VCP) inhibitor CB-5083 demonstrated the most significant variation in sensitivity among NSCLC cells, categorized according to FAT1 expression levels. Notably, CB-5083 markedly inhibits cell proliferation and induces apoptosis in NSCLC cells with high expression of FAT1. Targeting VCP may trigger strong endoplasmic reticulum stress (ER stress) in NSCLC cells, leading to inhibition of cell proliferation in tumor cells. Mechanically, knockdown of FAT1 stimulates YAP signaling and target gene transcription, thereby attenuating the UPR pathway signal induced by CB-5083 stimulation in NSCLC cells. Our results suggest that FAT1 regulates the activation of the ER stress pathway through YAP signaling, influencing the susceptibility of NSCLC cells to VCP inhibitors. These insights provide novel perspectives for NSCLC treatment and extend the therapeutic applications of VCP inhibitors in clinical settings.

Immune checkpoint blockade (ICB) therapy has shown promising clinical efficacy in cancer treatment, but only a subset of patients experience significant therapeutic responses. Tumor cells respond to internal and external stresses, such as hypoxia and nutrient deprivation, by activating the unfolded protein response (UPR) in the tumor microenvironment. This response helps maintain homeostasis, promoting malignant progression, chemotherapy resistance, and immune escape. In this study, single-cell RNA sequencing (scRNA-seq) data from non-small cell lung cancer (NSCLC) patients treated with ICB revealed upregulation of thioredoxin (TXN) expression in the epithelial tissues of LUAD (lung adenocarcinoma) and LUSC (lung squamous cell carcinoma) patients with minimal pathological remission. High TXN expression was also associated with "cold tumors," characterized by a lack of T cells and low levels of chemokine receptors and immunomodulators. Experimental results showed that TXN was highly expressed in NSCLC tissues, and its knockdown significantly inhibited the proliferation and migration of A549 and SK-MES-1 cells. Furthermore, TXN knockdown enhanced T-cell-mediated cytotoxicity against these tumor cells, suggesting that TXN contributes to immune escape in NSCLC by promoting tumor cell proliferation and migration while inhibiting immune killing. Notably, TXN knockdown also upregulated CD40 expression, indicating that TXN may regulate immune escape in lung cancer through CD40 modulation.

The mammalian endoplasmic reticulum (ER) stress sensor inositol-requiring enzyme 1α (IRE1α) is essential for cellular homeostasis and plays key roles in infection responses, including innate immunity and microbicidal activity. While IRE1α functions through the IRE1α-XBP1S axis are known, its XBP1S-independent roles are less well understood, and its functions during fungal infection are still emerging. We demonstrate that Candida albicans activates macrophage IRE1α via C-type lectin receptor signaling independent of protein misfolding, suggesting non-canonical activation. IRE1α enhances macrophage fungicidal activity by promoting phagosome maturation, which is crucial for containing C. albicans hyphae. IRE1α facilitates early phagosomal calcium flux post-phagocytosis, which is required for phagolysosomal fusion. In macrophages lacking the IRE1α endoribonuclease domain, defective calcium flux correlates with fewer ER-early endosome contact sites, suggesting a homeostatic role for IRE1α-promoting membrane contact sites. Overall, our findings illustrate non-canonical IRE1α activation during infection and a function for IRE1α in supporting organelle contact sites to safeguard against rapidly growing microbes.

UBA5 encodes for the E1 enzyme of the UFMylation cascade, which plays an essential role in endoplasmic reticulum (ER) homeostasis. The clinical phenotypes of UBA5-associated encephalopathy include developmental delays, epilepsy, and intellectual disability. To date, there is no humanized neuronal model to study the cellular and molecular consequences of UBA5 pathogenic variants. We developed and characterized patient-derived cortical organoid cultures from two patients with compound heterozygous variants in UBA5. Both shared the same missense variant, which encodes a hypomorphic allele (p.A371T), along with a nonsense variant (p.G267* or p.A123fs*4). Single-cell RNA sequencing of 100-day organoids identified defects in GABAergic interneuron development. We demonstrated aberrant neuronal firing and reduction in size of patient-derived organoids. Mechanistically, we showed that ER homeostasis is perturbed along with an exacerbated unfolded protein response pathway in engineered U87-MG cells and patient-derived organoids expressing UBA5 pathogenic variants. We also assessed two potential therapeutic modalities that augmented UBA5 protein abundance to rescue aberrant molecular and cellular phenotypes. We assessed SINEUP, a long noncoding RNA that augments translation efficiency, and CRISPRa, a modified CRISPR-Cas9 approach to augment transcription efficiency to increase UBA5 protein production. Our study provides a humanized model that allows further investigations of UBA5 variants in the brain and highlights promising approaches to alleviate cellular aberrations for this rare, developmental disorder.

Engineering cell factories that support the production of large quantities of protein therapeutics remains a significant biomanufacturing challenge. The overexpression of secretory proteins causes proteotoxic stress, affecting cell viability and protein productivity. Proteotoxic stress leads to the activation of the Unfolded Protein Response (UPR), a series of signal transduction pathways regulating protein quality control mechanisms aimed at restoring homeostasis. Sustained UPR activation culminates with the induction of apoptosis. Current strategies for enhancing the production of therapeutic proteins have focused on the deregulated modulation of key components of the UPR. These strategies have resulted in limited and often protein-specific improvements as they may lead to adaptation and cell toxicity and do not account for natural population heterogeneities. We report here feedback-responsive cell factories that sense proteotoxic stress and, in response, modulate the UPR to enhance stress attenuation and delay cell death, addressing the limitations of current strategies. We demonstrate that our cell engineering approach enables dynamic UPR modulation upon proteotoxic stress. The sense-and-respond systems that mediate dynamic UPR modulation enhance the production of the therapeutic enzyme tissue plasminogen activator and the bispecific antibody blinatumomab. Our feedback-responsive cell factories provide an innovative strategy for dynamically adjusting the innate cellular stress response and enhancing therapeutic protein manufacturing.

Membrane remodeling is essential for numerous cellular functions. Although liquid-liquid phase separation (LLPS) of intrinsically disordered region (IDR)-rich proteins could drive dramatic membrane remodeling of artificial giant unilamellar vesicles, it remains elusive whether LLPS-mediated membrane-remodeling functions in live cells and what role it plays in specific bioprocesses. Here, we show that three IDR-rich integral transmembrane fusion proteins (MFPs), generated by chromosomal translocations, can lead to de novo remodeling of their located membranous organelles. Taking FUS-CREB3L2, prevalent in low-grade fibromyxoid sarcoma (LGFMS), as a proof of concept, we recorded super-resolution long-time imaging of endoplasmic reticulum (ER) remodeling dynamics as accumulating FUS-CREB3L2, meanwhile causing spontaneous ER stress to hijack the X-box-binding protein 1 (XBP1) pathway. We further reveal the underlying mechanisms of how FUS-CREB3L2 transduces its tumorigenic signals and aberrant LLPS effects from the ER membrane into the nucleus autonomously, which activates hundreds of LGFMS-specific genes de novo compared with CREB3L2, thus sufficiently reprogramming the cells into an LGFMS-like status.

This study aimed to compare maternal and cord serum X box binding protein 1 (XBP-1) levels in pregnant women with fetal growth restriction (FGR) with healthy pregnancies.

This prospective case-control study was conducted between January 1, 2022, and May 31, 2022, at the Gynecology and Obstetrics Clinic of Selçuk University Faculty of Medicine Hospital. Forty-three pregnant women and fetuses with isolated FGR with abdominal circumference (AC) or estimated fetal weight (EFW) below the 10th percentile according to ultrasonographic measurements constituted the study group; 43 healthy pregnant women and fetuses constituted the control group. Serum XBP-1 levels in prenatal maternal and cord blood were measured by ELISA and compared between the two groups.

The mean maternal blood XBP-1 level was 1910.22 ± 607.07 ng/L in the FGR group and 1638.89 ± 385.80 ng/L in the control group (p = 0.044). Cord blood XBP-1 levels were 1837.72 ± 942.67 and 1346.14 ± 664.09 ng/L in the study and control groups, respectively (p = 0.006). Maternal XBP-1 levels were found to discriminate FGR with a sensitivity of 80% and specificity of 60% at a value of 1405 ng/L. For cord blood XBP-1, 869.2 ng/L was the best cut-off, with 98% sensitivity and 67% specificity. In ROC analysis, the area under the curve was found to be 0.626 and 0.671, and p values were found to be 0.044 and 0.006 for maternal serum XBP-1 and cord blood XBP-1, respectively.

In the study, serum XBP-1 levels in both maternal and fetal umbilical cord blood were found to be higher in patients with FGR. Considering the role of XBP-1 in metabolic pathways and cellular functions, XBP-1 may have an important role in the pathophysiology of FGR.

Multiple myeloma (MM) is an incurable hematologic malignancy. While recent therapies have significantly improved survival in MM patients, drug resistance and refractory phenomenon underscores the urgent need of new therapeutic targets. Methylenetetrahydrofolate dehydrogenase 2(MTHFD2) has been widely reported as a potential and promising anti-cancer target, but its role and underlying mechanisms remain unclear in MM. We aimed to investigate the biologic function and mechanisms of MTHFD2 in MM. First, we demonstrated that MTHFD2 is overexpressed in MM and associated with poor prognosis. We then illustrated that targeting MTHFD2 exhibits anti-MM effects in vitro and in vivo. Mechanistically, targeting MTHFD2 inhibited glycolysis and mitochondrial respiration in MM cells. For the nonmetabolic function of MTHFD2, we found that MTHFD2 knockdown affected the unfolded protein response (UPR) via decreasing expression of the splice form of X-box binding protein 1 (XBP1s). Importantly, the level of MTHFD2 in MM cells was associated with sensitivity of bortezomib, and targeting MTHFD2 synergizes with bortezomib against MM in vitro and in vivo. In summary, our innovative findings suggest that MTHFD2 is a promising target for MM, targeting it alters metabolic homeostasis of MM and synergizes with bortezomib to inhibit MM.

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease that primarily affects the motor neurons, causing progressive muscle weakness and paralysis. While research has focused on understanding pathological mechanisms in the motor cortex and spinal cord, there is growing evidence that extra-motor brain regions may also play a role in the pathogenesis or progression of ALS.

We generated 165 sample-matched post-mortem brain transcriptomes from 22 sporadic ALS patients with pTDP-43 pathological staging and 11 non-neurological controls. For each individual, five brain regions underwent mRNA sequencing: motor cortex (pTDP-43 inclusions always present), prefrontal cortex and hippocampus (pTDP-43 inclusions sometimes present), and occipital cortex and cerebellum (pTDP-43 inclusions rarely present). We examined gene expression, cell-type composition, transcript usage (% contribution of a transcript to total gene expression) and alternative splicing, comparing ALS-specific changes between brain regions. We also considered whether post-mortem pTDP-43 pathological stage classification defined ALS subgroups with distinct gene expression profiles.

Significant gene expression changes were observed in ALS cases for all five brain regions, with the cerebellum demonstrating the largest number of total (> 3,000) and unique (60%) differentially expressed genes. Pathway enrichment and predicted activity were largely concordant across brain regions, suggesting that ALS-linked mechanisms, including inflammation, mitochondrial dysfunction and oxidative stress, are also dysregulated in non-motor brain regions. Switches in transcript usage were identified for a small set of genes including increased usage of a POLDIP3 transcript, associated with TDP-43 loss-of-function, in the cerebellum and a XBP1 transcript, indicative of unfolded protein response activity, in the motor cortex. Extensive variation in RNA splicing was identified in the ALS brain, with 26-41% of alternatively spliced genes unique to a given brain region. This included detection of TDP-43-associated cryptic splicing events such as the STMN2 cryptic exon which was shown to have a pTDP-43 pathology-specific expression pattern. Finally, ALS patients with stage 4 pTDP-43 pathology demonstrated distinct gene and protein expression changes in the cerebellum.

Together our findings highlighted widespread transcriptome alterations in ALS post-mortem brain and showed that, despite the absence of pTDP-43 pathology in the cerebellum, extensive and pTDP-43 pathological stage-specific RNA changes are evident in this brain region.

The unfolded protein response (UPR) is activated primarily upon alteration of protein folding in the endoplasmic reticulum (ER). This occurs under physiological situations that cause an abrupt increase in protein synthesis, or under redox and metabolic stresses. Among the latter, hyperglycemia and glucose scarcity have been identified as major modulators of UPR signaling. Indeed, the first mammalian UPR effector, the glucose-regulated protein 78, also known as BiP, was identified in response to glucose deprivation. Tunicamycin, arguably the most commonly used drug to induce ER stress responses in vitro and in vivo, is an inhibitor of N-glycosylation. We compile here evidence that the UPR is activated upon physiological and pathological conditions that alter glucose levels and that this is mostly mediated by alterations of protein N-glycosylation, ATP levels, or redox balance. The three branches of the UPR transduced by PERK/ATF4, IRE1/XBP1s, and ATF6, as well as non-canonical ER sensors such as SCAP/SREBP, sense ER protein glycosylation status driven by glucose and other glucose-derived metabolites. The outcomes of UPR activation range from restoring protein N-glycosylation and protein folding flux to stimulating autophagy, organelle recycling, and mitochondrial respiration, and in some cases, cell death. Anabolic responses to glucose levels are also stimulated by glucose through components of the UPR. Therefore, the UPR should be further studied as a potential biomarker and mediator of glucose-associated diseases.

Neurodegenerative diseases are characterized by the localized loss of neurons. Why cell death is triggered only in specific neuronal populations and whether it is the response to toxic insults or the initial cellular state that determines their vulnerability is unknown. To understand individual cell responses to disease, we profiled their transcriptional signatures throughout disease development in a Drosophila model of C9orf72 (G4C2) repeat expansion (C9), the most common genetic cause of frontotemporal dementia and amyotrophic lateral sclerosis. We identified neuronal populations specifically vulnerable or resistant to C9 expression and found an upregulation of protein homeostasis pathways in resistant neurons at baseline. Overexpression of Xbp1s, a key regulator of the unfolded protein response and a central node in the resistance network, rescues C9 toxicity. This study shows that neuronal vulnerability depends on the intrinsic transcriptional state of neurons and that leveraging resistant neurons' properties can boost resistance in vulnerable neurons.

The role of copper in tumor progression is thought to be a double-edged sword. Moderate levels of copper promote tumor progression, while excess copper induces a novel form of programmed cell death known as cuproptosis. However, the relationship between lung adenocarcinoma (LUAD) and cuproptosis remains poorly understood. Copper colorimetric assay identified the progression of LUAD simultaneous associated with higher copper accumulation. Single-cell RNA sequencing further identified the activation of unfolded protein response correlates with copper accumulation, particularly the spliced form of XBP1 (XBP1s). XBP1s negatively regulates the protein level of LIPT1 to inhibit LUAD cell death induced by copper-loaded ionophore elesclomol. CUT&Tag-seq and chromosome conformation capture (3 C) experiment showed that XBP1s affect the frequency of MGRN1 promoter-enhancer interactions in various copper environments by forming super-enhancers. Additionally, MGRN1 promotes the ubiquitination and degradation of LIPT1, which in turn supports glycolysis in LUAD cells. In mouse xenograft models, overexpression of XBP1s significantly inhibits the cuproptosis induced by copper ionophores. Co-administration with SEs inhibitor and copper ionophore also markedly reduced tumor volume and growth rate. Our study sheds light on the molecular mechanism by which XBP1s affect the cuproptosis through super-enhancers formation in LUAD and suggested the potential clinical value of copper ionophore as well as a potential biomarker XBP1s for treatment response.

Pathogenic fungal infections cause significant morbidity and mortality, particularly in immunocompromised patients. The frequent emergence of multidrug-resistant strains challenges existing antifungal therapies, driving the need to investigate novel antifungal agents that target new molecular moieties. Pathogenic fungi are subjected to various environmental stressors, including pH, temperature, and pharmacological agents, both in natural habitats and the host body. These stressors elevate the risk of misfolded or unfolded protein production within the endoplasmic reticulum (ER) which, if not promptly mitigated, can lead to the accumulation of these proteins in the ER lumen. This accumulation triggers an ER stress response, potentially jeopardizing fungal survival. The unfolded protein response (UPR) is a critical cellular defense mechanism activated by ER stress to restore the homeostasis of protein folding. In recent years, the regulatory role of the UPR in pathogenic fungi has garnered significant attention, particularly for its involvement in fungal adaptation, regulation of virulence, and drug resistance. In this review, we comparatively analyze the UPRs of fungi and mammals and examine the potential utility of the UPR as a molecular antifungal target in pathogenic fungi. By clarifying the specificity and regulatory functions of the UPR in pathogenic fungi, we highlight new avenues for identifying potential therapeutic targets for antifungal treatments.

Cystic fibrosis (CF) is a genetic disease due to mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The most frequent mutation (p.Phe508del) results in a misfolded protein (p.Phe508del-CFTR) with an altered transport to the membrane of the cells via the conventional protein secretion (CPS) pathway. Nevertheless, it can use unconventional protein secretion (UPS). Indeed, p.Phe508del-CFTR forms a complex with GRASP55 to assist its direct trafficking from the endoplasmic reticulum to the plasma membrane. While GRASP55 is a key player of UPS, it is also a key player of stress-induced autophagy. In parallel, the unfolded protein response (UPR), which is activated in the presence of misfolded proteins, is tightly linked to UPS and autophagy through the key effectors IRE1, PERK, and ATF6. A better understanding of how UPS, UPR, and stress-induced autophagy interact to manage protein trafficking in CF and other conditions could lead to novel therapeutic strategies. By enhancing or modulating these pathways, it may be possible to increase p.Phe508del-CFTR surface expression. In summary, this review highlights the critical roles of UPS- and UPR-induced autophagy in managing protein transport, offering new perspectives for therapeutic approaches.

The endoplasmic reticulum (ER) is an essential sensing organelle responsible for the folding and secretion of almost one-third of eukaryotic cells' total proteins. However, environmental, chemical, and genetic insults often lead to protein misfolding in the ER, accumulating misfolded proteins, and causing ER stress. To solve this, several mechanisms were reported to relieve ER stress by decreasing the ER protein load. Recently, we reported a novel ER surveillance mechanism by which proteins from the secretory pathway are refluxed to the cytosol to relieve the ER of its content. The refluxed proteins gain new prosurvival functions in cancer cells, thereby increasing cancer cell fitness. We termed this phenomenon ER to CYtosol Signaling (or 'ERCYS'). Here, we found that in mammalian cells, ERCYS is regulated by DNAJB12, DNAJB14, and the HSC70 cochaperone SGTA. Mechanistically, DNAJB12 and DNAJB14 bind HSC70 and SGTA - through their cytosolically localized J-domains to facilitate ER-protein reflux. DNAJB12 is necessary and sufficient to drive this phenomenon to increase AGR2 reflux and inhibit wt-p53 during ER stress. Mutations in DNAJB12/14 J-domain prevent the inhibitory interaction between AGR2-wt-p53. Thus, targeting the DNAJB12/14-HSC70/SGTA axis is a promising strategy to inhibit ERCYS and impair cancer cell fitness.

Most available evidence points to a proviral role for endoplasmic reticulum (ER) stress, as many viruses exploit it to promote viral replication. In contrast, few studies have linked ER stress to the antiviral immune response, and even fewer to the vaccine-induced immune response. In this work, we demonstrated that ER stress is a key molecular link in the immune response of teleost erythrocytes or red blood cells (RBCs) under vaccine stimulation. Moreover, the unfolded protein response (UPRER) triggered by ER stress may work together with autophagy and related cellular mechanisms as part of a coordinated immune response in RBCs. We unveiled biochemical changes in the lipid-protein profile of vaccine-treated RBCs by synchrotron radiation-based Fourier transform infrared microspectroscopy (SR-µFTIR) associated with the modulation of ER expansion, increased mitochondrial number, and vesicular structures detected by soft X-ray cryotomography (cryo-SXT). We found a positive correlation between both morphological and biochemical changes and the expression of genes related to UPRER, autophagy, mitochondrial stress, vesicle trafficking, and extracellular vesicle release. These processes in RBCs are ideal cellular targets for the development of more specific prophylactic tools with greater immunogenic capacity than currently available options.

Murine double minute 2 (MDM2), a key negative regulator of p53, forms a feedback loop with p53 to drive tumor progression, including colorectal cancer. Nutlin-3a, an MDM2 inhibitor, induces apoptosis in wild-type p53 tumors, but its effects on p53-mutated cancers and potential p53-independent apoptotic mechanisms remain unclear.

We investigated Nutlin-3a's effects on colon cancer cells with varying p53 phenotypes. Endoplasmic reticulum (ER) stress-associated CHOP was detected and knocked down to explore mechanisms. In vitro and in vivo experiments assessed Nutlin-3a's synergy with 5-fluorouracil and TRAIL.

Nutlin-3a activated caspase-8-dependent extrinsic apoptosis in colon cancer cells via DR5 upregulation, independent of p53 status. ER stress and CHOP activation mediated DR5 induction, driven by calcium release. Combined Nutlin-3a treatment enhanced sensitivity to 5-fluorouracil and TRAIL in vitro and in vivo through caspase-8 pathway activation.

These findings reveal a novel p53-independent apoptotic mechanism of Nutlin-3a involving ER stress and death receptor signaling. This pathway highlights Nutlin-3a's potential as an adjuvant therapy for colon cancer, even in p53-mutated tumors, by enhancing chemotherapeutic efficacy through extrinsic apoptosis.

Pharmacological enhancement of endoplasmic reticulum (ER) proteostasis is an attractive strategy to mitigate pathology linked to etiologically-diverse protein misfolding diseases. However, despite this promise, few compounds have been identified that enhance ER proteostasis through defined mechanisms of action. We previously identified the phenylhydrazone-based compound AA263 as a compound that promotes adaptive ER proteostasis remodeling through mechanisms including activation of the ATF6 signaling arm of the unfolded protein response (UPR). However, the protein target(s) of AA263 and the potential for further development of this class of ER proteostasis regulators had not been previously explored. Here, we employ chemical proteomics to demonstrate that AA263 covalently targets a subset of ER protein disulfide isomerases, revealing a molecular mechanism for the activation of ATF6 afforded by this compound. We then use medicinal chemistry to establish next-generation AA263 analogs showing improved potency and efficacy for ATF6 activation, as compared to the parent compound. Finally, we show that treatment with these AA263 analogs enhances secretory pathway proteostasis to correct the pathologic protein misfolding and trafficking of both a destabilized, disease-associated α1-antitrypsin (A1AT) variant and an epilepsy-associated GABA A receptor variant. These results establish AA263 analogs with enhanced potential for correcting imbalanced ER proteostasis associated with etiologically-diverse protein misfolding disorders.

Activating autophagy may be therapeutically beneficial, and we have previously shown that azathioprine (AZA), an immunomodulatory drug, induces autophagy. Here, we evaluated the induction of autophagy by the thiopurines AZA, mercaptopurine (6-MP) and thioguanine (6-TG) in THP-1 macrophages and investigated the mechanism of action in the context of this cellular process. The cytotoxicity of thiopurines was evaluated using an LDH assay. Induction of endogenous LC3 by thiopurines was evaluated using immunostaining. To confirm autophagy activation by thiopurines, a GFP-RFP-LC3 reporter plasmid was used to monitor the maturation of autophagosomes to autolysosomes. Induction of apoptosis by thiopurines was evaluated using Annexin V/PI staining, and ER stress was assessed via RT‒PCR analysis of XBP1 splicing. To gain insight into the mechanism of action of thiopurines, mTORC1 activity and eIF2α-S51 phosphorylation were evaluated by immunoblotting. Thiopurines were not cytotoxic to cells and induced strong time- and concentration-dependent autophagy. Thiopurines activate autophagy with complete progression through the pathway. Induction of autophagy by thiopurines occurred independently of apoptosis and ER stress. Immunoblotting revealed that AZA inhibited mTORC1 activity, and AZA and 6-TG increased eIF2α-S51 phosphorylation. In contrast, 6-MP had a minor effect on either signalling pathway. Thiopurines are strong inducers of autophagy, and autophagy induction should be considered among the mechanisms responsible for patient response to thiopurines.

The present study explores the x-box binding protein 1 (xbp1) gene in Haliotis discus hannai (Pacific abalone), focusing on its structure, expression, and functional role under heat stress. Southern blot revealed two copies of xbp1 in the intestine and mantle, one in the gill and muscle, and no detection in the digestive gland. mRNA expression level of xbp1 was highest in the gill, followed by the mantle, intestine, and muscle, with the digestive gland showing the lowest expression. Actinomycin D treatment demonstrated that xbp1 mRNA stability varied among tissues, with slower degradation in the gill and mantle, while rapid degradation was observed in the digestive gland. Heat stress caused a 20 bp fragment removal from xbp1 mRNA, producing spliced xbp1 (xbp1s), with a conserved inositol-requiring enzyme 1α (IRE1α) cleavage motif (5'- CAGCACCUGCUGAUCCUCUG -3'). Genome walking was used to obtain the promoter sequences of downstream genes regulated by xbp1s. Through sequence conservation analysis, the binding sites of xbp1s on these promoters were identified in Pacific abalone. Yeast one-hybrid (Y1H) assays confirmed xbp1s binding to these sites, and morpholino oligonucleotides (MO) treatment effectively suppressed xbp1s production. Western blot analysis demonstrated that heat stress induced the expression of HDEL-related proteins, while MO injection significantly reduced their expression under both basal and heat stress conditions. Immunofluorescence analysis revealed decreased endoplasmic reticulum (ER) chaperone glucose-regulated protein 78 (GRP78) levels and increased apoptosis in MO-treated abalone under heat stress, suggesting a compromised ER stress response. These findings underscore XBP1's crucial role in regulating ER stress management and apoptotic processes, providing new insights into the functional significance of xbp1 in abalone's response to thermal stress.

Endoplasmic reticulum (ER) is a specialized organelle that plays a significant role in cellular function. The major functions of ER include protein synthesis and transport, folding of proteins, biosynthesis of lipids, calcium (Ca2+) storage, and redox balance. The loss of ER integrity results in the induction of ER stress within the cell due to the accumulation of unfolded, improperly folded proteins or changes in Ca2+ metabolism and redox balance of organelle. This ER stress commences the Unfolded Protein Response (UPR) that serves to counteract the ER stress via three sensors inositol requiring protein-1 (IRE1), protein kinase RNA-like ER kinase (PERK), and activating transcription factor-6 (ATF6) that serve to establish ER homeostasis and alleviates ER stress. Severe ER dysfunction ultimately results in the induction of apoptosis. Increasing shreds of evidence suggest the implication of ER stress in the development and progression of several diseases viz. tuberculosis, malaria, Alzheimer's disease, Parkinson's disease, diabetes, and cancer. Activation of ER stress can be beneficial for treating some diseases while inhibiting the process can be useful in others. A deeper understanding of these pathways can provide key insights in designing novel therapeutics to treat these diseases.

IgE induces stronger ER stress than IgG1 due to its constant region, particularly the Cε3 domain, which binds BiP more efficiently. Genetic and structural analyses confirmed IgE's higher BiP-binding capacity. ER stress, driven by IRE1-XBP1 signaling, regulates plasma cell differentiation, suggesting IgE-specific mechanisms in immune responses.

Aims: Thyroid hormones (TH) are major regulators of cell differentiation, growth, and metabolic rate. TH synthesis in the thyroid gland requires high amounts of H2O2 to oxidize iodide for the iodination of thyroglobulin (TG). Retinol Saturase (RetSat) is an oxidoreductase implicated in dihydroretinol formation and cellular sensitivity toward peroxides and ferroptosis. RetSat is highly expressed in metabolically active organs where it regulates lipid metabolism and the production of reactive oxygen species. Due to the high expression of RetSat in the thyroid gland and its role in peroxide sensitivity, we investigated the regulation and function of RetSat in the thyroid gland in appropriate mouse models. Results: RetSat is strongly expressed in thyrocytes, induced by hypothyroidism, and decreased by iodide overload in mice. Thyrocyte-specific deletion of RetSat increased circulating thyroid-stimulating hormone levels, altered thyroid morphology, and disturbed metabolic homeostasis in a diet- and sex-dependent manner without major effects on the concentrations of circulating TH. Moreover, deletion of RetSat increased TG protein levels but lowered TG iodination upon iodide overload. In cultured thyrocytes, acute RetSat depletion altered the expression of genes involved in TH biosynthesis and the response to endoplasmic reticulum stress. Innovation: This is the first report that specifically dissects the regulation and function of the oxidoreductase RetSat in the thyroid gland. Conclusion: Deletion of RetSat in thyrocytes induces compensatory feedback mechanisms to maintain TH homeostasis in mice. We conclude that RetSat in the thyroid gland is required for TH biosynthesis and secretion and metabolic homeostasis in mice. Antioxid. Redox Signal. 42, 463-479.

Begomoviruses are a group of single stranded DNA plant viruses exclusively transmitted by the sweet potato whitefly Bemisia tabaci in a persistent, circulative manner. After acquisition from plant phloem, this group of viruses circulate and are retained within the whitefly, interacting with tissues, cells and molecular pathways for maintaining the safety of the infective intact virions, by exploiting cellular mechanisms and avoiding degradation by the insect immune responses. During retention, the virions are internalized in the midgut cells, exit and spend hours-days in the hemolymph and cross into salivary gland cells, before transmission. Destroying this group of viruses by the insect immune system seems inefficient for the most part, by examining their very efficient transmission. Thus, within the various sites along the transmission pathway especially in the midgut, it is thought that the immune system with its various layers is activated for avoiding the damage caused by the viruses on one hand, and for ensuring their safe circulation and transmission on the other hand. Begomoviruses have evolved mechanisms for counteracting and exploiting the activated immune system for their safe translocation within the whitefly. In this review, we discuss the various levels of immunity activated against begomoviruses in B. tabaci, taking other pathogen-vector systems as examples and reflecting relevant components on the interactions between B. tabaci and Begomoviruses.

The endoplasmic reticulum (ER) plays a crucial role in protein synthesis, folding and quality control. Disruptions in these processes lead to ER stress (ERS) and activate the unfolded protein response (UPR) to restore cellular homeostasis. In gastrointestinal cancers, inositol-requiring enzyme 1α (IRE1α) is a key regulator of the UPR, enabling cancer cells to adapt to hostile conditions such as hypoxia, oxidative stress and chemotherapy. Elevated IRE1α activity supports tumor survival, progression and metastasis by mitigating ERS-induced apoptosis. However, targeting IRE1α signaling presents a promising therapeutic strategy by impairing cancer cell adaptation to stress, offering promising therapeutic opportunities for gastrointestinal cancers.

SUMMARYHuman coronaviruses cause a range of respiratory diseases, from the common cold (HCoV-229E, HCoV-NL63, HCoV-OC43, and SARS-CoV-2) to lethal pneumonia (SARS-CoV, SARS-CoV-2, and MERS-CoV). Coronavirus interactions with host innate immune antiviral responses are an important determinant of disease outcome. This review compares the host's innate response to different human coronaviruses. Host antiviral defenses discussed in this review include frontline defenses against respiratory viruses in the nasal epithelium, early sensing of viral infection by innate immune effectors, double-stranded RNA and stress-induced antiviral pathways, and viral antagonism of innate immune responses conferred by conserved coronavirus nonstructural proteins and genus-specific accessory proteins. The common cold coronaviruses HCoV-229E and -NL63 induce robust interferon signaling and related innate immune pathways, SARS-CoV and SARS-CoV-2 induce intermediate levels of activation, and MERS-CoV shuts down these pathways almost completely.

Proteasomes maintain cellular homeostasis by degrading abnormal proteins, while cancer cells exploit them for survival, becoming a key chemotherapeutic target. Bortezomib (BTZ), a reversible proteasomal inhibitor, is a front-line treatment for multiple myeloma, mantle cell lymphoma, and non-small cell lung cancer. However, its efficacy is limited by severe side effects, including neurotoxicity and cardiovascular distress, with its toxicity mechanisms largely unexplored. Here, we discover that Bortezomib (BTZ), is cytotoxic to non-cancerous cells distinctly from Carfilzomib (CFZ), the second-line irreversible PI. BTZ or CFZ is administered intravenously, impacting blood vessel (vascular) endothelial cells. We used human pulmonary microvascular endothelial cells (HPMECs) to demonstrate that BTZ but not CFZ elicits endoplasmic reticulum (ER) stress, mitochondrial membrane compromise, mitochondrial reactive oxygen species (ROS) accumulation, and Caspase (CASP)9 activation (mediator of Intrinsic apoptosis) within fifteen hours of treatment. By twenty-four hours, BTZ-treated cells display cleavage of CASP8 (mediator of extrinsic apoptosis), activation of CASP3 (terminal executioner of apoptosis), cell-death and vascular barrier loss. Pan-caspase inhibitor zVAD significantly rescues BTZ-treated cells from cytotoxicity. Both BTZ and CFZ effectively kill MM cells. These findings reveal novel insights into fundamental signaling of regular cells where reversible inhibition of the proteasome dictates a unique cascade of stress distinct from irreversible inhibition. These harmful effects of BTZ emphasize the need to re- evaluate its use as a frontline chemotherapy for MM.

Reversible proteasomal inhibitor Bortezomib is cytotoxic to non-cancerous, microvascular endothelial cellsIn endothelial cells, Bortezomib, but not irreversible inhibitor Carfilzomib, activates temporal cascade of caspases (Caspase-9, Caspase-8, Caspase-3) triggering apoptosisCaspase activation results from ER stress (via the IRE1α-CHOP) pathway and mitochondrial stress (ROS accumulation) independently from contribution from extrinsic signal via TNFBortezomib-dependent cytotoxicity compromises endothelial barrier potential.

Neurobrucellosis represents a severe complication of brucellosis, posing a considerable risk to human health and quality of life. This condition arises from an increased susceptibility to chronic Brucella infection, a significant clinical challenge. One key factor contributing to chronic neurobrucellosis is the regulation of microglial apoptosis by Brucella; however, the exact molecular mechanisms remain largely unresolved. In this study, human microglial clone 3 (HMC3) cells were infected with Brucella suis vaccine strain S2 (B. suis S2) at varying multiplicity of infection (MOI) and durations to assess its effects on the IRE1/caspase-12/caspase-3 signaling pathway. Following the suppression of this pathway by B. suis S2, calreticulin (CALR) was identified through ubiquitin-modified proteomics (data accessible via ProteomeXchange, identifier PXD056006). To further investigate, CALR-overexpression and knockdown HMC3 cell lines were infected with B. suis S2 to elucidate the mechanism by which B. suis S2 inhibits apoptosis in HMC3 cells. In conclusion, our findings demonstrate that B. suis S2 suppresses HMC3 cell apoptosis via the IRE1/caspase-12/caspase-3 pathway by modulating CALR ubiquitination. This study provides a theoretical basis for exploring the mechanisms of neurobrucellosis and offers insights into its clinical treatment.IMPORTANCENeurobrucellosis is a severe complication impacting the central nervous system (CNS) due to neurological deficits caused by Brucella, with primary clinical features including meningitis, encephalitis, brain abscesses, and demyelinating lesions. These nonspecific symptoms often lead to misdiagnosis or delayed diagnosis, increasing the risk of recurrent or chronic neurobrucellosis infections. Consequently, persistent infection and relapse are critical challenges in the clinical management of neurobrucellosis, which are closely linked to Brucella's survival and replication within microglia. Interestingly, Brucella may inhibit microglia apoptosis by mitigating endoplasmic reticulum (ER) stress, though the precise molecular mechanisms remain largely unexplored. Thus, this study will elucidate the specific mechanisms by which Brucella suppresses microglial apoptosis and provide deeper insights into the molecular pathogenesis and clinical treatment of neurobrucellosis.

The ability to quantitatively study mRNA translation using SunTag imaging is transforming our understanding of the translation process. Here, we expand the SunTag method to study new aspects of translation regulation in Drosophila. Repression of the maternal hunchback (hb) mRNA in the posterior of the Drosophila embryo is a textbook example of translational control. Using SunTag imaging to quantify translation of maternal SunTag-hb mRNAs, we show that repression in the posterior is leaky, as ∼5% of SunTag-hb mRNAs are translated. In the anterior of the embryo, the maternal and zygotic SunTag-hb mRNAs show similar translation efficiency despite having different untranslated regions (UTRs). We demonstrate that the SunTag-hb mRNA can be used as a reporter to study ribosome pausing at single-mRNA resolution, by exploiting the conserved xbp1 mRNA and A60 pausing sequences. Finally, we adapt the detector component of the SunTag system to visualise and quantify translation of the short gastrulation (sog) mRNA, encoding an essential secreted extracellular BMP regulator, at the endoplasmic reticulum in fixed and live embryos. Together, these tools will facilitate the future dissection of translation regulatory mechanisms during development.

Vascular endothelial growth factor B186 (VEGF-B186), a ligand for VEGF receptor 1 (VEGFR1) and neuropilin (NRP), promotes vascular growth in healthy and ischemic myocardium. However, the mechanisms and signaling of VEGF-B186 to support angiogenesis have remained unclear. We studied the effects of VEGF-B186 and its variant, VEGF-B186R127S, which cannot bind to NRPs, using VEGFR1 tyrosine kinase knockout (TK-/-) mice to explore the mechanism of VEGF-B186 in promoting vascular growth. Ultrasound-guided adenoviral VEGF-B186, VEGF-B186R127S, and control vector gene transfers were performed into VEGFR1 TK-/- mice hearts. In vitro studies in cardiac endothelial cells and further validation in normal and ischemic pig hearts, as well as in wild-type mice, were conducted. Both VEGF-B186 forms promoted vascular growth in VEGFR1 TK-/- mouse heart and increased the expression of proangiogenic and hematopoietic factors. Unlike VEGF-A, VEGF-B186 forms induced endoplasmic reticulum (ER) stress via the upregulation of Binding immunoglobulin Protein (BiP) as well as ER stress sensors (ATF6, PERK, IRE1α) through ITGAV and ITGA5 integrins, newly identified receptors for VEGF-B, activating the unfolded protein response (UPR) through XBP1. VEGFR1 and NRP are not essential for VEGF-B186-induced vascular growth. Instead, VEGF-B186 can stimulate cardiac regeneration through RGD-binding integrins and ER stress, suggesting a novel mechanism of action for VEGF-B186.

The endoplasmic reticulum (ER), an elaborate cellular organelle that interweaves the cytosol, nucleus, mitochondria and plasma membrane, is essential for cell function and survival. Disruption of ER function can trigger unfolded protein response (UPR), which is activated by ER stress (ERS). In this study, we investigated the role of ERS in cell apoptosis induced by duck hepatitis A virus type 1 (DHAV-1) infection. Our findings revealed that DHAV-1 infection led to the activation of ERS. Specially, the expression of glucose-regulated protein 78 (GRP78) was upregulated, activating two pathways of UPR: the protein kinase R-like ER kinase (PERK) pathway and the inositol-requiring enzyme 1(IRE1) pathway. Consequently, phosphorylation of eukaryotic initiation factor 2 alpha (p-eIF2α) was increased, and transcription factor 4 (ATF4) was up-regulated, resulting in the induction of the apoptotic C/EBP homologous protein (CHOP). DHAV-1-infected cells exhibited various apoptotic phenotypes, including growth arrest, induction of the DNA damage-inducible protein 34 (GADD34), activation of caspase-3, and suppression of antiapoptotic protein B cell lymphoma-2 (Bcl-2). Importantly, inhibition of PERK or protein kinase R (PKR) activity suppressed CHOP activation and DHAV-1 replication, indicating that the PERK/PKR-eIF2α pathway played a crucial role in ERS-induced apoptosis. Collectively, our study provides novel insights into the mechanism of DHAV-1-induced apoptosis and reveals a potential defense mechanism against DHAV-1 replication.

Skin wound healing is a dynamic process consisting of multiple cellular and molecular events that must be tightly coordinated to repair the injured tissue efficiently. The healing pace is decided by the type of injuries, the depth and size of the wounds, and whether wound infections occur. However, aging, comorbidities, genetic factors, hormones, and nutrition also impact healing outcomes. During wound healing, cells undergo robust processes of synthesizing new proteins and degrading multifunctional proteins. This imposes an increasing burden on the endoplasmic reticulum (ER), causing ER stress. Unfolded protein response (UPR) represents a collection of highly conserved stress signaling pathways originated from the ER to maintain protein homeostasis and modulate cell physiology. UPR is known to be beneficial for tissue healing. However, when excessive ER stress exceeds ER's folding potential, UPR pathways trigger cell apoptosis, interrupting tissue regeneration. Understanding how UPR pathways modulate the skin's response to injuries is critical for new interventions toward the control of acute and chronic wounds. Herein, in this review, we focus on the participation of the canonical and noncanonical UPR pathways during different stages of wound healing, summarize the available evidence demonstrating UPR's unique position in balancing homeostasis and pathophysiology of healing tissues, and highlight the understudied areas where therapeutic opportunities may arise.

[Figure: see text].

The unfolded protein response (UPR) is a complex intracellular signal transduction system that orchestrates the cellular response during Endoplasmic Reticulum (ER) stress conditions to reestablish cellular proteostasis. If, on one side, prolonged ER stress conditions can lead to programmed cell death and autophagy as a cytoprotective mechanism, on the other, unresolved ER stress and improper UPR activation represent a perilous condition able to trigger or exacerbate inflammatory responses. Notably, intestinal and immune cells experience ER stress physiologically due to their high protein secretory rate. Indeed, there is evidence of UPR's involvement in both physiological and pathological intestinal conditions, while less is known about its bidirectional interaction with gut microbiota. However, gut microbes and their metabolites can influence ER stress and UPR pathways, and, in turn, ER stress conditions can shape gut microbiota composition, with important implications for overall intestinal health. Thus, targeting UPR components is an intriguing strategy for treating ER stress-linked dysbiosis and diseases, particularly intestinal inflammation.

The endoplasmic reticulum (ER) is an important organelle that controls the intracellular and extracellular environments. The ER is responsible for folding almost one-third of the total protein population in the eukaryotic cell. Disruption of ER-protein folding is associated with numerous human diseases, including metabolic disorders, neurodegenerative diseases, and cancer. During ER perturbations, the cells deploy various mechanisms to increase the ER-folding capacity and reduce ER-protein load by minimizing the number of substrates entering the ER to regain homeostasis. These mechanisms include signaling pathways, degradation mechanisms, and other processes that mediate the reflux of ER content to the cytosol. In this review, we will discuss the recent discoveries of five different ER quality control mechanisms, including the unfolded protein response (UPR), ER-associated-degradation (ERAD), pre-emptive quality control, ER-phagy and ER to cytosol signaling (ERCYS). We will discuss the roles of these processes in decreasing ER-protein load and inter-mechanism crosstalk.