|
1
|
Huang D, Li X, Pan M, Liu Y, Qin G, Chen Z, Yu X, Mai K, Zhang W. Comprehensive analysis of the xbp1 gene in Pacific abalone Haliotis discus hannai: Structure, expression, and role in heat stress response. Int J Biol Macromol 2025; 298:139771. [PMID: 39800022 DOI: 10.1016/j.ijbiomac.2025.139771] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/27/2024] [Revised: 01/07/2025] [Accepted: 01/09/2025] [Indexed: 01/15/2025]
Abstract
The present study explores the x-box binding protein 1 (xbp1) gene in Haliotis discus hannai (Pacific abalone), focusing on its structure, expression, and functional role under heat stress. Southern blot revealed two copies of xbp1 in the intestine and mantle, one in the gill and muscle, and no detection in the digestive gland. mRNA expression level of xbp1 was highest in the gill, followed by the mantle, intestine, and muscle, with the digestive gland showing the lowest expression. Actinomycin D treatment demonstrated that xbp1 mRNA stability varied among tissues, with slower degradation in the gill and mantle, while rapid degradation was observed in the digestive gland. Heat stress caused a 20 bp fragment removal from xbp1 mRNA, producing spliced xbp1 (xbp1s), with a conserved inositol-requiring enzyme 1α (IRE1α) cleavage motif (5'- CAGCACCUGCUGAUCCUCUG -3'). Genome walking was used to obtain the promoter sequences of downstream genes regulated by xbp1s. Through sequence conservation analysis, the binding sites of xbp1s on these promoters were identified in Pacific abalone. Yeast one-hybrid (Y1H) assays confirmed xbp1s binding to these sites, and morpholino oligonucleotides (MO) treatment effectively suppressed xbp1s production. Western blot analysis demonstrated that heat stress induced the expression of HDEL-related proteins, while MO injection significantly reduced their expression under both basal and heat stress conditions. Immunofluorescence analysis revealed decreased endoplasmic reticulum (ER) chaperone glucose-regulated protein 78 (GRP78) levels and increased apoptosis in MO-treated abalone under heat stress, suggesting a compromised ER stress response. These findings underscore XBP1's crucial role in regulating ER stress management and apoptotic processes, providing new insights into the functional significance of xbp1 in abalone's response to thermal stress.
Collapse
Affiliation(s)
- Dong Huang
- The Key Laboratory of Mariculture (Ministry of Education), Fisheries College, Ocean University of China, Qingdao 266003, China
| | - Xinxin Li
- The Key Laboratory of Mariculture (Ministry of Education), Fisheries College, Ocean University of China, Qingdao 266003, China
| | - Mingzhu Pan
- College of Marine and Biology Engineering, Yancheng Institute of Technology, Yancheng, 224051, China
| | - Yue Liu
- The Key Laboratory of Mariculture (Ministry of Education), Fisheries College, Ocean University of China, Qingdao 266003, China
| | - Gaochan Qin
- The Key Laboratory of Mariculture (Ministry of Education), Fisheries College, Ocean University of China, Qingdao 266003, China
| | - Zhichu Chen
- State Key Laboratory of Mariculture Breeding, Key Laboratory of Marine Biotechnology of Fujian Province, Fujian Agriculture and Forestry University, Fuzhou 350002, China
| | - Xiaojun Yu
- The Key Laboratory of Mariculture (Ministry of Education), Fisheries College, Ocean University of China, Qingdao 266003, China
| | - Kangsen Mai
- The Key Laboratory of Mariculture (Ministry of Education), Fisheries College, Ocean University of China, Qingdao 266003, China
| | - Wenbing Zhang
- The Key Laboratory of Mariculture (Ministry of Education), Fisheries College, Ocean University of China, Qingdao 266003, China.
| |
Collapse
|
|
2
|
Xue H, Yan M, Zhu X, Wang L, Chen L, Luo J, Cui J, Gao X. AgoArmet and AgoC002: key effector proteins in cotton aphids host adaptation. FRONTIERS IN PLANT SCIENCE 2024; 15:1500834. [PMID: 39670273 PMCID: PMC11634620 DOI: 10.3389/fpls.2024.1500834] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Subscribe] [Scholar Register] [Received: 09/24/2024] [Accepted: 11/05/2024] [Indexed: 12/14/2024]
Abstract
Aphids are insects that feed on phloem and introduce effector proteins into plant cells through saliva. These effector proteins are key in regulating host plant defense and enhancing aphid host adaptation. We identified these salivary proteins in the cotton aphids genome and named them AgoArmet and AgoC002. Multiple sequence alignment, protein structure analysis, and phylogenetic analysis of these proteins with related proteins from other insects showed that AgoArmet and Armet of Aphis craccivora have high sequence identity (97%) and belong to the same evolutionary branch and that AgoC002 shares the highest sequence identity (80%) and closest evolutionary relationship with C002 of Aphis glyceins. Expression profiling of AgoArmet and AgoC002 showed that they were most highly expressed in cotton aphids during the adult-3d period. Cotton aphids transferred to zucchini leaves resulted in a significant increase in the expression of AgoArmet and AgoC002 within 48h. To investigate the functions of AgoArmet and AgoC002, we decreased the expression of these genes in cotton using virus-induced gene silencing (VIGS), which ultimately led to a 38% and 26% decrease in cotton aphids fecundity, respectively. Moreover, the reduction in AgoC002 expression resulted in a significant (24%) reduction in body weight. Taken together, our findings demonstrate that AgoArmet and AgoC002 are key effector proteins involved in cotton aphids feeding and host adaptation.
Collapse
Affiliation(s)
- Hui Xue
- Research Base of Zhengzhou University, State Key Laboratory of Cotton Bio-breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, China
- State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou, China
- College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, China
| | - Mengjie Yan
- Research Base of Zhengzhou University, State Key Laboratory of Cotton Bio-breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, China
- State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou, China
| | - Xiangzhen Zhu
- Research Base of Zhengzhou University, State Key Laboratory of Cotton Bio-breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, China
- State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou, China
| | - Li Wang
- Research Base of Zhengzhou University, State Key Laboratory of Cotton Bio-breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, China
- State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou, China
| | - Lizhen Chen
- College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, China
| | - Junyu Luo
- Research Base of Zhengzhou University, State Key Laboratory of Cotton Bio-breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, China
- State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou, China
| | - Jinjie Cui
- Research Base of Zhengzhou University, State Key Laboratory of Cotton Bio-breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, China
- State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou, China
| | - Xueke Gao
- Research Base of Zhengzhou University, State Key Laboratory of Cotton Bio-breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, China
- State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou, China
| |
Collapse
|
|
3
|
Zhang Y, Chen X, Chen L, Shao M, Zhu W, Xing T, Guo T, Jia Q, Yang H, Yin P, Yan XX, Yu J, Li S, Li XJ, Yang S. Increased expression of mesencephalic astrocyte-derived neurotrophic factor (MANF) contributes to synapse loss in Alzheimer's disease. Mol Neurodegener 2024; 19:75. [PMID: 39425207 PMCID: PMC11490049 DOI: 10.1186/s13024-024-00771-3] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/09/2024] [Accepted: 10/11/2024] [Indexed: 10/21/2024] Open
Abstract
BACKGROUND The activation of endoplasmic reticulum (ER) stress is an early pathological hallmark of Alzheimer's disease (AD) brain, but how ER stress contributes to the onset and development of AD remains poorly characterized. Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a non-canonical neurotrophic factor and an ER stress inducible protein. Previous studies reported that MANF is increased in the brains of both pre-symptomatic and symptomatic AD patients, but the consequence of the early rise in MANF protein is unknown. METHODS We examined the expression of MANF in the brain of AD mouse models at different pathological stages. Through behavioral, electrophysiological, and neuropathological analyses, we assessed the level of synaptic dysfunctions in the MANF transgenic mouse model which overexpresses MANF in the brain and in wild type (WT) mice with MANF overexpression in the hippocampus. Using proteomic and transcriptomic screening, we identified and validated the molecular mechanism underlying the effects of MANF on synaptic function. RESULTS We found that increased expression of MANF correlates with synapse loss in the hippocampus of AD mice. The ectopic expression of MANF in mice via transgenic or viral approaches causes synapse loss and defects in learning and memory. We also identified that MANF interacts with ELAV like RNA-binding protein 2 (ELAVL2) and affects its binding to RNA transcripts that are involved in synaptic functions. Increasing or decreasing MANF expression in the hippocampus of AD mice exacerbates or ameliorates the behavioral deficits and synaptic pathology, respectively. CONCLUSIONS Our study established MANF as a mechanistic link between ER stress and synapse loss in AD and hinted at MANF as a therapeutic target in AD treatment.
Collapse
Affiliation(s)
- Yiran Zhang
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
| | - Xiusheng Chen
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
| | - Laiqiang Chen
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
- State Key Laboratory of Bioactive Molecules and Druggability Assessment, Jinan University, Guangzhou, China
| | - Mingting Shao
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
| | - Wenzhen Zhu
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
| | - Tingting Xing
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
| | - Tingting Guo
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
| | - Qingqing Jia
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
| | - Huiming Yang
- Department of Neurology, The First Affiliated Hospital, Sun Yat-Sen University; Guangdong Provincial Key Laboratory of Diagnosis and Treatment of Major Neurological Diseases, Guangzhou, China
| | - Peng Yin
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
- State Key Laboratory of Bioactive Molecules and Druggability Assessment, Jinan University, Guangzhou, China
| | - Xiao-Xin Yan
- Department of Anatomy and Neurobiology, Central South University Xiangya School of Medicine, Changsha, China
| | - Jiandong Yu
- Department of Neurosurgery, The First Affiliated Hospital of Bengbu Medical College, Bengbu, China
| | - Shihua Li
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
- State Key Laboratory of Bioactive Molecules and Druggability Assessment, Jinan University, Guangzhou, China
| | - Xiao-Jiang Li
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China
- State Key Laboratory of Bioactive Molecules and Druggability Assessment, Jinan University, Guangzhou, China
| | - Su Yang
- Guangdong Key Laboratory of Non-Human Primate Research, Key Laboratory of CNS Regeneration (Ministry of Education), Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Jinan University, Guangzhou, China.
- State Key Laboratory of Bioactive Molecules and Druggability Assessment, Jinan University, Guangzhou, China.
| |
Collapse
|
|
4
|
Cicek C, Telkoparan-Akillilar P, Sertyel S, Bilgi C, Ozgun OD. Investigation of endoplasmic reticulum stress-regulated chaperones as biomarkers in idiopathic nonobstructive azoospermia. Cell Stress Chaperones 2024; 29:654-665. [PMID: 39237030 PMCID: PMC11424951 DOI: 10.1016/j.cstres.2024.08.004] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/11/2024] [Revised: 08/27/2024] [Accepted: 08/30/2024] [Indexed: 09/07/2024] Open
Abstract
Azoospermia is a condition in which sperm cells are completely absent in a male's ejaculate. Typically, sperm production occurs in the testes and is regulated by a complex series of cellular and molecular interactions. Endoplasmic reticulum (ER) stress arises when there is a deviation from or damage to the normal functions of the ER within cells. In response to this stress, a cascade of response mechanisms is activated to regulate ER stress within cells. This study aims to investigate the role of ER stress-regulated chaperones as potential biomarkers in male infertility. ER stress associated with azoospermia can manifest in cells such as spermatogonia in the testes and can impact sperm production. As a result of ER stress, the expression and activity of a variety of proteins within cells can be altered. Among these proteins are chaperone proteins that regulate the ER stress response. The sample size was calculated to be a minimum of 36 patients in each group. In this preliminary study, we measured and compared serum levels of protein disulfide-isomerase A1, protein disulfide-isomerase A3 (PDIA3), mesencephalic astrocyte-derived neurotrophic factor (MANF), glucose regulatory protein 78 (GRP78), clusterin (CLU), calreticulin (CRT), and calnexin (CNX) between male subjects with idiopathic nonobstructive azoospermia and a control group of noninfertile males. Serum PDIA1 (P = 0.0004), MANF (P = 0.018), PDIA3 (P < 0.0001), GRP78 (P = 0.0027), and CRT (P = 0.0009) levels were higher in the infertile group compared to the control. In summary, this study presents novel findings in a cohort of male infertile patients, emphasizing the significance of incorporating diverse biomarkers. It underscores the promising role of ER stress-regulated proteins as potential serum indicators for male infertility. By elucidating the impact of ER stress on spermatogenic cells, the research illuminates the maintenance or disruption of cellular health. A deeper understanding of these results could open the door to novel treatment approaches for reproductive conditions, including azoospermia.
Collapse
Affiliation(s)
- Cigdem Cicek
- Department of Medical Biochemistry, Faculty of Medicine, Yuksek Ihtisas University, Ankara 06530, Turkey.
| | - Pelin Telkoparan-Akillilar
- Department of Medical Biology, Faculty of Medicine, Gazi University, Ankara 06500, Turkey; Department of Medical Biology, Faculty of Medicine, Yuksek Ihtisas University, Ankara 06530, Turkey
| | | | - Cumhur Bilgi
- Alife Hospital Biochemistry Laboratory, Ankara 06794, Turkey
| | | |
Collapse
|
|
5
|
Graewert MA, Volkova M, Jonasson K, Määttä JAE, Gräwert T, Mamidi S, Kulesskaya N, Evenäs J, Johnsson RE, Svergun D, Bhattacharjee A, Huttunen HJ. Structural basis of CDNF interaction with the UPR regulator GRP78. Nat Commun 2024; 15:8175. [PMID: 39289391 PMCID: PMC11408689 DOI: 10.1038/s41467-024-52478-0] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/23/2024] [Accepted: 09/05/2024] [Indexed: 09/19/2024] Open
Abstract
Cerebral dopamine neurotrophic factor (CDNF) is an unconventional neurotrophic factor that is a disease-modifying drug candidate for Parkinson's disease. CDNF has pleiotropic protective effects on stressed cells, but its mechanism of action remains incompletely understood. Here, we use state-of-the-art advanced structural techniques to resolve the structural basis of CDNF interaction with GRP78, the master regulator of the unfolded protein response (UPR) pathway. Subsequent binding studies confirm the obtained structural model of the complex, eventually revealing the interaction site of CDNF and GRP78. Finally, mutating the key residues of CDNF mediating its interaction with GRP78 not only results in impaired binding of CDNF but also abolishes the neuroprotective activity of CDNF-derived peptides in mesencephalic neuron cultures. These results suggest that the molecular interaction with GRP78 mediates the neuroprotective actions of CDNF and provide a structural basis for development of next generation CDNF-based therapeutic compounds against neurodegenerative diseases.
Collapse
Affiliation(s)
- Melissa A Graewert
- European Molecular Biological Laboratory, DE-22607, Hamburg, Germany
- BIOSAXS GmbH, DE-22607, Hamburg, Germany
| | - Maria Volkova
- Red Glead Discovery AB, Medicon Village SE-223 81, Lund, Sweden
| | - Klara Jonasson
- Red Glead Discovery AB, Medicon Village SE-223 81, Lund, Sweden
| | - Juha A E Määttä
- Faculty of Medicine and Health Technology, Tampere University, Tampere, FI-33520, Finland
| | | | - Samara Mamidi
- Red Glead Discovery AB, Medicon Village SE-223 81, Lund, Sweden
| | | | - Johan Evenäs
- Red Glead Discovery AB, Medicon Village SE-223 81, Lund, Sweden
| | | | | | | | | |
Collapse
|
|
6
|
Kitamura RA, Hummel D, Ustione A, Piston DW, Urano F. Dual role of neuroplastin in pancreatic β cells: Regulating insulin secretion and promoting islet inflammation. Proc Natl Acad Sci U S A 2024; 121:e2411234121. [PMID: 39666939 PMCID: PMC11331099 DOI: 10.1073/pnas.2411234121] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/04/2024] [Accepted: 07/03/2024] [Indexed: 12/14/2024] Open
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an endoplasmic reticulum (ER)-resident secretory protein that reduces inflammation and promotes proliferation in pancreatic β cells. Numerous studies have highlighted the potential of MANF as a therapeutic agent for diabetes mellitus (DM), making it essential to understand the mechanisms underlying MANF's functions. In our previous search for a molecule that mediates MANF signaling, we identified Neuroplastin (NPTN) as a binding partner of MANF that localizes on the cell surface. However, the roles of NPTN in pancreatic β cells remain unclear. In this study, we generated β cell-specific Nptn knockout (KO) mice and conducted metabolic characterization. NPTN deficiency improved glucose tolerance by increasing insulin secretion and β cell mass in the pancreas. Moreover, proliferation and mitochondrial numbers in β cells increased in Nptn KO islets. These phenotypes resulted from elevated cytosolic Ca2+ levels and subsequent activation of downstream molecules. Simultaneously, we demonstrated that NPTN induces the expression of proinflammatory cytokines via the TRAF6-NF-κB axis in β cells. Additionally, NPTN deficiency conferred resistance to streptozotocin-induced diabetic phenotypes. Finally, exogenous MANF treatment in islets or β cells led to similar phenotypes as those observed in NPTN-deficient models. These results indicate that NPTN plays important roles in the regulation of insulin secretion, proliferation, and mitochondrial quantity, as well as proinflammatory responses, which are antagonized by MANF treatment. Thus, targeting the MANF-NPTN interaction may lead to a novel treatment for improving β cell functions in DM.
Collapse
Affiliation(s)
- Rie Asada Kitamura
- Department of Medicine, Division of Endocrinology, Metabolism, and Lipid Research, Washington University School of Medicine, St. Louis, MO63110
| | - Devynn Hummel
- Department of Medicine, Division of Endocrinology, Metabolism, and Lipid Research, Washington University School of Medicine, St. Louis, MO63110
| | - Alessandro Ustione
- Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO63110
| | - David W. Piston
- Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO63110
| | - Fumihiko Urano
- Department of Medicine, Division of Endocrinology, Metabolism, and Lipid Research, Washington University School of Medicine, St. Louis, MO63110
- Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, MO63110
| |
Collapse
|
|
7
|
Hrabos D, Poggiolini I, Civitelli L, Galli E, Esapa C, Saarma M, Lindholm P, Parkkinen L. Unfolded protein response markers Grp78 and eIF2alpha are upregulated with increasing alpha-synuclein levels in Lewy body disease. Neuropathol Appl Neurobiol 2024; 50:e12999. [PMID: 39036837 DOI: 10.1111/nan.12999] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/02/2024] [Revised: 06/26/2024] [Accepted: 07/01/2024] [Indexed: 07/23/2024]
Abstract
AIMS Endoplasmic reticulum stress followed by the unfolded protein response is one of the cellular mechanisms contributing to the progression of α-synuclein pathology in Parkinson's disease and other Lewy body diseases. We aimed to investigate the activation of endoplasmic reticulum stress and its correlation with α-synuclein pathology in human post-mortem brain tissue. METHODS We analysed brain tissue from 45 subjects-14 symptomatic patients with Lewy body disease, 19 subjects with incidental Lewy body disease, and 12 healthy controls. The analysed brain regions included the medulla, pons, midbrain, striatum, amygdala and entorhinal, temporal, frontal and occipital cortex. We analysed activation of endoplasmic reticulum stress via levels of the unfolded protein response-related proteins (Grp78, eIF2α) and endoplasmic reticulum stress-regulating neurotrophic factors (MANF, CDNF). RESULTS We showed that regional levels of two endoplasmic reticulum-localised neurotrophic factors, MANF and CDNF, did not change in response to accumulating α-synuclein pathology. The concentration of MANF negatively correlated with age in specific regions. eIF2α was upregulated in the striatum of Lewy body disease patients and correlated with increased α-synuclein levels. We found the upregulation of chaperone Grp78 in the amygdala and nigral dopaminergic neurons of Lewy body disease patients. Grp78 levels in the amygdala strongly correlated with soluble α-synuclein levels. CONCLUSIONS Our data suggest a strong but regionally specific change in Grp78 and eIF2α levels, which positively correlates with soluble α-synuclein levels. Additionally, MANF levels decreased in dopaminergic neurons in the substantia nigra. Our research suggests that endoplasmic reticulum stress activation is not associated with Lewy pathology but rather with soluble α-synuclein concentration and disease progression.
Collapse
Affiliation(s)
- Dominik Hrabos
- Nuffield Department of Clinical Neuroscience, University of Oxford, Oxford, UK
- Department of Clinical and Molecular Pathology, Palacky University Olomouc and University Hospital Olomouc, Olomouc, Czech Republic
- Department of Neurology, Palacky University Olomouc and University Hospital Olomouc, Olomouc, Czech Republic
| | - Ilaria Poggiolini
- Nuffield Department of Clinical Neuroscience, University of Oxford, Oxford, UK
| | - Livia Civitelli
- Nuffield Department of Clinical Neuroscience, University of Oxford, Oxford, UK
| | - Emilia Galli
- Institute of Biotechnology, Helsinki Institute of Life Science, University of Helsinki, Helsinki, Finland
| | - Chris Esapa
- Mammalian Genetics Unit, MRC Harwell Institute, Harwell Science and Innovation Campus, Didcot, UK
| | - Mart Saarma
- Institute of Biotechnology, Helsinki Institute of Life Science, University of Helsinki, Helsinki, Finland
| | - Päivi Lindholm
- Institute of Biotechnology, Helsinki Institute of Life Science, University of Helsinki, Helsinki, Finland
| | - Laura Parkkinen
- Nuffield Department of Clinical Neuroscience, University of Oxford, Oxford, UK
| |
Collapse
|
|
8
|
Wen W, Li H, Lauffer M, Hu D, Zhang Z, Lin H, Wang Y, Leidinger M, Luo J. Sex-specific effects of alcohol on neurobehavioral performance and endoplasmic reticulum stress: an analysis using neuron-specific MANF deficient mice. Front Pharmacol 2024; 15:1407576. [PMID: 39130640 PMCID: PMC11310019 DOI: 10.3389/fphar.2024.1407576] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/26/2024] [Accepted: 07/09/2024] [Indexed: 08/13/2024] Open
Abstract
Excessive alcohol exposure can cause neurobehavioral deficits and structural alterations in the brain. Emerging research evidence suggests that endoplasmic reticulum (ER) stress plays an important role in alcohol-induced neurotoxicity. Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an ER stress inducible protein and is responsible to maintain ER homeostasis. MANF is highly expressed in both the developing and mature brain. We have previously shown that MANF deficiency exacerbated alcohol induced neurodegeneration and ER stress in the developing brain. However, little is known regarding the role of MANF in alcohol induced neuronal damage in the adult brain. In this study, we used a neuron-specific MANF knockout (KO) mouse model to investigate the effect of MANF deficiency on acute binge alcohol exposure-induced neurobehavioral deficits and ER stress. Adult male and female MANF KO mice and littermate controls received daily alcohol gavage (5 g/kg) for 10 days and then subjected to a battery of neurobehavioral tests including rotarods, balance beam, DigiGait, open field, elevated plus maze, Barnes maze, and three-chamber sociability task. Female MANF KO animals were more susceptible to alcohol-induced body weight loss. Alcohol exposure did not affect motor function, however female but not male MANF KO mice exhibited an increased locomotor activity in open field test. Learning and memory was not significantly impaired, but it was altered by MANF deficiency in females while it was affected by alcohol treatment in males. Both alcohol-exposed male and female MANF KO mice displayed increased sociability. Alcohol induced the expression of ER chaperones GRP78 and GRP94 and altered the levels of several unfolded protein response (UPR) and neuroinflammation markers in MANF KO mice in a sex-specific manner. The expression of MANF interacting proteins neuroplastin, PDIA1, and PDIA6 was increased in MANF KO mice, and was further induced by alcohol. In conclusion, alcohol exposure and neuronal MANF deficiency interacted to alter neurobehavioral outcomes, ER homeostasis and neuroinflammation in a sex-specific manner.
Collapse
Affiliation(s)
- Wen Wen
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, United States
| | - Hui Li
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, United States
| | - Marisol Lauffer
- Neural Circuits and Behavior Core, University of Iowa Carver College of Medicine, Iowa City, IA, United States
| | - Di Hu
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, United States
| | - Zuohui Zhang
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, United States
| | - Hong Lin
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, United States
| | - Yongchao Wang
- Vanderbilt Memory and Alzheimer’s Center, Department of Neurology, Vanderbilt University Medical Center, Nashville, TN, United States
| | - Mariah Leidinger
- Comparative Pathology Laboratory, University of Iowa Carver College of Medicine, Iowa City, IA, United States
| | - Jia Luo
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, United States
- Iowa City VA Health Care System, Iowa City, IA, United States
| |
Collapse
|
|
9
|
Hinaga S, Kandeel M, Oh-Hashi K. Molecular characterization of the ER stress-inducible factor CRELD2. Cell Biochem Biophys 2024; 82:1463-1475. [PMID: 38753249 DOI: 10.1007/s12013-024-01300-1] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Accepted: 04/29/2024] [Indexed: 08/25/2024]
Abstract
Previously, we found by constructing various luciferase reporters that a well-conserved ATF6-binding element in the CRELD2 promoter is activated by transient ATF6 overexpression. In this study, we established ATF6-deficient and ATF4-deficient cell lines to analyze CRELD2 mRNA and protein expression together with that of other ER stress-inducible factors. Our results showed that ATF6 deficiency markedly suppressed tunicamycin (Tm)-induced expression of unglycosylated CRELD2. This reduction reflected a decrease in the CRELD2 transcription level. On the other hand, a putative ATF4-binding site in the mouse CRELD2 promoter did not respond to Tm stimulation, but ATF4 loss resulted in reductions in CRELD2 mRNA and protein expression, accompanied by a decrease in Tm-induced ATF6 expression. In contrast, transient suppression of GADD34, an ATF4 downstream factor, suppressed Tm-induced CRELD2 protein expression without a decrease in ATF6 protein expression. Furthermore, we investigated the association of CRELD2 with a well-known ERAD substrate, namely, an α1-antitripsin truncation mutant, NHK, by generating various CRELD2 and NHK constructs. Coimmunoprecipitation of these proteins was observed only when the cysteine in the CXXC motif on the N-terminal side of CRELD2 was replaced with alanine, and the interaction between the two was found to be disulfide bond-independent. Taken together, these findings indicate that CRELD2 expression is regulated by multiple factors via transcriptional and posttranscriptional mechanisms. In addition, the N-terminal structure of CRELD2, including the CXXC motif, was suggested to play a role in the association of the target proteins. In the future, the identification and characterization of factors interacting with CRELD2 will be useful for understanding protein homeostasis under various ER stress conditions.
Collapse
Affiliation(s)
- Shohei Hinaga
- Graduate School of Natural Science and Technology, Gifu University, 1-1 Yanagido, Gifu, 501-1193, Japan
| | - Mahmoud Kandeel
- Department of Biomedical Sciences, College of Veterinary Medicine, King Faisal University, 31982, Al-Ahsa, Saudi Arabia
- Department of Pharmacology, Faculty of Veterinary Medicine, Kafrelsheikh University, 33516, Kafrelsheikh, Egypt
| | - Kentaro Oh-Hashi
- Graduate School of Natural Science and Technology, Gifu University, 1-1 Yanagido, Gifu, 501-1193, Japan.
- Department of Chemistry and Biomolecular Science, Faculty of Engineering, Gifu University, 1-1 Yanagido, Gifu, 501-1193, Japan.
- United Graduate School of Drug Discovery and Medical Information Sciences, Gifu University, 1-1 Yanagido, Gifu, 501-1193, Japan.
- Center for One Medicine Innovative Translational Research (COMIT), Gifu University, 1-1 Yanagido, Gifu, 501-1193, Japan.
| |
Collapse
|
|
10
|
Zhou C, Han D, Fang H, Huang D, Cai H, Shen Y, Shen Y, Liu J. Deletion of mesencephalic astrocyte-derived neurotrophic factor delays and damages the development of white pulp in spleen. Immunobiology 2024; 229:152778. [PMID: 38159526 DOI: 10.1016/j.imbio.2023.152778] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/24/2023] [Revised: 11/29/2023] [Accepted: 12/10/2023] [Indexed: 01/03/2024]
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an endoplasmic reticulum (ER) stress-induced protein, and it has been reported that ER stress and unfolded protein response (UPR) are closely related to the immune system. The spleen is an important immune organ and we have shown in our previous research that MANF is expressed in human spleen tissues. However, there have been limited studies about the effect of MANF on spleen development. In this study, we detected MANF expression in spleen tissues and found that MANF was expressed in the red pulp and marginal zone. Additionally, MANF was localized in the CD68+ and CD138+ cells of adult rat spleen tissues, but not in the CD3+ cells. We performed immunohistochemical staining to detect MANF expression in the spleen tissues of rats that were different ages, and we found that MANF+ cells were localized together in the spleen tissues of rats that were 1-4 weeks old. MANF was also expressed in CD68+ cells in the spleen tissues of rats and mice. Furthermore, we found that MANF deficiency inhibited white pulp development in MANF knockout mice, thus indicating that MANF played an important role in the white pulp development of rodent spleen tissues.
Collapse
Affiliation(s)
- Chengyue Zhou
- Department of Clinical Pharmacy, Anhui Provincial Children's Hospital, Hefei, China; School of Basic Medical Sciences, Anhui Medical University, Hefei, China; Biopharmaceutical Institute, Anhui Medical University, Hefei, China
| | - Dan Han
- School of Basic Medical Sciences, Anhui Medical University, Hefei, China; Biopharmaceutical Institute, Anhui Medical University, Hefei, China; The Clinical College, Anhui Medical University, Hefei, China
| | - Hui Fang
- Anhui Institute of Pediatric Research, Anhui, Hefei, China
| | - Dake Huang
- School of Basic Medical Sciences, Anhui Medical University, Hefei, China; Comprehensive Experiment Center, School of Basic Medical Sciences, Anhui Medical University, Hefei, China
| | - Heping Cai
- Department of Clinical Pharmacy, Anhui Provincial Children's Hospital, Hefei, China
| | - Yujun Shen
- School of Basic Medical Sciences, Anhui Medical University, Hefei, China; Biopharmaceutical Institute, Anhui Medical University, Hefei, China
| | - Yuxian Shen
- School of Basic Medical Sciences, Anhui Medical University, Hefei, China; Biopharmaceutical Institute, Anhui Medical University, Hefei, China.
| | - Jun Liu
- School of Basic Medical Sciences, Anhui Medical University, Hefei, China; Biopharmaceutical Institute, Anhui Medical University, Hefei, China.
| |
Collapse
|
|
11
|
Gong L, Dong J, Huang K, Pan K, Wang S, Liu H. Effect of mesencephalic astrocyte-derived neurotrophic factor on the inflammatory response in human gingival fibroblasts cells. Eur J Oral Sci 2023; 131:e12945. [PMID: 37461146 DOI: 10.1111/eos.12945] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/12/2023] [Accepted: 07/06/2023] [Indexed: 11/04/2023]
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a unique member of the neurotrophic factor family residing in the endoplasmic reticulum, where it functions as a stress response protein maintaining endoplasmic reticulum homeostasis, in addition to being secreted extracellularly as a neurotrophic factor to bind with receptors to initiate intracellular signal transduction pathways. Interestingly, MANF has shown an important protective role in the inflammatory response of many diseases. In neural stem cells, pancreatic β cells, and retinal cells, MANF can inhibit the inflammatory response, modulate the immune response, and promote tissue repair. However, the role of MANF in the periodontal inflammatory response remains unclear. In the present study, we used lipopolysaccharide (LPS) from Porphyromonas gingivalis (Pg) to establish a Pg-LPS-stimulated periodontal inflammatory model in human gingival fibroblasts cells (HGF-1) to investigate the role of MANF in vitro. We found that MANF could inhibit pro-inflammatory cytokine secretion, alleviate the endoplasmic reticulum stress response, promote cell survival, and inhibit cell apoptosis. Therefore, MANF might be a novel promising target for the treatment of periodontitis.
Collapse
Affiliation(s)
- Lei Gong
- Department of Laboratory Center, The Affiliated Yantai Yuhuangding Hospital of Qingdao University, Yantai, Shandong, China
| | - Jie Dong
- Department of Laboratory Center, The Affiliated Yantai Yuhuangding Hospital of Qingdao University, Yantai, Shandong, China
| | - Kai Huang
- College of Stomatology, Binzhou Medical University, Yantai, Shandong, China
| | - Keqing Pan
- Department of Stomatology, The Affiliated Hospital of Qingdao University, Qingdao, Shandong, China
| | - Shengzhi Wang
- Department of Stomatology, The Affiliated Yantai Yuhuangding Hospital of Qingdao University, Yantai, Shandong, China
| | - Hao Liu
- Department of Stomatology, The Affiliated Yantai Yuhuangding Hospital of Qingdao University, Yantai, Shandong, China
| |
Collapse
|
|
12
|
Lee H, Jeong S, Kim HJ, Chung YG, Kwon YK. Mesencephalic astrocyte-derived neurotrophic factor promotes axonal regeneration and the motor function recovery after sciatic nerve injury. Biochem Biophys Res Commun 2023; 674:36-43. [PMID: 37393642 DOI: 10.1016/j.bbrc.2023.06.056] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/19/2023] [Revised: 06/15/2023] [Accepted: 06/16/2023] [Indexed: 07/04/2023]
Abstract
Peripheral nerve injuries have common clinical problems that are often accompanied by sensory and motor dysfunction and failure of axonal regeneration. Although various therapeutic approaches have been attempted, full functional recovery and axonal regeneration are rarely achieved in patients. In this study, we investigated the effects of recombinant adeno-associated virus (AAV) of mesencephalic astrocyte-derived neurotrophic factor (AAV-MANF) or placental growth factor (AAV-PlGF) transduced into mesenchymal stem cells (hMSC-MANF and hMSC-PlGF), which were then transplanted using human decellularized nerves (HDN) into sciatic nerve injury model. Our results showed that both AAV-MANF and AAV-PlGF were expressed in MSCs transplanted into the injury site. Behavioral measurements performed 2, 4, 6, 8, and 12 weeks after injury indicated that MANF facilitated the rapid and improved recovery of sensory and motor functions than PlGF. In addition, immunohistochemical analysis was used to quantitatively analyze the myelination of neurofilaments, Schwann cells, and regrowth axons. Both hMSC-MANF and hMSC-PlGF increased axon numbers and immunoreactive areas of axons and Schwann cells compared with the hMSC-GFP group. However, hMSC-MANF significantly improved the thickness of axons and Schwann cells compared with hMSC-PlGF. G-ratio analysis also showed a marked increase in axon myelination in axons thicker than 2.0 μm treated with MANF than that treated with PlGF. Our study suggests that transplantation of hMSC transduced with AAV-MANF has a potential to provide a novel and efficient strategy for promoting functional recovery and axonal regeneration in peripheral nerve injury.
Collapse
Affiliation(s)
- Hyemi Lee
- Department of Biomedical and Pharmaceutical Sciences, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea
| | - Seungyeon Jeong
- Department of Biomedical and Pharmaceutical Sciences, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea
| | - Hyun-Ju Kim
- Department of Biology, College of Sciences, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea
| | - Yang-Guk Chung
- Department of Orthopedic Surgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, South Korea
| | - Yunhee Kim Kwon
- Department of Biomedical and Pharmaceutical Sciences, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea; Department of Biology, College of Sciences, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea.
| |
Collapse
|
|
13
|
Wen W, Wang Y, Li H, Hu D, Zhang Z, Lin H, Luo J. Upregulation of mesencephalic astrocyte-derived neurotrophic factor (MANF) expression offers protection against alcohol neurotoxicity. J Neurochem 2023; 166:943-959. [PMID: 37507360 PMCID: PMC10906989 DOI: 10.1111/jnc.15921] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/30/2023] [Revised: 07/05/2023] [Accepted: 07/06/2023] [Indexed: 07/30/2023]
Abstract
Alcohol exposure has detrimental effects on both the developing and mature brain. Endoplasmic reticulum (ER) stress is one of the mechanisms that contributes to alcohol-induced neuronal damages. Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an ER stress-responsive protein and is neuroprotective in multiple neuronal injury and neurodegenerative disease models. MANF deficiency has been shown to exacerbate alcohol-induced ER stress and neurodegeneration. However, it is unknown whether MANF supplement is sufficient to protect against alcohol neurotoxicity. Alcohol alters MANF expression in the brain, but the mechanisms underlying alcohol modulation of MANF expression remain unclear. This study was designed to determine how alcohol alters MANF expression in neuronal cells and whether exogeneous MANF can alleviate alcohol neurotoxicity. We showed that alcohol increased MANF transcription and secretion without affecting MANF mRNA stability and protein degradation. ER stress was necessary for alcohol-induced MANF upregulation, as pharmacological inhibition of ER stress by 4-PBA diminished alcohol-induced MANF expression. In addition, the presence of ER stress response element II (ERSE-II) was required for alcohol-stimulated MANF transcription. Mutations or deletion of this sequence abolished alcohol-regulated transcriptional activity. We generated MANF knockout (KO) neuronal cells using CRISPR/Cas9. MANF KO cells exhibited increased unfolded protein response (UPR) and were more susceptible to alcohol-induced cell death. On the other hand, MANF upregulation by the addition of recombinant MANF protein or adenovirus gene transduction protected neuronal cells against alcohol-induced cell death. Further studies using early postnatal mouse pups demonstrated that enhanced MANF expression in the brain by intracerebroventricular (ICV) injection of MANF adeno-associated viruses ameliorated alcohol-induced cell death. Thus, alcohol increased MANF expression through inducing ER stress, which could be a protective response. Exogenous MANF was able to protect against alcohol-induced neurodegeneration.
Collapse
Affiliation(s)
- Wen Wen
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA
| | - Yongchao Wang
- Vanderbilt Memory and Alzheimer’s Center, Department of Neurology, Vanderbilt University Medical Center, Nashville, TN 37372, USA
| | - Hui Li
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA
| | - Di Hu
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA
| | - Zuohui Zhang
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA
| | - Hong Lin
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA
| | - Jia Luo
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA
- VA Iowa City Health Care System, Iowa City, IA 52246, USA
| |
Collapse
|
|
14
|
Pakarinen E, Lindholm P. CDNF and MANF in the brain dopamine system and their potential as treatment for Parkinson's disease. Front Psychiatry 2023; 14:1188697. [PMID: 37555005 PMCID: PMC10405524 DOI: 10.3389/fpsyt.2023.1188697] [Citation(s) in RCA: 2] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 03/17/2023] [Accepted: 05/23/2023] [Indexed: 08/10/2023] Open
Abstract
Parkinson's disease (PD) is a progressive neurodegenerative disease characterized by gradual loss of midbrain dopamine neurons, leading to impaired motor function. Preclinical studies have indicated cerebral dopamine neurotrophic factor (CDNF) and mesencephalic astrocyte-derived neurotrophic factor (MANF) to be potential therapeutic molecules for the treatment of PD. CDNF was proven to be safe and well tolerated when tested in Phase I-II clinical trials in PD patients. Neuroprotective and neurorestorative effects of CDNF and MANF were demonstrated in animal models of PD, where they promoted the survival of dopamine neurons and improved motor function. However, biological roles of endogenous CDNF and MANF proteins in the midbrain dopamine system have been less clear. In addition to extracellular trophic activities, CDNF/MANF proteins function intracellularly in the endoplasmic reticulum (ER), where they modulate protein homeostasis and protect cells against ER stress by regulating the unfolded protein response (UPR). Here, our aim is to give an overview of the biology of endogenous CDNF and MANF in the brain dopamine system. We will discuss recent studies on CDNF and MANF knockout animal models, and effects of CDNF and MANF in preclinical models of PD. To elucidate possible roles of CDNF and MANF in human biology, we will review CDNF and MANF tissue expression patterns and regulation of CDNF/MANF levels in human diseases. Finally, we will discuss novel findings related to the molecular mechanism of CDNF and MANF action in ER stress, UPR, and inflammation, all of which are mechanisms potentially involved in the pathophysiology of PD.
Collapse
Affiliation(s)
| | - Päivi Lindholm
- Institute of Biotechnology, Helsinki Institute of Life Science, University of Helsinki, Helsinki, Finland
| |
Collapse
|
|
15
|
Sivakumar B, Krishnan A. Mesencephalic Astrocyte-Derived Neurotrophic Factor (MANF): An Emerging Therapeutic Target for Neurodegenerative Disorders. Cells 2023; 12:cells12071032. [PMID: 37048105 PMCID: PMC10093115 DOI: 10.3390/cells12071032] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/31/2023] [Revised: 03/12/2023] [Accepted: 03/26/2023] [Indexed: 03/30/2023] Open
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a member of the new family of neurotrophic factors (NTFs) with a unique structure and functions compared to other conventionally known NTFs. MANF is broadly expressed in developing and mature tissues, including the central nervous system and peripheral nervous system tissues. Growing research demonstrated that MANF protects neurons from endoplasmic reticulum (ER) stress-associated complications by restoring ER homeostasis and regulating unfolded protein response. This review discusses MANF signaling in neurodegenerative conditions with specific emphasis given to its overall effect and mechanisms of action in experimental models of Parkinson’s disease, Alzheimer’s disease, and stroke. Additional perspectives on its potential unexplored roles in other neurodegenerative conditions are also given.
Collapse
Affiliation(s)
- Bhadrapriya Sivakumar
- Department of Anatomy, Physiology, and Pharmacology, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada
- Cameco MS Neuroscience Research Centre (CMSNRC), Saskatoon, SK S7K 0M7, Canada
| | - Anand Krishnan
- Department of Anatomy, Physiology, and Pharmacology, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada
- Cameco MS Neuroscience Research Centre (CMSNRC), Saskatoon, SK S7K 0M7, Canada
- Correspondence: ; Tel.: +1-306-655-8711
| |
Collapse
|
|
16
|
Kovaleva V, Yu LY, Ivanova L, Shpironok O, Nam J, Eesmaa A, Kumpula EP, Sakson S, Toots U, Ustav M, Huiskonen JT, Voutilainen MH, Lindholm P, Karelson M, Saarma M. MANF regulates neuronal survival and UPR through its ER-located receptor IRE1α. Cell Rep 2023; 42:112066. [PMID: 36739529 DOI: 10.1016/j.celrep.2023.112066] [Citation(s) in RCA: 11] [Impact Index Per Article: 5.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/24/2021] [Revised: 10/20/2022] [Accepted: 01/19/2023] [Indexed: 02/05/2023] Open
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an endoplasmic reticulum (ER)-located protein with cytoprotective effects in neurons and pancreatic β cells in vitro and in models of neurodegeneration and diabetes in vivo. However, the exact mode of MANF action has remained elusive. Here, we show that MANF directly interacts with the ER transmembrane unfolded protein response (UPR) sensor IRE1α, and we identify the binding interface between MANF and IRE1α. The expression of wild-type MANF, but not its IRE1α binding-deficient mutant, attenuates UPR signaling by decreasing IRE1α oligomerization; phosphorylation; splicing of Xbp1, Atf6, and Txnip levels; and protecting neurons from ER stress-induced death. MANF-IRE1α interaction and not MANF-BiP interaction is crucial for MANF pro-survival activity in neurons in vitro and is required to protect dopamine neurons in an animal model of Parkinson's disease. Our data show IRE1α as an intracellular receptor for MANF and regulator of neuronal survival.
Collapse
Affiliation(s)
- Vera Kovaleva
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland.
| | - Li-Ying Yu
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland
| | - Larisa Ivanova
- Institute of Chemistry, University of Tartu, 50411 Tartu, Estonia
| | - Olesya Shpironok
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland
| | - Jinhan Nam
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland; Division of Pharmacology and Pharmacotherapy, Faculty of Pharmacy, University of Helsinki, 00014 Helsinki, Finland
| | - Ave Eesmaa
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland
| | - Esa-Pekka Kumpula
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland
| | - Sven Sakson
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland
| | | | | | - Juha T Huiskonen
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland
| | - Merja H Voutilainen
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland; Division of Pharmacology and Pharmacotherapy, Faculty of Pharmacy, University of Helsinki, 00014 Helsinki, Finland
| | - Päivi Lindholm
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland
| | - Mati Karelson
- Institute of Chemistry, University of Tartu, 50411 Tartu, Estonia
| | - Mart Saarma
- Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland.
| |
Collapse
|
|
17
|
Tang Q, Liu Q, Li Y, Mo L, He J. CRELD2, endoplasmic reticulum stress, and human diseases. Front Endocrinol (Lausanne) 2023; 14:1117414. [PMID: 36936176 PMCID: PMC10018036 DOI: 10.3389/fendo.2023.1117414] [Citation(s) in RCA: 6] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 12/06/2022] [Accepted: 02/13/2023] [Indexed: 03/06/2023] Open
Abstract
CRELD2, a member of the cysteine-rich epidermal growth factor-like domain (CRELD) protein family, is both an endoplasmic reticulum (ER)-resident protein and a secretory factor. The expression and secretion of CRELD2 are dramatically induced by ER stress. CRELD2 is ubiquitously expressed in multiple tissues at different levels, suggesting its crucial and diverse roles in different tissues. Recent studies suggest that CRELD2 is associated with cartilage/bone metabolism homeostasis and pathological conditions involving ER stress such as chronic liver diseases, cardiovascular diseases, kidney diseases, and cancer. Herein, we first summarize ER stress and then critically review recent advances in the knowledge of the characteristics and functions of CRELD2 in various human diseases. Furthermore, we highlight challenges and present future directions to elucidate the roles of CRELD2 in human health and disease.
Collapse
Affiliation(s)
- Qin Tang
- Department of Pharmacy, Institute of Metabolic Diseases and Pharmacotherapy, West China Hospital, Sichuan University, Chengdu, Sichuan, China
| | - Qinhui Liu
- Department of Pharmacy, Institute of Metabolic Diseases and Pharmacotherapy, West China Hospital, Sichuan University, Chengdu, Sichuan, China
| | - Yanping Li
- Department of Pharmacy, Institute of Metabolic Diseases and Pharmacotherapy, West China Hospital, Sichuan University, Chengdu, Sichuan, China
| | - Li Mo
- Center of Gerontology and Geriatrics, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Jinhan He
- Department of Pharmacy, Institute of Metabolic Diseases and Pharmacotherapy, West China Hospital, Sichuan University, Chengdu, Sichuan, China
- *Correspondence: Jinhan He,
| |
Collapse
|
|
18
|
Deng H, Zhang P, Gao X, Chen W, Li J, Wang F, Gu Y, Hou X. Emerging trophic activities of mesencephalic astrocyte-derived neurotrophic factor in tissue repair and regeneration. Int Immunopharmacol 2023; 114:109598. [PMID: 36538855 DOI: 10.1016/j.intimp.2022.109598] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/07/2022] [Revised: 12/05/2022] [Accepted: 12/12/2022] [Indexed: 12/23/2022]
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a soluble endoplasmic reticulum (ER) luminal protein and its expression and secretion can be induced by ER stress. Despite initially being classified as a neurotrophic factor, MANF has been demonstrated to have restorative and protective effects in many different cell types such as neurons, liver cells, retinal cells, cardiac myocytes, and pancreatic β cells. However, underlying molecular mechanisms are complex and remain incompletely understood. The aims of this review are to highlight the latest advances in the understanding of the trophic activities of MANF in tissue repair and regeneration as well as underlying molecular mechanisms. The structural motifs and immune modulation of MANF are also described. We therefore propose that MANF might be a promising therapeutic target for tissue repair.
Collapse
Affiliation(s)
- Haiyan Deng
- School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, PR China
| | - Pingping Zhang
- Institute of Clinical Pharmacology, Anhui Medical University, Key Laboratory of Anti-inflammatory and Immune Medicine, Ministry of Education, Anhui Collaborative Innovation Center of Anti-inflammatory and Immune Medicine, Hefei, PR China
| | - Xianxian Gao
- School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, PR China
| | - Weiyi Chen
- School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, PR China
| | - Jianing Li
- School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, PR China
| | - Fuyan Wang
- School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, PR China; Qingdao Hospital of Traditional Chinese Medicine (Qingdao Hiser Hospital), Qingdao, 266000, PR China
| | - Yiyue Gu
- Department of Cardiology, Xuzhou No.1 Peoples Hospital, Xuzhou, PR China
| | - Xin Hou
- School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, PR China; The Affiliated Hospital of Medical School, Ningbo University, Ningbo, PR China.
| |
Collapse
|
|
19
|
The Role of ER Stress in Diabetes: Exploring Pathological Mechanisms Using Wolfram Syndrome. Int J Mol Sci 2022; 24:ijms24010230. [PMID: 36613674 PMCID: PMC9820298 DOI: 10.3390/ijms24010230] [Citation(s) in RCA: 7] [Impact Index Per Article: 2.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/03/2022] [Revised: 12/19/2022] [Accepted: 12/19/2022] [Indexed: 12/25/2022] Open
Abstract
The endoplasmic reticulum (ER) is a cytosolic organelle that plays an essential role in the folding and processing of new secretory proteins, including insulin. The pathogenesis of diabetes, a group of metabolic disorders caused by dysfunctional insulin secretion (Type 1 diabetes, T1DM) or insulin sensitivity (Type 2 diabetes, T2DM), is known to involve the excess accumulation of "poorly folded proteins", namely, the induction of pathogenic ER stress in pancreatic β-cells. ER stress is known to contribute to the dysfunction of the insulin-producing pancreatic β-cells. T1DM and T2DM are multifactorial diseases, especially T2DM; both environmental and genetic factors are involved in their pathogenesis, making it difficult to create experimental disease models. In recent years, however, the development of induced pluripotent stem cells (iPSCs) and other regenerative technologies has greatly expanded research capabilities, leading to the development of new candidate therapies. In this review, we will discuss the mechanism by which dysregulated ER stress responses contribute to T2DM pathogenesis. Moreover, we describe new treatment methods targeting protein folding and ER stress pathways with a particular focus on pivotal studies of Wolfram syndrome, a monogenic form of syndromic diabetes caused by pathogenic variants in the WFS1 gene, which also leads to ER dysfunction.
Collapse
|
|
20
|
Liu YY, Huo D, Zeng LT, Fan GQ, Shen T, Zhang TM, Cai JP, Cui J. Mesencephalic astrocyte-derived neurotrophic factor (MANF): Structure, functions and therapeutic potential. Ageing Res Rev 2022; 82:101763. [PMID: 36272696 DOI: 10.1016/j.arr.2022.101763] [Citation(s) in RCA: 19] [Impact Index Per Article: 6.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/10/2022] [Revised: 09/18/2022] [Accepted: 10/15/2022] [Indexed: 01/31/2023]
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a novel evolutionarily conserved protein present in both vertebrate and invertebrate species. MANF shows distinct structural and functional properties than the traditional neurotrophic factors (NTF). MANF is composed of an N-terminal saposin-like lipid-binding domain and a C-terminal SAF-A/B, Acinus and PIAS (SAP) domain connected by a short linker. The two well-described activities of MANF include (1) role as a neurotrophic factor that plays direct neuroprotective effects in the nervous system and (2) cell protective effects in the animal models of non-neuronal diseases, including retinal damage, diabetes mellitus, liver injury, myocardial infarction, nephrotic syndrome, etc. The main objective of the current review is to provide up-to-date insights regarding the structure of MANF, mechanisms regulating its expression and secretion, physiological functions in various tissues and organs, protective effects during aging, and potential clinical applications. Together, this review highlights the importance of MANF in reversing age-related dysfunction and geroprotection.
Collapse
Affiliation(s)
- Yuan-Yuan Liu
- The Key Laboratory of Geriatrics, Beijing Institute of Geriatrics, Institute of Geriatric Medicine, Chinese Academy of Medical Science, Beijing Hospital/National Center of Gerontology of National Health Commission, Beijing, PR China
| | - Da Huo
- The Key Laboratory of Geriatrics, Beijing Institute of Geriatrics, Institute of Geriatric Medicine, Chinese Academy of Medical Science, Beijing Hospital/National Center of Gerontology of National Health Commission, Beijing, PR China
| | - Lv-Tao Zeng
- The Key Laboratory of Geriatrics, Beijing Institute of Geriatrics, Institute of Geriatric Medicine, Chinese Academy of Medical Science, Beijing Hospital/National Center of Gerontology of National Health Commission, Beijing, PR China
| | - Guo-Qing Fan
- The Key Laboratory of Geriatrics, Beijing Institute of Geriatrics, Institute of Geriatric Medicine, Chinese Academy of Medical Science, Beijing Hospital/National Center of Gerontology of National Health Commission, Beijing, PR China
| | - Tao Shen
- The Key Laboratory of Geriatrics, Beijing Institute of Geriatrics, Institute of Geriatric Medicine, Chinese Academy of Medical Science, Beijing Hospital/National Center of Gerontology of National Health Commission, Beijing, PR China
| | - Tie-Mei Zhang
- The Key Laboratory of Geriatrics, Beijing Institute of Geriatrics, Institute of Geriatric Medicine, Chinese Academy of Medical Science, Beijing Hospital/National Center of Gerontology of National Health Commission, Beijing, PR China
| | - Jian-Ping Cai
- The Key Laboratory of Geriatrics, Beijing Institute of Geriatrics, Institute of Geriatric Medicine, Chinese Academy of Medical Science, Beijing Hospital/National Center of Gerontology of National Health Commission, Beijing, PR China.
| | - Ju Cui
- The Key Laboratory of Geriatrics, Beijing Institute of Geriatrics, Institute of Geriatric Medicine, Chinese Academy of Medical Science, Beijing Hospital/National Center of Gerontology of National Health Commission, Beijing, PR China.
| |
Collapse
|
|
21
|
Eesmaa A, Yu LY, Göös H, Danilova T, Nõges K, Pakarinen E, Varjosalo M, Lindahl M, Lindholm P, Saarma M. CDNF Interacts with ER Chaperones and Requires UPR Sensors to Promote Neuronal Survival. Int J Mol Sci 2022; 23:ijms23169489. [PMID: 36012764 PMCID: PMC9408947 DOI: 10.3390/ijms23169489] [Citation(s) in RCA: 12] [Impact Index Per Article: 4.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/04/2022] [Revised: 08/16/2022] [Accepted: 08/20/2022] [Indexed: 11/16/2022] Open
Abstract
Cerebral dopamine neurotrophic factor (CDNF) is a neurotrophic factor that has beneficial effects on dopamine neurons in both in vitro and in vivo models of Parkinson's disease (PD). CDNF was recently tested in phase I-II clinical trials for the treatment of PD, but the mechanisms underlying its neuroprotective properties are still poorly understood, although studies have suggested its role in the regulation of endoplasmic reticulum (ER) homeostasis and the unfolded protein response (UPR). The aim of this study was to investigate the mechanism of action of CDNF through analyzing the involvement of UPR signaling in its anti-apoptotic function. We used tunicamycin to induce ER stress in mice in vivo and used cultured primary neurons and found that CDNF expression is regulated by ER stress in vivo and that the involvement of UPR pathways is important for the neuroprotective function of CDNF. Moreover, we used AP-MS and BiFC to perform the first interactome screening for CDNF and report novel binding partners of CDNF. These findings allowed us to hypothesize that CDNF protects neurons from ER-stress-inducing agents by modulating UPR signaling towards cell survival outcomes.
Collapse
|
|
22
|
Lõhelaid H, Anttila JE, Liew HK, Tseng KY, Teppo J, Stratoulias V, Airavaara M. UPR Responsive Genes Manf and Xbp1 in Stroke. Front Cell Neurosci 2022; 16:900725. [PMID: 35783104 PMCID: PMC9240287 DOI: 10.3389/fncel.2022.900725] [Citation(s) in RCA: 9] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/21/2022] [Accepted: 05/02/2022] [Indexed: 11/13/2022] Open
Abstract
Stroke is a devastating medical condition with no treatment to hasten recovery. Its abrupt nature results in cataclysmic changes in the affected tissues. Resident cells fail to cope with the cellular stress resulting in massive cell death, which cannot be endogenously repaired. A potential strategy to improve stroke outcomes is to boost endogenous pro-survival pathways. The unfolded protein response (UPR), an evolutionarily conserved stress response, provides a promising opportunity to ameliorate the survival of stressed cells. Recent studies from us and others have pointed toward mesencephalic astrocyte-derived neurotrophic factor (MANF) being a UPR responsive gene with an active role in maintaining proteostasis. Its pro-survival effects have been demonstrated in several disease models such as diabetes, neurodegeneration, and stroke. MANF has an ER-signal peptide and an ER-retention signal; it is secreted by ER calcium depletion and exits cells upon cell death. Although its functions remain elusive, conducted experiments suggest that the endogenous MANF in the ER lumen and exogenously administered MANF protein have different mechanisms of action. Here, we will revisit recent and older bodies of literature aiming to delineate the expression profile of MANF. We will focus on its neuroprotective roles in regulating neurogenesis and inflammation upon post-stroke administration. At the same time, we will investigate commonalities and differences with another UPR responsive gene, X-box binding protein 1 (XBP1), which has recently been associated with MANF’s function. This will be the first systematic comparison of these two UPR responsive genes aiming at revealing previously uncovered associations between them. Overall, understanding the mode of action of these UPR responsive genes could provide novel approaches to promote cell survival.
Collapse
Affiliation(s)
- Helike Lõhelaid
- HiLIFE – Neuroscience Center, University of Helsinki, Helsinki, Finland
- *Correspondence: Helike Lõhelaid,
| | - Jenni E. Anttila
- Drug Research Program, Division of Pharmacology and Pharmacotherapy, Faculty of Pharmacy, University of Helsinki, Helsinki, Finland
- Individualized Drug Therapy Research Program, Faculty of Medicine, University of Helsinki, Helsinki, Finland
| | - Hock-Kean Liew
- Department of Medical Research, Hualien Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, Hualien City, Taiwan
| | - Kuan-Yin Tseng
- Department of Neurological Surgery, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan
| | - Jaakko Teppo
- Drug Research Program, Division of Pharmaceutical Chemistry and Technology, Faculty of Pharmacy, University of Helsinki, Helsinki, Finland
| | | | - Mikko Airavaara
- HiLIFE – Neuroscience Center, University of Helsinki, Helsinki, Finland
- Drug Research Program, Division of Pharmacology and Pharmacotherapy, Faculty of Pharmacy, University of Helsinki, Helsinki, Finland
- Mikko Airavaara,
| |
Collapse
|
|
23
|
Wang Y, Wen W, Li H, Xu H, Xu M, Ma M, Luo J. Deficiency of mesencephalic astrocyte-derived neurotrophic factor affects neurogenesis in mouse brain. Brain Res Bull 2022; 183:49-56. [PMID: 35227768 PMCID: PMC10014018 DOI: 10.1016/j.brainresbull.2022.02.019] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/08/2021] [Revised: 02/18/2022] [Accepted: 02/24/2022] [Indexed: 12/31/2022]
Abstract
The mechanisms underlying the regulation of neurogenesis in the adult brain remain unclear. Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a neurotrophic factor that has been implicated in various neuropathological processes and endoplasmic reticulum stress. However, the role of MANF in neurogenesis has not been investigated. Using a central nervous system (CNS)-specific Manf knock-out mouse model, we examined the role of MANF in mouse neurogenesis. We demonstrated that MANF deficiency increased BrdU labeling and Ki-67 positive cells in the subgranular zone and subventricular zone. MANF knock-out-induced upregulation of proliferative activity was accompanied by a decrease of cell cycle inhibitors (p15 and p27), an increase of G2/M marker (phospho-histone H3), as well as an increase of neural progenitor markers (Sox2 and NeuroD1) in the brain. In vitro studies using N2A neuroblastoma cells showed that the gain-of-function of MANF inhibited cell cycle progression, whereas the loss-of-function of MANF promoted cell cycle progression. Collectively, our findings indicate MANF deficiency affects cell proliferation and suggest a role of MANF in the neurogenesis of the adult brain.
Collapse
Affiliation(s)
- Yongchao Wang
- Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37372, USA
| | - Wen Wen
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA
| | - Hui Li
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA
| | - Hong Xu
- Department of Pharmacology and Nutritional Sciences, University of Kentucky College of Medicine, Lexington, KY 40536, USA
| | - Mei Xu
- Department of Pharmacology and Nutritional Sciences, University of Kentucky College of Medicine, Lexington, KY 40536, USA
| | - Murong Ma
- Department of Pharmacology and Nutritional Sciences, University of Kentucky College of Medicine, Lexington, KY 40536, USA
| | - Jia Luo
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA; Iowa City VA Health Care System, Iowa City, IA 52246, USA.
| |
Collapse
|
|
24
|
Du H, Xu HX, Wang F, Qian LX, Liu SS, Wang XW. Armet from whitefly saliva acts as an effector to suppress plant defences by targeting tobacco cystatin. THE NEW PHYTOLOGIST 2022; 234:1848-1862. [PMID: 35238409 DOI: 10.1111/nph.18063] [Citation(s) in RCA: 14] [Impact Index Per Article: 4.7] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Subscribe] [Scholar Register] [Received: 10/28/2021] [Accepted: 02/18/2022] [Indexed: 06/14/2023]
Abstract
Arginine rich, mutated in early stage of tumours (Armet), is a well-characterized bifunctional protein as an unfolded protein response component intracellularly and a neurotrophic factor extracellularly in mammals. Recently, a new role of Armet as an effector protein mediating insect-plant interactions has been reported; however, its molecular mechanisms underlying the regulation of plant defences remain unclear. We investigated the molecular mechanisms underlying whitefly-secreted Armet-mediated regulation of insect-plant interaction by agrobacterium-mediated transient expression, RNA interference, electrical penetration graph, protein-protein interaction studies, virus-induced gene silencing assay, phytohormone analysis and whitefly bioassays. Armet, secreted by Bemisia tabaci whitefly, is highly expressed in the primary salivary gland and is delivered into tobacco plants during feeding. Overexpression of the BtArmet gene in tobacco enhanced whitefly performance, while silencing the BtArmet gene in whitefly interrupted whitefly feeding and suppressed whitefly performance on tobacco plants. BtArmet was shown to interact with NtCYS6, a cystatin protein essential for tobacco anti-whitefly resistance, and counteract the negative effects of NtCYS6 on whitefly. These results indicate that BtArmet is a salivary effector and acts to promote whitefly performance on tobacco plants through binding to the tobacco cystatin NtCYS6. Our findings provide novel insight into whitefly-plant interactions.
Collapse
Affiliation(s)
- Hui Du
- State Key Laboratory of Rice Biology, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
- Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insects, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
- Key Laboratory of Biology of Crop Pathogens and Insects of Zhejiang Province, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
- Institute of Insect Sciences, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
| | - Hong-Xing Xu
- Institute of Insect Sciences, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
| | - Fang Wang
- Institute of Insect Sciences, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
| | - Li-Xin Qian
- Institute of Insect Sciences, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
| | - Shu-Sheng Liu
- Institute of Insect Sciences, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
| | - Xiao-Wei Wang
- State Key Laboratory of Rice Biology, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
- Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insects, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
- Key Laboratory of Biology of Crop Pathogens and Insects of Zhejiang Province, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
- Institute of Insect Sciences, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China
| |
Collapse
|
|
25
|
Wen W, Li H, Luo J. Potential Role of MANF, an ER Stress Responsive Neurotrophic Factor, in Protecting Against Alcohol Neurotoxicity. Mol Neurobiol 2022; 59:2992-3015. [PMID: 35254650 PMCID: PMC10928853 DOI: 10.1007/s12035-022-02786-7] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/12/2021] [Accepted: 02/26/2022] [Indexed: 10/18/2022]
Abstract
Alcohol exposure during pregnancy is harmful to the fetus and causes a wide range of long-lasting physiological and neurocognitive impairments, collectively referred to as fetal alcohol spectrum disorders (FASD). The neurobehavioral deficits observed in FASD result from structural and functional damages in the brain, with neurodegeneration being the most destructive consequence. Currently, there are no therapies for FASD. It is exigent to delineate the underlying mechanisms of alcohol neurotoxicity and develop an effective strategy of treatment. ER stress, caused by the accumulation of unfolded/misfolded proteins in the ER, is the hallmark of many neurodegenerative diseases, including alcohol-induced neurodegeneration. Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a newly discovered endoplasmic reticulum (ER) stress responsive neurotrophic factor that regulates diverse neuronal functions. This review summarizes the recent findings revealing the effects of MANF on the CNS and its protective role against neurodegeneration. Particularly, we focus the role of MANF on alcohol-induced ER stress and neurodegeneration and discuss the therapeutic potential of MANF in treating alcohol neurotoxicity such as FASD.
Collapse
Affiliation(s)
- Wen Wen
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, 52242, USA
| | - Hui Li
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, 52242, USA
| | - Jia Luo
- Department of Pathology, University of Iowa Carver College of Medicine, Iowa City, IA, 52242, USA.
- Iowa City VA Health Care System, Iowa City, IA, 52246, USA.
| |
Collapse
|
|
26
|
Liu Q, Tang Q, Jing X, Zhang J, Xia Y, Yan J, Xu Y, Li J, Li Y, He J, Mo L. Mesencephalic astrocyte-derived neurotrophic factor protects against paracetamol -induced liver injury by inhibiting PERK-ATF4-CHOP signaling pathway. Biochem Biophys Res Commun 2022; 602:163-169. [PMID: 35278889 DOI: 10.1016/j.bbrc.2022.02.059] [Citation(s) in RCA: 3] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/11/2022] [Accepted: 02/16/2022] [Indexed: 02/08/2023]
Abstract
Paracetamol (APAP), an over-the-counter drug, is normally safe within the therapeutic dose range but can cause irreversible liver damage after an overdose. Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an endoplasmic reticulum (ER) stress protein and plays a crucial role in metabolic disease. However, the role of MANF in APAP-induced acute hepatotoxicity is still unknown. We used hepatocyte-specific MANF-knockout mice and hepatocyte-specific MANF transgenic mice to investigate the role of hepatocyte-derived MANF in APAP-induced acute liver injury. MANF deficiency was associated with a decreased expression of detoxification enzymes, aggravated glutathione depletion and apoptosis in hepatocytes. Mechanistically, MANF knockout significantly increased PERK-eIF2α-ATF4-CHOP signaling pathway. Blockade of PERK abolished MANF deficiency-over-induced hepatotoxicity after APAP administration. Conversely, hepatocyte-specific MANF overexpression attenuated APAP-induced hepatotoxicity by downregulating the PERK-eIF2α-ATF4-CHOP signaling pathway. Thus, hepatocyte-derived MANF may play a protective role in APAP-induced hepatotoxicity.
Collapse
Affiliation(s)
- Qinhui Liu
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Qin Tang
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Xiandan Jing
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Jinhang Zhang
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Yan Xia
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Jiamin Yan
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Ying Xu
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Jiahui Li
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Yanping Li
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Jinhan He
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital of Sichuan University, Chengdu, China
| | - Li Mo
- Center of Gerontology and Geriatrics, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, Sichuan Province, China.
| |
Collapse
|
|
27
|
Tang Q, Li Y, He J. MANF: an emerging therapeutic target for metabolic diseases. Trends Endocrinol Metab 2022; 33:236-246. [PMID: 35135706 DOI: 10.1016/j.tem.2022.01.001] [Citation(s) in RCA: 24] [Impact Index Per Article: 8.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 11/18/2021] [Revised: 01/04/2022] [Accepted: 01/07/2022] [Indexed: 02/08/2023]
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an endoplasmic reticulum-resident protein and a secretory factor and has beneficial effects in multiple diseases. Recent evidence shows that its circulating levels in humans are dynamically regulated under various metabolic diseases, including diabetes, obesity, fatty liver, and cardiovascular diseases, suggesting that MANF may play a role in these pathological states. Also, its downregulation in mice impairs glucose homeostasis, promotes lipid accumulation in the liver, reduces energy expenditure, and induces inflammation. Conversely, MANF overexpression prevents or mitigates some of these metabolic disturbances. In particular, systemic MANF administration alleviates dietary obesity and related metabolic disorders in obese mice. We therefore propose that MANF might be a promising target for treating chronic metabolic diseases.
Collapse
Affiliation(s)
- Qin Tang
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, China
| | - Yanping Li
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, China
| | - Jinhan He
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, China; Department of Pharmacy, State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, China.
| |
Collapse
|
|
28
|
Spliced or Unspliced, That Is the Question: The Biological Roles of XBP1 Isoforms in Pathophysiology. Int J Mol Sci 2022; 23:ijms23052746. [PMID: 35269888 PMCID: PMC8910952 DOI: 10.3390/ijms23052746] [Citation(s) in RCA: 13] [Impact Index Per Article: 4.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/15/2022] [Revised: 02/27/2022] [Accepted: 02/27/2022] [Indexed: 01/27/2023] Open
Abstract
X-box binding protein 1 (XBP1) is a member of the CREB/ATF basic region leucine zipper family transcribed as the unspliced isoform (XBP1-u), which, upon exposure to endoplasmic reticulum stress, is spliced into its spliced isoform (XBP1-s). XBP1-s interacts with the cAMP response element of major histocompatibility complex class II gene and plays critical role in unfolded protein response (UPR) by regulating the transcriptional activity of genes involved in UPR. XBP1-s is also involved in other physiological pathways, including lipid metabolism, insulin metabolism, and differentiation of immune cells. Its aberrant expression is closely related to inflammation, neurodegenerative disease, viral infection, and is crucial for promoting tumor progression and drug resistance. Meanwhile, recent studies reported that the function of XBP1-u has been underestimated, as it is not merely a precursor of XBP1-s. Instead, XBP-1u is a critical factor involved in various biological pathways including autophagy and tumorigenesis through post-translational regulation. Herein, we summarize recent research on the biological functions of both XBP1-u and XBP1-s, as well as their relation to diseases.
Collapse
|
|
29
|
Friend or foe for obesity: how hepatokines remodel adipose tissues and translational perspective. Genes Dis 2022. [DOI: 10.1016/j.gendis.2021.12.011] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/15/2022] Open
|
|
30
|
Lindholm P, Saarma M. Cerebral dopamine neurotrophic factor protects and repairs dopamine neurons by novel mechanism. Mol Psychiatry 2022; 27:1310-1321. [PMID: 34907395 PMCID: PMC9095478 DOI: 10.1038/s41380-021-01394-6] [Citation(s) in RCA: 44] [Impact Index Per Article: 14.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 06/14/2021] [Revised: 11/09/2021] [Accepted: 11/15/2021] [Indexed: 12/20/2022]
Abstract
Midbrain dopamine neurons deteriorate in Parkinson's disease (PD) that is a progressive neurodegenerative movement disorder. No cure is available that would stop the dopaminergic decline or restore function of injured neurons in PD. Neurotrophic factors (NTFs), e.g., glial cell line-derived neurotrophic factor (GDNF) are small, secreted proteins that promote neuron survival during mammalian development and regulate adult neuronal plasticity, and they are studied as potential therapeutic agents for the treatment of neurodegenerative diseases. However, results from clinical trials of GDNF and related NTF neurturin (NRTN) in PD have been modest so far. In this review, we focus on cerebral dopamine neurotrophic factor (CDNF), an unconventional neurotrophic protein. CDNF delivered to the brain parenchyma protects and restores dopamine neurons in animal models of PD. In a recent Phase I-II clinical trial CDNF was found safe and well tolerated. CDNF deletion in mice led to age-dependent functional changes in the brain dopaminergic system and loss of enteric neurons resulting in slower gastrointestinal motility. These defects in Cdnf-/- mice intriguingly resemble deficiencies observed in early stage PD. Different from classical NTFs, CDNF can function both as an extracellular trophic factor and as an intracellular, endoplasmic reticulum (ER) luminal protein that protects neurons and other cell types against ER stress. Similarly to the homologous mesencephalic astrocyte-derived neurotrophic factor (MANF), CDNF is able to regulate ER stress-induced unfolded protein response (UPR) signaling and promote protein homeostasis in the ER. Since ER stress is thought to be one of the pathophysiological mechanisms contributing to the dopaminergic degeneration in PD, CDNF, and its small-molecule derivatives that are under development may provide useful tools for experimental medicine and future therapies for the treatment of PD and other neurodegenerative protein-misfolding diseases.
Collapse
Affiliation(s)
- Päivi Lindholm
- grid.7737.40000 0004 0410 2071Institute of Biotechnology, Helsinki Institute of Life Science, University of Helsinki, FI-00014 Helsinki, Finland
| | - Mart Saarma
- Institute of Biotechnology, Helsinki Institute of Life Science, University of Helsinki, FI-00014, Helsinki, Finland.
| |
Collapse
|
|
31
|
MANF: A Novel Endoplasmic Reticulum Stress Response Protein-The Role in Neurological and Metabolic Disorders. OXIDATIVE MEDICINE AND CELLULAR LONGEVITY 2021; 2021:6467679. [PMID: 34745419 PMCID: PMC8568515 DOI: 10.1155/2021/6467679] [Citation(s) in RCA: 11] [Impact Index Per Article: 2.8] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 08/11/2021] [Accepted: 10/04/2021] [Indexed: 02/05/2023]
Abstract
The mesencephalic astrocyte-derived neurotrophic factor (MANF), also named as arginine-rich protein (ARP) or arginine-rich mutated in early-stage tumors (ARMET), is a novel evolutionary conserved protein related to unfolded protein response. Growing evidence suggests that MANF critically involves in many ER stress-related diseases with a protective effect. Here, we review the function of MANF based on its structure in neurological and metabolic disorders and summarize its potential applications in disease diagnosis and therapies.
Collapse
|
|
32
|
Krzeptowski W, Walkowicz L, Krzeptowska E, Motta E, Witek K, Szramel J, Al Abaquita T, Baster Z, Rajfur Z, Rosato E, Stratoulias V, Heino TI, Pyza EM. Mesencephalic Astrocyte-Derived Neurotrophic Factor Regulates Morphology of Pigment-Dispersing Factor-Positive Clock Neurons and Circadian Neuronal Plasticity in Drosophila melanogaster. Front Physiol 2021; 12:705183. [PMID: 34646147 PMCID: PMC8502870 DOI: 10.3389/fphys.2021.705183] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/04/2021] [Accepted: 08/31/2021] [Indexed: 11/13/2022] Open
Abstract
Mesencephalic Astrocyte-derived Neurotrophic Factor (MANF) is one of a few neurotrophic factors described in Drosophila melanogaster (DmMANF) but its function is still poorly characterized. In the present study we found that DmMANF is expressed in different clusters of clock neurons. In particular, the PDF-positive large (l-LNv) and small (s-LNv) ventral lateral neurons, the CRYPTOCHROME-positive dorsal lateral neurons (LNd), the group 1 dorsal neurons posterior (DN1p) and different tim-positive cells in the fly's visual system. Importantly, DmMANF expression in the ventral lateral neurons is not controlled by the clock nor it affects its molecular mechanism. However, silencing DmMANF expression in clock neurons affects the rhythm of locomotor activity in light:dark and constant darkness conditions. Such phenotypes correlate with abnormal morphology of the dorsal projections of the s-LNv and with reduced arborizations of the l-LNv in the medulla of the optic lobe. Additionally, we show that DmMANF is important for normal morphology of the L2 interneurons in the visual system and for the circadian rhythm in the topology of their dendritic tree. Our results indicate that DmMANF is important not only for the development of neurites but also for maintaining circadian plasticity of neurons.
Collapse
Affiliation(s)
- Wojciech Krzeptowski
- Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland
| | - Lucyna Walkowicz
- Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland
| | - Ewelina Krzeptowska
- Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland
| | - Edyta Motta
- Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland
| | - Kacper Witek
- Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland
| | - Joanna Szramel
- Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland
| | - Terence Al Abaquita
- Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland
| | - Zbigniew Baster
- Faculty of Physics, Astronomy and Applied Computer Science, Jagiellonian University, Kraków, Poland
| | - Zenon Rajfur
- Faculty of Physics, Astronomy and Applied Computer Science, Jagiellonian University, Kraków, Poland.,Jagiellonian Center of Biomedical Imaging, Jagiellonian University, Kraków, Poland
| | - Ezio Rosato
- Department of Genetics, University of Leicester, Leicester, United Kingdom
| | - Vassilis Stratoulias
- Molecular and Integrative Biosciences Research Program, Faculty of Biological and Environmental Sciences, University of Helsinki, Helsinki, Finland.,Neuroscience Center, HiLIFE, University of Helsinki, Helsinki, Finland
| | - Tapio I Heino
- Molecular and Integrative Biosciences Research Program, Faculty of Biological and Environmental Sciences, University of Helsinki, Helsinki, Finland
| | - Elżbieta M Pyza
- Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland.,Jagiellonian Center of Biomedical Imaging, Jagiellonian University, Kraków, Poland
| |
Collapse
|
|
33
|
Fu J, Malale K, Luo X, Chen M, Liu Q, Cheng W, Liu D. The relationship of mesencephalic astrocyte-derived neurotrophic factor with hyperlipidemia in patients with or without type 2 diabetes mellitus. Hormones (Athens) 2021; 20:537-543. [PMID: 33559083 DOI: 10.1007/s42000-021-00272-8] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 07/30/2020] [Accepted: 01/17/2021] [Indexed: 10/22/2022]
Abstract
PURPOSE This study was conducted to determine the relationship between mesencephalic astrocyte-derived neurotrophic factor (MANF) and lipid metabolism with or without type 2 diabetes mellitus (T2DM). METHODS Human serum samples were collected from 58 normal controls (NC), 40 subjects with hyperlipidemia (HLD) without T2DM, and 42 subjects with HLD and T2DM. Their MANF levels were detected using an enzyme-linked immunosorbent assay (ELISA). Subgroup analysis was performed in the group with HLD and T2DM based on fasting blood glucose (FBG) > 8.22 vs. FBG ≤ 8.22. Furthermore, the relationship between MANF levels and lipid indices was analyzed. RESULTS Serum MANF levels were found to be significantly higher in the HLD group, both with and without T2DM (5.62 (3.59-7.11) and 4.21 (2.87-6.11)), both P < 0.001, than in the NC (2.81(1.81-4.01). MANF levels were higher in those with FBG > 8.22 than that in those with FBG ≤ 8.22. In addition, in the HLD without T2DM group, MANF levels were negatively correlated with total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and age, while LDL-C and age were independently related to MANF levels. The area under the curve (AUC) in the ROC analysis of MANF for the diagnosis of HLD without T2DM and HLD with T2DM was 0.709 and 0.841, respectively (P < 0.001). CONCLUSION Serum MANF levels increased in the HLD with or without T2DM groups and was associated with lipid and glucose metabolism. MANF may be a useful marker for predicting the development of dyslipidemia in T2DM.
Collapse
Affiliation(s)
- Jili Fu
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, 400010, Chongqing, China
- Daping Hospital, Army Medical University (Third Military Medical University), Chongqing, China
| | - Kija Malale
- Department of Gastroenterology, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, 400010, Chongqing, China
- Archbishop Anthony Mayala School of Nursing, Catholic University of Health and Allied Sciences, Mwanza, Tanzania
| | - Xie Luo
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, 400010, Chongqing, China
| | - Min Chen
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, 400010, Chongqing, China
| | - Qicong Liu
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, 400010, Chongqing, China
| | - Wei Cheng
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, 400010, Chongqing, China.
| | - Dongfang Liu
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, 400010, Chongqing, China
| |
Collapse
|
|
34
|
Gopar-Cuevas Y, Duarte-Jurado AP, Diaz-Perez RN, Saucedo-Cardenas O, Loera-Arias MJ, Montes-de-Oca-Luna R, Rodriguez-Rocha H, Garcia-Garcia A. Pursuing Multiple Biomarkers for Early Idiopathic Parkinson's Disease Diagnosis. Mol Neurobiol 2021; 58:5517-5532. [PMID: 34350555 DOI: 10.1007/s12035-021-02500-z] [Citation(s) in RCA: 6] [Impact Index Per Article: 1.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/09/2021] [Accepted: 07/16/2021] [Indexed: 12/21/2022]
Abstract
Parkinson's disease (PD) ranks first in the world as a neurodegenerative movement disorder and occurs most commonly in an idiopathic form. PD patients may have motor symptoms, non-motor symptoms, including cognitive and behavioral changes, and symptoms related to autonomic nervous system (ANS) failures, such as gastrointestinal, urinary, and cardiovascular symptoms. Unfortunately, the diagnostic accuracy of PD by general neurologists is relatively low. Currently, there is no objective molecular or biochemical test for PD; its diagnosis is based on clinical criteria, mainly by cardinal motor symptoms, which manifest when patients have lost about 60-80% of dopaminergic neurons. Therefore, it is urgent to establish a panel of biomarkers for the early and accurate diagnosis of PD. Once the disease is accurately diagnosed, it may be easier to unravel idiopathic PD's pathogenesis, and ultimately, finding a cure. This review discusses several biomarkers' potential to set a panel for early idiopathic PD diagnosis and future directions.
Collapse
Affiliation(s)
- Yareth Gopar-Cuevas
- Departamento de Histología, Facultad de Medicina, Universidad Autónoma de Nuevo León, 64460, Monterrey, Mexico
| | - Ana P Duarte-Jurado
- Departamento de Histología, Facultad de Medicina, Universidad Autónoma de Nuevo León, 64460, Monterrey, Mexico
| | - Rosa N Diaz-Perez
- Departamento de Histología, Facultad de Medicina, Universidad Autónoma de Nuevo León, 64460, Monterrey, Mexico
| | - Odila Saucedo-Cardenas
- Departamento de Histología, Facultad de Medicina, Universidad Autónoma de Nuevo León, 64460, Monterrey, Mexico.,Departamento de Genética Molecular, Centro de Investigación Biomédica del Noreste, Delegación Nuevo León, Instituto Mexicano del Seguro Social, Monterrey, Mexico
| | - Maria J Loera-Arias
- Departamento de Histología, Facultad de Medicina, Universidad Autónoma de Nuevo León, 64460, Monterrey, Mexico
| | - Roberto Montes-de-Oca-Luna
- Departamento de Histología, Facultad de Medicina, Universidad Autónoma de Nuevo León, 64460, Monterrey, Mexico
| | - Humberto Rodriguez-Rocha
- Departamento de Histología, Facultad de Medicina, Universidad Autónoma de Nuevo León, 64460, Monterrey, Mexico.
| | - Aracely Garcia-Garcia
- Departamento de Histología, Facultad de Medicina, Universidad Autónoma de Nuevo León, 64460, Monterrey, Mexico.
| |
Collapse
|
|
35
|
Eremin DV, Ilchibaeva TV, Tsybko AS. Cerebral Dopamine Neurotrophic Factor (CDNF): Structure, Functions, and Therapeutic Potential. BIOCHEMISTRY (MOSCOW) 2021; 86:852-866. [PMID: 34284712 DOI: 10.1134/s0006297921070063] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 11/23/2022]
Abstract
The cerebral dopamine neurotrophic factor (CDNF) together with the mesencephalic astrocyte-derived neurotrophic factor (MANF) form a unique family of neurotrophic factors (NTFs) structurally and functionally different from other proteins with neurotrophic activity. CDNF has no receptors on the cell membrane, is localized mainly in the cavity of endoplasmic reticulum (ER), and its primary function is to regulate ER stress. In addition, CDNF is able to suppress inflammation and apoptosis. Due to its functions, CDNF has demonstrated outstanding protective and restorative properties in various models of neuropathology associated with ER stress, including Parkinson's disease (PD). That is why CDNF already passed clinical trials in patients with PD. However, despite the name, CDNF functions extend far beyond the dopamine system in the brain. In particular, there are data on participation of CDNF in the maturation and maintenance of other neurotransmitter systems, regulation of the processes of neuroplasticity and non-motor behavior. In the present review, we discuss the features of CDNF structure and functions, its protective and regenerative properties.
Collapse
Affiliation(s)
- Dmitry V Eremin
- Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, 630090, Russia
| | - Tatiana V Ilchibaeva
- Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, 630090, Russia
| | - Anton S Tsybko
- Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, 630090, Russia.
| |
Collapse
|
|
36
|
Peled M, Bar-Lev TH, Talalai E, Aspitz HZ, Daniel-Meshulam I, Bar J, Kamer I, Ofek E, Mor A, Onn A. Mesencephalic astrocyte-derived neurotrophic factor is secreted from interferon-γ-activated tumor cells through ER calcium depletion. PLoS One 2021; 16:e0250178. [PMID: 33891607 PMCID: PMC8064521 DOI: 10.1371/journal.pone.0250178] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/08/2020] [Accepted: 03/31/2021] [Indexed: 01/05/2023] Open
Abstract
The most successful immunotherapeutic agents are blocking antibodies to either programmed cell death-1 (PD-1), an inhibitory receptor expressed on T lymphocytes, or to its ligand, programmed cell death-ligand 1 (PD-L1). Nevertheless, many patients do not respond, and additional approaches, specifically blocking other inhibitory receptors on T cells, are being explored. Importantly, the source of the ligands for these receptors are often the tumor cells. Indeed, cancer cells express high levels of PD-L1 upon stimulation with interferon-γ (IFN-γ), a major cytokine in the tumor microenvironment. The increase in PD-L1 expression serves as a negative feedback towards the immune system, and allows the tumor to evade the attack of immune cells. A potential novel immunoregulator is mesencephalic astrocyte-derived neurotrophic factor (MANF), an endoplasmic reticulum (ER)-resident protein that is secreted from pancreatic beta cells upon cytokines activation, and can induce an alternatively activated macrophage phenotype (M2), and thus may support tumor growth. While MANF was shown to be secreted from pancreatic beta cells, its IFN-γ-induced secretion from tumor cells has never been assessed. Here we found that IFN-γ induced MANF secretion from diverse tumor cell-lines-melanoma cells, colon carcinoma cells and hepatoma cells. Mechanistically, there was no increase in MANF RNA or intracellular protein levels upon IFN-γ stimulation. However, IFN-γ induced ER calcium depletion, which was necessary for MANF secretion, as Dantrolene, an inhibitor of ER calcium release, prevented its secretion. Thus, MANF is secreted from IFN-γ-stimulated tumor cells, and further studies are required to assess its potential as a drug target for cancer immunotherapy.
Collapse
Affiliation(s)
- Michael Peled
- Institute of Pulmonary Medicine, Sheba Medical Center, Tel Hashomer, Israel
- Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel
- * E-mail:
| | - Tali H. Bar-Lev
- Institute of Pulmonary Medicine, Sheba Medical Center, Tel Hashomer, Israel
| | - Efrosiniia Talalai
- Institute of Pulmonary Medicine, Sheba Medical Center, Tel Hashomer, Israel
- Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel
| | - Haggar Zoë Aspitz
- Institute of Pulmonary Medicine, Sheba Medical Center, Tel Hashomer, Israel
- Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel
| | | | - Jair Bar
- Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel
- Thoracic Oncology Unit, Institute of Oncology, Sheba Medical Center, Tel Hashomer, Israel
| | - Iris Kamer
- Thoracic Oncology Unit, Institute of Oncology, Sheba Medical Center, Tel Hashomer, Israel
| | - Efrat Ofek
- Pathology Department, Tel HaShomer Hospital, Tel Hashomer, Israel
| | - Adam Mor
- Columbia Center for Translational Immunology, Columbia University Medical Center, New York, NY, United States of America
| | - Amir Onn
- Institute of Pulmonary Medicine, Sheba Medical Center, Tel Hashomer, Israel
| |
Collapse
|
|
37
|
Wu T, Liu Q, Li Y, Li H, Chen L, Yang X, Tang Q, Pu S, Kuang J, Li R, Huang Y, Zhang J, Zhang Z, Zhou J, Huang C, Zhang G, Zhao Y, Zou M, Jiang W, Mo L, He J. Feeding-induced hepatokine, Manf, ameliorates diet-induced obesity by promoting adipose browning via p38 MAPK pathway. J Exp Med 2021; 218:211993. [PMID: 33856409 PMCID: PMC8054200 DOI: 10.1084/jem.20201203] [Citation(s) in RCA: 45] [Impact Index Per Article: 11.3] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/10/2020] [Revised: 12/19/2020] [Accepted: 02/12/2021] [Indexed: 02/05/2023] Open
Abstract
Activating beige adipocytes in white adipose tissue (WAT) to increase energy expenditure is a promising strategy to combat obesity. We identified that mesencephalic astrocyte–derived neurotrophic factor (Manf) is a feeding-induced hepatokine. Liver-specific Manf overexpression protected mice against high-fat diet–induced obesity and promoted browning of inguinal subcutaneous WAT (iWAT). Manf overexpression in liver was also associated with decreased adipose inflammation and improved insulin sensitivity and hepatic steatosis. Mechanistically, Manf could directly promote browning of white adipocytes via the p38 MAPK pathway. Blockade of p38 MAPK abolished Manf-induced browning. Consistently, liver-specific Manf knockout mice showed impaired iWAT browning and exacerbated diet-induced obesity, insulin resistance, and hepatic steatosis. Recombinant Manf reduced obesity and improved insulin resistance in both diet-induced and genetic obese mouse models. Finally, we showed that circulating Manf level was positively correlated with BMI in humans. This study reveals the crucial role of Manf in regulating thermogenesis in adipose tissue, representing a potential therapeutic target for obesity and related metabolic disorders.
Collapse
Affiliation(s)
- Tong Wu
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Qinhui Liu
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Yanping Li
- Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Hong Li
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Lei Chen
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Xuping Yang
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Qin Tang
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Shiyun Pu
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Jiangying Kuang
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Rui Li
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Ya Huang
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Jinhang Zhang
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Zijing Zhang
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Jian Zhou
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Cuiyuan Huang
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Guorong Zhang
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Yingnan Zhao
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Min Zou
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Wei Jiang
- Molecular Medicine Research Center, West China Hospital of Sichuan University, Chengdu, China
| | - Li Mo
- Center of Gerontology and Geriatrics, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| | - Jinhan He
- Department of Pharmacy, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China.,Laboratory of Clinical Pharmacy and Adverse Drug Reaction, National Clinical Research Center for Geriatrics, West China Hospital, Sichuan University, Chengdu, China
| |
Collapse
|
|
38
|
Montaser H, Patel KA, Balboa D, Ibrahim H, Lithovius V, Näätänen A, Chandra V, Demir K, Acar S, Ben-Omran T, Colclough K, Locke JM, Wakeling M, Lindahl M, Hattersley AT, Saarimäki-Vire J, Otonkoski T. Loss of MANF Causes Childhood-Onset Syndromic Diabetes Due to Increased Endoplasmic Reticulum Stress. Diabetes 2021; 70:1006-1018. [PMID: 33500254 PMCID: PMC7610619 DOI: 10.2337/db20-1174] [Citation(s) in RCA: 36] [Impact Index Per Article: 9.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 11/20/2020] [Accepted: 01/20/2021] [Indexed: 02/07/2023]
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an endoplasmic reticulum (ER)-resident protein that plays a crucial role in attenuating ER stress responses. Although MANF is indispensable for the survival and function of mouse β-cells, its precise role in human β-cell development and function is unknown. In this study, we show that lack of MANF in humans results in diabetes due to increased ER stress, leading to impaired β-cell function. We identified two patients from different families with childhood diabetes and a neurodevelopmental disorder associated with homozygous loss-of-function mutations in the MANF gene. To study the role of MANF in human β-cell development and function, we knocked out the MANF gene in human embryonic stem cells and differentiated them into pancreatic endocrine cells. Loss of MANF induced mild ER stress and impaired insulin-processing capacity of β-cells in vitro. Upon implantation to immunocompromised mice, the MANF knockout grafts presented elevated ER stress and functional failure, particularly in recipients with diabetes. By describing a new form of monogenic neurodevelopmental diabetes syndrome caused by disturbed ER function, we highlight the importance of adequate ER stress regulation for proper human β-cell function and demonstrate the crucial role of MANF in this process.
Collapse
Affiliation(s)
- Hossam Montaser
- Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki, Helsinki, Finland
| | - Kashyap A Patel
- Institute of Biomedical and Clinical Science, College of Medicine and Health, University of Exeter, Exeter, U.K.
| | - Diego Balboa
- Bioinformatics and Genomics Program, Centre for Genomic Regulation, The Barcelona Institute of Science and Technology, Barcelona, Spain
| | - Hazem Ibrahim
- Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki, Helsinki, Finland
| | - Väinö Lithovius
- Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki, Helsinki, Finland
| | - Anna Näätänen
- Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki, Helsinki, Finland
| | - Vikash Chandra
- Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki, Helsinki, Finland
| | - Korcan Demir
- Department of Pediatric Endocrinology, Dokuz Eylül University, Izmir, Turkey
| | - Sezer Acar
- Department of Pediatric Endocrinology, Dokuz Eylül University, Izmir, Turkey
| | - Tawfeg Ben-Omran
- Section of Clinical and Metabolic Genetics, Department of Pediatrics, Hamad Medical Corporation, Doha, Qatar
- Department of Pediatrics, Weill Cornell Medical College, Doha, Qatar
- Division of Genetic and Genomic Medicine, Sidra Medicine, Doha, Qatar
| | - Kevin Colclough
- Department of Molecular Genetics, Royal Devon and Exeter NHS Foundation Trust, Exeter, U.K
| | - Jonathan M Locke
- Institute of Biomedical and Clinical Science, College of Medicine and Health, University of Exeter, Exeter, U.K
| | - Matthew Wakeling
- Institute of Biomedical and Clinical Science, College of Medicine and Health, University of Exeter, Exeter, U.K
| | - Maria Lindahl
- Research Program in Developmental Biology, Institute of Biotechnology, University of Helsinki, Helsinki, Finland
| | - Andrew T Hattersley
- Institute of Biomedical and Clinical Science, College of Medicine and Health, University of Exeter, Exeter, U.K
| | - Jonna Saarimäki-Vire
- Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki, Helsinki, Finland
| | - Timo Otonkoski
- Stem Cells and Metabolism Research Program, Faculty of Medicine, University of Helsinki, Helsinki, Finland
| |
Collapse
|
|
39
|
Eesmaa A, Yu LY, Göös H, Nõges K, Kovaleva V, Hellman M, Zimmermann R, Jung M, Permi P, Varjosalo M, Lindholm P, Saarma M. The cytoprotective protein MANF promotes neuronal survival independently from its role as a GRP78 cofactor. J Biol Chem 2021; 296:100295. [PMID: 33460650 PMCID: PMC7949057 DOI: 10.1016/j.jbc.2021.100295] [Citation(s) in RCA: 25] [Impact Index Per Article: 6.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/07/2020] [Revised: 01/07/2021] [Accepted: 01/12/2021] [Indexed: 12/14/2022] Open
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an endoplasmic reticulum (ER)-stress-regulated protein exhibiting cytoprotective properties through a poorly understood mechanism in various in vitro and in vivo models of neuronal and non-neuronal damage. Although initially characterized as a secreted neurotrophic factor for midbrain dopamine neurons, MANF has recently gained more interest for its intracellular role in regulating the ER homeostasis, including serving as a cofactor of the chaperone glucose-regulated protein 78 (GRP78). We aimed for a better understanding of the neuroprotective mechanisms of MANF. Here we show for the first time that MANF promotes the survival of ER-stressed neurons in vitro as a general unfolded protein response (UPR) regulator, affecting several UPR pathways simultaneously. Interestingly, MANF does not affect naïve neurons. We hypothesize that MANF regulates UPR signaling toward a mode more compatible with neuronal survival. Screening of MANF interacting proteins from two mammalian cell lines revealed a conserved interactome of 15 proteins including several ER chaperones such as GRP78, GRP170, protein disulfide isomerase family A member 1, and protein disulfide isomerase family A member 6. Further characterization confirmed previously published finding that MANF is a cofactor of GRP78 interacting with its nucleotide binding domain. Using microscale thermophoresis and nuclear magnetic resonance spectroscopy, we discovered that MANF is an ATP binding protein and that ATP blocks the MANF-GRP78 interaction. Interestingly, functional analysis of the antiapoptotic properties of MANF mutants in cultured neurons revealed divergent roles of MANF as a GRP78 cofactor and as an antiapoptotic regulator of UPR. We conclude that the co-factor type interaction with GRP78 is dispensable for the survival-promoting activity of MANF in neurons.
Collapse
Affiliation(s)
- Ave Eesmaa
- Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland
| | - Li-Ying Yu
- Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland
| | - Helka Göös
- Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland
| | - Kristofer Nõges
- Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland
| | - Vera Kovaleva
- Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland
| | - Maarit Hellman
- Department of Chemistry, Nanoscience Center, University of Jyväskylä, Jyväskylä, Finland
| | - Richard Zimmermann
- Medical Biochemistry and Molecular Biology, Saarland University, Homburg, Germany
| | - Martin Jung
- Medical Biochemistry and Molecular Biology, Saarland University, Homburg, Germany
| | - Perttu Permi
- Department of Chemistry, Nanoscience Center, University of Jyväskylä, Jyväskylä, Finland; Department of Biological and Environmental Science, Nanoscience Center, University of Jyväskylä, Jyväskylä, Finland
| | - Markku Varjosalo
- Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland
| | - Päivi Lindholm
- Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland.
| | - Mart Saarma
- Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland.
| |
Collapse
|
|
40
|
Maciel L, de Oliveira DF, Mesquita F, Souza HADS, Oliveira L, Christie MLA, Palhano FL, Campos de Carvalho AC, Nascimento JHM, Foguel D. New Cardiomyokine Reduces Myocardial Ischemia/Reperfusion Injury by PI3K-AKT Pathway Via a Putative KDEL-Receptor Binding. J Am Heart Assoc 2021; 10:e019685. [PMID: 33372525 PMCID: PMC7955482 DOI: 10.1161/jaha.120.019685] [Citation(s) in RCA: 15] [Impact Index Per Article: 3.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 10/06/2020] [Accepted: 11/11/2020] [Indexed: 02/06/2023]
Abstract
Background CDNF (cerebral dopamine neurotrophic factor) belongs to a new family of neurotrophic factors that exert systemic beneficial effects beyond the brain. Little is known about the role of CDNF in the cardiac context. Herein we investigated the effects of CDNF under endoplasmic reticulum-stress conditions using cardiomyocytes (humans and mice) and isolated rat hearts, as well as in rats subjected to ischemia/reperfusion (I/R). Methods and Results We showed that CDNF is secreted by cardiomyocytes stressed by thapsigargin and by isolated hearts subjected to I/R. Recombinant CDNF (exoCDNF) protected human and mouse cardiomyocytes against endoplasmic reticulum stress and restored the calcium transient. In isolated hearts subjected to I/R, exoCDNF avoided mitochondrial impairment and reduced the infarct area to 19% when administered before ischemia and to 25% when administered at the beginning of reperfusion, compared with an infarct area of 42% in the untreated I/R group. This protection was completely abrogated by AKT (protein kinase B) inhibitor. Heptapeptides containing the KDEL sequence, which binds to the KDEL-R (KDEL receptor), abolished exoCDNF beneficial effects, suggesting the participation of KDEL-R in this cardioprotection. CDNF administered intraperitoneally to rats decreased the infarct area in an in vivo model of I/R (from an infarct area of ≈44% in the I/R group to an infarct area of ≈27%). Moreover, a shorter version of CDNF, which lacks the last 4 residues (CDNF-ΔKTEL) and thus allows CDNF binding to KDEL-R, presented no cardioprotective activity in isolated hearts. Conclusions This is the first study to propose CDNF as a new cardiomyokine that induces cardioprotection via KDEL receptor binding and PI3K/AKT activation.
Collapse
Affiliation(s)
- Leonardo Maciel
- Institute of Biophysics Carlos Chagas FilhoFederal University of Rio de JaneiroBrazil
| | | | - Fernanda Mesquita
- Institute of Biophysics Carlos Chagas FilhoFederal University of Rio de JaneiroBrazil
| | | | - Leandro Oliveira
- Institute of Medical Biochemistry Leopoldo de MeisRio de Janeiro Federal, University of Rio de JaneiroBrazil
| | | | - Fernando L. Palhano
- Institute of Medical Biochemistry Leopoldo de MeisRio de Janeiro Federal, University of Rio de JaneiroBrazil
| | | | | | - Debora Foguel
- Institute of Medical Biochemistry Leopoldo de MeisRio de Janeiro Federal, University of Rio de JaneiroBrazil
| |
Collapse
|
|
41
|
Wang P, Yang Y, Pang G, Zhang C, Wei C, Tao X, Liu J, Xu J, Zhang W, Shen Y. Hepatocyte-derived MANF is protective for rifampicin-induced cholestatic hepatic injury via inhibiting ATF4-CHOP signal activation. Free Radic Biol Med 2021; 162:283-297. [PMID: 33127565 DOI: 10.1016/j.freeradbiomed.2020.10.028] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 09/22/2020] [Accepted: 10/18/2020] [Indexed: 02/03/2023]
Abstract
Rifampicin (RFP) has been known to be potentially hepatotoxic and often used as an inducer of cholestatic hepatic injury. Here we found that mesencephalic astrocyte-derived neurotrophic factor (MANF), an endoplasmic reticulum (ER) stress inducible protein, is a protector in RFP-induced liver injury. In cholestatic hepatic injury mice induced by RFP, the liver/body ratio and the levels of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total bile acid (TBA), total bilirubin (TBIL), and direct bilirubin (DBIL) were significantly increased. Meanwhile, the protein and mRNA levels of MANF were remarkably elevated in the liver injury mice. In hepatocyte-specific MANF knockout (HKO) mice, an extra increase in the liver/body ratio and serum ALT, AST, ALP, TBA, TBIL, and DBIL levels was detected after treatment with RFP. In addition, recombinant human MANF (rhMANF) treatment efficiently reduced the liver/body ratio and serum ALT, AST, ALP, TBA, TBIL, and DBIL levels in RFP-induced liver injury mice. Furthermore, we found there is an increase in the number of the apoptotic cells, detected by TUNEL staining in the liver tissues of HKO mice. Meanwhile, the protein levels of C/EBP-homologous protein (CHOP), Ki67, and the proliferating cell nuclear antigen (PCNA), as well as the mRNA level of Ki67 were elevated after treated with RFP, and these parameters were increased more significantly in HKO mice than that in wild type (WT) controls in RFP-induced liver injury. The rhMANF treatment can rescue the cell apoptosis and reduce the protein and mRNA levels of CHOP, Ki67, and PCNA elevated by MANF deletion and RFP. In HKO mice, immunoglobulin heavy chain binding protein (BIP) and activating transcription factor 4 (ATF4) were predominantly increased after treatment with RFP, which were reduced by rhMANF treatment. Therefore, we conclude that hepatocyte-derived MANF is protective for RFP-induced cholestatic hepatic injury via inhibiting ATF4-CHOP signal activation and subsequent cell apoptosis.
Collapse
Affiliation(s)
- Peng Wang
- School of Basic Medical Sciences, Anhui Medical University, Hefei, 230032, Anhui, China; Biopharmaceutical Research Institute, Anhui Medical University, Hefei, 230032, Anhui, China.
| | - Yi Yang
- School of Basic Medical Sciences, Anhui Medical University, Hefei, 230032, Anhui, China; Biopharmaceutical Research Institute, Anhui Medical University, Hefei, 230032, Anhui, China.
| | - Gaozong Pang
- School of Basic Medical Sciences, Anhui Medical University, Hefei, 230032, Anhui, China; Biopharmaceutical Research Institute, Anhui Medical University, Hefei, 230032, Anhui, China.
| | - Chaoyi Zhang
- School of Basic Medical Sciences, Anhui Medical University, Hefei, 230032, Anhui, China; Biopharmaceutical Research Institute, Anhui Medical University, Hefei, 230032, Anhui, China.
| | - Chuansheng Wei
- School of Basic Medical Sciences, Anhui Medical University, Hefei, 230032, Anhui, China; Biopharmaceutical Research Institute, Anhui Medical University, Hefei, 230032, Anhui, China.
| | - Xiaofang Tao
- School of Basic Medical Sciences, Anhui Medical University, Hefei, 230032, Anhui, China; Biopharmaceutical Research Institute, Anhui Medical University, Hefei, 230032, Anhui, China.
| | - Jun Liu
- School of Basic Medical Sciences, Anhui Medical University, Hefei, 230032, Anhui, China; Biopharmaceutical Research Institute, Anhui Medical University, Hefei, 230032, Anhui, China.
| | - Jianming Xu
- Department of Gastroenterology, The First Affiliated Hospital of Anhui Medical University, Hefei, 230022, Anhui, China.
| | - Weiping Zhang
- Department of Gastroenterology, The First Affiliated Hospital of Anhui Medical University, Hefei, 230022, Anhui, China.
| | - Yuxian Shen
- School of Basic Medical Sciences, Anhui Medical University, Hefei, 230032, Anhui, China; Biopharmaceutical Research Institute, Anhui Medical University, Hefei, 230032, Anhui, China.
| |
Collapse
|
|
42
|
Neuroplastin Modulates Anti-inflammatory Effects of MANF. iScience 2020; 23:101810. [PMID: 33299977 PMCID: PMC7702011 DOI: 10.1016/j.isci.2020.101810] [Citation(s) in RCA: 42] [Impact Index Per Article: 8.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/24/2020] [Revised: 06/22/2020] [Accepted: 11/11/2020] [Indexed: 02/07/2023] Open
Abstract
Endoplasmic reticulum (ER) stress is known to induce pro-inflammatory response and ultimately leads to cell death. Mesencephalic astrocyte-derived neurotrophic factor (MANF) is an ER-localized protein whose expression and secretion is induced by ER stress and a crucial survival factor. However, the underlying mechanism of how MANF exerts its cytoprotective activity remains unclear due to the lack of knowledge of its receptor. Here we show that Neuroplastin (NPTN) is such a receptor for MANF. Biochemical analysis shows the physiological interaction between MANF and NPTN on the cell surface. Binding of MANF to NPTN mitigates the inflammatory response and apoptosis via suppression of NF-kβ signaling. Our results demonstrate that NPTN is a cell surface receptor for MANF, which modulates inflammatory responses and cell death, and that the MANF-NPTN survival signaling described here provides potential therapeutic targets for the treatment of ER stress-related disorders, including diabetes mellitus, neurodegeneration, retinal degeneration, and Wolfram syndrome.
Neuroplastin (NPTN) is a plasma membrane receptor for MANF NPTN regulates MANF-mediated suppression of inflammation NPTN regulates cell survival mediated by MANF under ER stress MANF-NPTN survival pathway provides potential therapeutic targets for ER stress-related disorders
Collapse
|
|
43
|
Linnerbauer M, Rothhammer V. Protective Functions of Reactive Astrocytes Following Central Nervous System Insult. Front Immunol 2020; 11:573256. [PMID: 33117368 PMCID: PMC7561408 DOI: 10.3389/fimmu.2020.573256] [Citation(s) in RCA: 135] [Impact Index Per Article: 27.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/01/2020] [Accepted: 09/14/2020] [Indexed: 12/14/2022] Open
Abstract
Astrocytes play important roles in numerous central nervous system disorders including autoimmune inflammatory, hypoxic, and degenerative diseases such as Multiple Sclerosis, ischemic stroke, and Alzheimer’s disease. Depending on the spatial and temporal context, activated astrocytes may contribute to the pathogenesis, progression, and recovery of disease. Recent progress in the dissection of transcriptional responses to varying forms of central nervous system insult has shed light on the mechanisms that govern the complexity of reactive astrocyte functions. While a large body of research focuses on the pathogenic effects of reactive astrocytes, little is known about how they limit inflammation and contribute to tissue regeneration. However, these protective astrocyte pathways might be of relevance for the understanding of the underlying pathology in disease and may lead to novel targeted approaches to treat autoimmune inflammatory and degenerative disorders of the central nervous system. In this review article, we have revisited the emerging concept of protective astrocyte functions and discuss their role in the recovery from inflammatory and ischemic disease as well as their role in degenerative disorders. Focusing on soluble astrocyte derived mediators, we aggregate the existing knowledge on astrocyte functions in the maintenance of homeostasis as well as their reparative and tissue-protective function after acute lesions and in neurodegenerative disorders. Finally, we give an outlook of how these mediators may guide future therapeutic strategies to tackle yet untreatable disorders of the central nervous system.
Collapse
Affiliation(s)
- Mathias Linnerbauer
- Department of Neurology, Klinikum rechts der Isar, Technical University of Munich, Munich, Germany.,Department of Neurology, University Hospital Erlangen, Friedrich-Alexander University Erlangen-Nürnberg, Erlangen, Germany
| | - Veit Rothhammer
- Department of Neurology, Klinikum rechts der Isar, Technical University of Munich, Munich, Germany.,Department of Neurology, University Hospital Erlangen, Friedrich-Alexander University Erlangen-Nürnberg, Erlangen, Germany
| |
Collapse
|
|
44
|
He J, Li G, Liu X, Ma L, Zhang J, Zheng S, Wang J, Liu J. Mesencephalic Astrocyte-Derived Neurotrophic Factor, a Prognostic Factor of Cholangiocarcinoma, Affects Sorafenib Sensitivity of Cholangiocarcinoma Cells by Deteriorating ER Stress. Onco Targets Ther 2020; 13:9169-9184. [PMID: 32982305 PMCID: PMC7502388 DOI: 10.2147/ott.s245575] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/10/2020] [Accepted: 08/11/2020] [Indexed: 01/06/2023] Open
Abstract
Purpose Intrahepatic cholangiocarcinoma (ICC) is an aggressive malignant tumor characterized by high malignancy and poor prognosis. Although the efficacy of sorafenib against cholangiocarcinoma cell lines has been demonstrated in vivo and in vitro, limited clinical data are available on the efficacy of sorafenib in patients with cholangiocarcinoma. Sorafenib can enhance endoplasmic reticulum (ER) stress-mediated apoptosis, and ER stress and unfolded protein response are also the mechanisms by which cancer cells resist drug therapy. Mesencephalic astrocyte-derived neurotrophic factor (MANF), initially identified as a neurotrophic factor, can be regulated by ER stress activation. There are no available studies on the diagnostic value and therapeutic significance of MANF in ICC. Hence, the purpose of this study was to evaluate the role of MANF in cholangiocarcinoma, investigating the possibility of whether sorafenib could become a reliable strategy for cholangiocarcinoma therapy. Methods In this study, the expression level of MANF in ICC patients was investigated by bioinformatic analysis and the results were verified by tissue microarray assay. Cholangiocarcinoma cell lines were also used to determine how MANF regulates the therapeutic effect of sorafenib and to identify the underlying mechanisms. Results The results showed that MANF was correlated with poor prognosis and MANF knockdown could facilitate sorafenib-mediated apoptosis and increase the sensitivity of sorafenib treatment by activating excessive ER stress. Conclusion MANF is a prognostic marker of cholangiocarcinoma. MANF knockdown increases sorafenib-mediated ER stress and apoptosis in the cholangiocarcinoma cell lines. This mechanism may lead to a new therapeutic strategy in cholangiocarcinoma.
Collapse
Affiliation(s)
- Jingyi He
- Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, China.,Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong 250021, China
| | - Guangbing Li
- Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, China.,Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong 250021, China
| | - Xihan Liu
- Qilu Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, China
| | - Liye Ma
- Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, China.,Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong 250021, China
| | - Jiayao Zhang
- Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, China.,Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong 250021, China
| | - Shunzhen Zheng
- Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, China.,Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong 250021, China
| | - Jianping Wang
- Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, China.,Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong 250021, China
| | - Jun Liu
- Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, China.,Department of Hepatobiliary Surgery and Center of Organ Transplantation, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong 250021, China
| |
Collapse
|
|
45
|
Wen W, Wang Y, Li H, Xu H, Xu M, Frank JA, Ma M, Luo J. Mesencephalic Astrocyte-Derived Neurotrophic Factor (MANF) Regulates Neurite Outgrowth Through the Activation of Akt/mTOR and Erk/mTOR Signaling Pathways. Front Mol Neurosci 2020; 13:560020. [PMID: 33071755 PMCID: PMC7541815 DOI: 10.3389/fnmol.2020.560020] [Citation(s) in RCA: 8] [Impact Index Per Article: 1.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/07/2020] [Accepted: 09/04/2020] [Indexed: 12/13/2022] Open
Abstract
Neurite outgrowth is essential for brain development and the recovery of brain injury and neurodegenerative diseases. In this study, we examined the role of the neurotrophic factor MANF in regulating neurite outgrowth. We generated MANF knockout (KO) neuro2a (N2a) cell lines using clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 and demonstrated that MANF KO N2a cells failed to grow neurites in response to RA stimulation. Using MANF siRNA, this finding was confirmed in human SH-SY5Y neuronal cell line. Nevertheless, MANF overexpression by adenovirus transduction or addition of MANF into culture media facilitated the growth of longer neurites in RA-treated N2a cells. MANF deficiency resulted in inhibition of Akt, Erk, mTOR, and P70S6, and impaired protein synthesis. MANF overexpression on the other hand facilitated the growth of longer neurites by activating Akt, Erk, mTOR, and P70S6. Pharmacological blockade of Akt, Erk or mTOR eliminated the promoting effect of MANF on neurite outgrowth. These findings suggest that MANF positively regulated neurite outgrowth by activating Akt/mTOR and Erk/mTOR signaling pathways.
Collapse
Affiliation(s)
- Wen Wen
- Department of Pathology, University of Iowa, Iowa City, IA, United States
| | - Yongchao Wang
- Department of Pharmacology and Nutritional Sciences, University of Kentucky College of Medicine, Lexington, KY, United States
| | - Hui Li
- Department of Pathology, University of Iowa, Iowa City, IA, United States
| | - Hong Xu
- Department of Pharmacology and Nutritional Sciences, University of Kentucky College of Medicine, Lexington, KY, United States
| | - Mei Xu
- Department of Pharmacology and Nutritional Sciences, University of Kentucky College of Medicine, Lexington, KY, United States
| | - Jacqueline A Frank
- Department of Neurology, University of Kentucky College of Medicine, Lexington, KY, United States
| | - Murong Ma
- Department of Pharmacology and Nutritional Sciences, University of Kentucky College of Medicine, Lexington, KY, United States
| | - Jia Luo
- Department of Pathology, University of Iowa, Iowa City, IA, United States
| |
Collapse
|
|
46
|
Jӓntti M, Harvey BK. Trophic activities of endoplasmic reticulum proteins CDNF and MANF. Cell Tissue Res 2020; 382:83-100. [PMID: 32845431 DOI: 10.1007/s00441-020-03263-0] [Citation(s) in RCA: 35] [Impact Index Per Article: 7.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/10/2020] [Accepted: 07/20/2020] [Indexed: 12/13/2022]
Abstract
Mesencephalic astrocyte-derived neurotrophic factor (MANF) and cerebral dopamine neurotrophic factor (CDNF) are endoplasmic reticulum (ER) luminal proteins that confer trophic activities in a wide range of tissues under diverse pathological conditions. Despite initially being classified as neurotrophic factors, neither protein structurally nor functionally resembles bona fide neurotrophic factors. Their highly homologous structures comprise a unique globular, saposin-like domain within the N-terminus joined by a flexible linker to a C-terminus containing a SAP-like domain, CXXC motif and an ER retention sequence. Neurotrophic factors exert effects by binding to cognate receptors in the plasma membrane; however, no cell surface receptors have been identified for MANF and CDNF. Both can act as unfolded protein response (UPR) genes that modulate the UPR and inflammatory processes. The trophic activity of MANF and CDNF extends beyond the central nervous system with MANF being crucial for the development of pancreatic β cells and both have trophic effects in a variety of diseases related to the liver, heart, skeletal tissue, kidney and peripheral nervous system. In this article, the unique features of MANF and CDNF, such as their structure and mechanisms of action related to ER stress and inflammation, will be reviewed. Recently identified interactions with lipids and membrane trafficking will also be described. Lastly, their function and therapeutic potential in different diseases including a recent clinical trial using CDNF to treat Parkinson's disease will be discussed. Collectively, this review will highlight MANF and CDNF as broad-acting trophic factors that regulate functions of the endoplasmic reticulum.
Collapse
Affiliation(s)
- Maria Jӓntti
- Molecular Mechanisms of Cellular Stress and Inflammation Lab, Intramural Research Program, National Institute on Drug Abuse, Suite 200, 251 Bayview Blvd, Baltimore, MD, 21224, USA
| | - Brandon K Harvey
- Molecular Mechanisms of Cellular Stress and Inflammation Lab, Intramural Research Program, National Institute on Drug Abuse, Suite 200, 251 Bayview Blvd, Baltimore, MD, 21224, USA.
| |
Collapse
|
|
47
|
Yang F, Li WB, Qu YW, Gao JX, Tang YS, Wang DJ, Pan YJ. Bone marrow mesenchymal stem cells induce M2 microglia polarization through PDGF-AA/MANF signaling. World J Stem Cells 2020; 12:633-658. [PMID: 32843919 PMCID: PMC7415242 DOI: 10.4252/wjsc.v12.i7.633] [Citation(s) in RCA: 38] [Impact Index Per Article: 7.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 01/20/2020] [Revised: 04/04/2020] [Accepted: 05/17/2020] [Indexed: 02/06/2023] Open
Abstract
BACKGROUND Bone marrow mesenchymal stem cells (BMSCs) are capable of shifting the microglia/macrophages phenotype from M1 to M2, contributing to BMSCs-induced brain repair. However, the regulatory mechanism of BMSCs on microglia/macrophages after ischemic stroke is unclear. Recent evidence suggests that mesencephalic astrocyte–derived neurotrophic factor (MANF) and platelet-derived growth factor-AA (PDGF-AA)/MANF signaling regulate M1/M2 macrophage polarization.
AIM To investigate whether and how MANF or PDGF-AA/MANF signaling influences BMSCs-mediated M2 polarization.
METHODS We identified the secretion of MANF by BMSCs and developed transgenic BMSCs using a targeting small interfering RNA for knockdown of MANF expression. Using a rat middle cerebral artery occlusion (MCAO) model transplanted by BMSCs and BMSCs–microglia Transwell coculture system, the effect of BMSCs-induced downregulation of MANF expression on the phenotype of microglia/macrophages was tested by Western blot, quantitative reverse transcription-polymerase chain reaction, and immunofluorescence. Additionally, microglia were transfected with mimics of miR-30a*, which influenced expression of X-box binding protein (XBP) 1, a key transcription factor that synergized with activating transcription factor 6 (ATF6) to govern MANF expression. We examined the levels of miR-30a*, ATF6, XBP1, and MANF after PDGF-AA treatment in the activated microglia.
RESULTS Inhibition of MANF attenuated BMSCs-induced functional recovery and decreased M2 marker production, but increased M1 marker expression in vivo or in vitro. Furthermore, PDGF-AA treatment decreased miR-30a* expression, had no influence on the levels of ATF6, but enhanced expression of both XBP1 and MANF.
CONCLUSION BMSCs-mediated MANF paracrine signaling, in particular the PDGF-AA/miR-30a*/XBP1/MANF pathway, synergistically mediates BMSCs-induced M2 polarization.
Collapse
Affiliation(s)
- Fan Yang
- Department of Neurology, The First Clinical College of Harbin Medical University, Harbin 150001, Heilongjiang Province, China
| | - Wen-Bin Li
- Department of Neurology, The First Clinical College of Harbin Medical University, Harbin 150001, Heilongjiang Province, China
| | - Ye-Wei Qu
- Department of Neurology, The First Clinical College of Harbin Medical University, Harbin 150001, Heilongjiang Province, China
| | - Jin-Xing Gao
- Department of Neurology, The First Clinical College of Harbin Medical University, Harbin 150001, Heilongjiang Province, China
| | - Yu-Shi Tang
- Department of Neurology, The First Clinical College of Harbin Medical University, Harbin 150001, Heilongjiang Province, China
| | - Dong-Jie Wang
- Department of Respiratory Medicine, The First Clinical College of Harbin Medical University, Harbin 150001, Heilongjiang Province, China
| | - Yu-Jun Pan
- Department of Neurology, The First Clinical College of Harbin Medical University, Harbin 150001, Heilongjiang Province, China
| |
Collapse
|
|
48
|
Tousson-Abouelazm N, Papillon J, Guillemette J, Cybulsky AV. Urinary ERdj3 and mesencephalic astrocyte-derived neutrophic factor identify endoplasmic reticulum stress in glomerular disease. J Transl Med 2020; 100:945-958. [PMID: 32203149 DOI: 10.1038/s41374-020-0416-5] [Citation(s) in RCA: 22] [Impact Index Per Article: 4.4] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/13/2019] [Revised: 03/03/2020] [Accepted: 03/03/2020] [Indexed: 11/09/2022] Open
Abstract
Podocyte injury and endoplasmic reticulum (ER) stress have been implicated in the pathogenesis of various glomerular diseases. ERdj3 (DNAJB11) and mesencephalic astrocyte-derived neurotrophic factor (MANF) are ER chaperones lacking the KDEL motif, and may be secreted extracellularly. Since podocytes reside in the urinary space, we examined if podocyte injury is associated with secretion of KDEL-free ER chaperones from these cells into the urine, and if chaperones in the urine reflect ER stress in glomerulonephritis. In cultured podocytes, ER stress increased ERdj3 and MANF intracellularly and in culture medium, whereas GRP94 (KDEL chaperone) increased only intracellularly. ERdj3 and MANF secretion was blocked by the secretory trafficking inhibitor, brefeldin A. Urinary ERdj3 and MANF increased in rats injected with tunicamycin (in the absence of proteinuria). After induction of passive Heymann nephritis (PHN) and puromycin aminonucleoside nephrosis (PAN), there was an increase in glomerular ER stress, and appearance of ERdj3 and MANF in the urine, coinciding with the onset of proteinuria. Rats with PHN were treated with the chemical chaperone, 4-phenyl butyrate (PBA), starting at the time of disease induction, or after disease was established. In both protocols, 4-PBA reduced proteinuria and urinary ER chaperone secretion, compared with PHN rats treated with saline (control). In conclusion, urinary ERdj3 and MANF reflect glomerular ER stress. 4-PBA protected against complement-mediated podocyte injury and the therapeutic response could be monitored by urinary ERdj3 and MANF.
Collapse
Affiliation(s)
- Nihad Tousson-Abouelazm
- Department of Medicine, McGill University Health Centre Research Institute, McGill University, Montreal, QC, Canada.,Department of Clinical Pharmacology, Faculty of Medicine, Alexandria University, Alexandria, Egypt
| | - Joan Papillon
- Department of Medicine, McGill University Health Centre Research Institute, McGill University, Montreal, QC, Canada
| | - Julie Guillemette
- Department of Medicine, McGill University Health Centre Research Institute, McGill University, Montreal, QC, Canada
| | - Andrey V Cybulsky
- Department of Medicine, McGill University Health Centre Research Institute, McGill University, Montreal, QC, Canada.
| |
Collapse
|
|
49
|
Diagnostic and Prognostic Values of MANF Expression in Hepatocellular Carcinoma. BIOMED RESEARCH INTERNATIONAL 2020; 2020:1936385. [PMID: 32382531 PMCID: PMC7193290 DOI: 10.1155/2020/1936385] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.4] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 10/29/2019] [Revised: 03/15/2020] [Accepted: 03/24/2020] [Indexed: 02/07/2023]
Abstract
Hepatocellular carcinoma (HCC) is one of the most common malignant tumors, and its prognosis is still poor. Mesencephalic astrocyte-derived neurotrophic factor (MANF) plays a key role in endoplasmic reticulum stress. ER stress plays a key role in HCC carcinogenesis. To confirm the clinical and prognostic value of MANF in HCC, we investigated the expression level of MANF in HCC as recorded in databases, and the results were verified by experiment. Survival analysis was probed by the Kaplan–Meier method. Cox regression models were used to ascertain the prognostic value of MANF in HCC tissue microarray. The diagnostic value of MANF in HCC was evaluated by receiver operating characteristic curve analysis. Potential correlation between MANF and selected genes was also analyzed. Results showed that MANF was overexpressed in HCC. Patients with high MANF expression levels had a worse prognosis and higher risk of tumor recurrence. Furthermore, the expression level of MANF had good diagnostic power. Correlation analysis revealed potential regulatory networks of MANF in HCC, laying a foundation for further study of the role of MANF in tumorigenesis. In conclusion, MANF was overexpressed in HCC and related to the occurrence and development of HCC. It is a potential diagnostic and prognostic indicator of HCC.
Collapse
|
|
50
|
Fu J, Nchambi KM, Wu H, Luo X, An X, Liu D. Liraglutide protects pancreatic β cells from endoplasmic reticulum stress by upregulating MANF to promote autophagy turnover. Life Sci 2020; 252:117648. [PMID: 32275937 DOI: 10.1016/j.lfs.2020.117648] [Citation(s) in RCA: 14] [Impact Index Per Article: 2.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/09/2020] [Revised: 03/31/2020] [Accepted: 04/05/2020] [Indexed: 11/30/2022]
Abstract
AIMS This study was conducted to determine the relationship between mesencephalic astrocyte-derived neurotrophic factor (MANF), autophagy and endoplasmic reticulum (ER) stress, and whether liraglutide (LRG) can protect β cells, promote autophagy and alleviate ER stress by regulating MANF expression. MAIN METHODS Human serum samples were collected from healthy controls (NC), simple hyperlipidemia (HLD), and newly diagnosed type 2 diabetes (T2D). The MANF levels were detected using ELISA. In vitro, after the mouse islet MIN6 cells were treated with glucose (GLU), palmitate (PA), thapsigargin (TG), LRG, and chloroquine (CQ), cell proliferation was detected using cell counting kit-8 (CCK-8), apoptosis-related protein cleaved caspase 3 (C-cas-3), ER stress, and autophagy-related proteins were detected by Western blotting, MANF, insulin, and C-cas-3 proteins were detected via immunofluorescence. Subcellular structures and autophagosomes were examined using electron microscopy. KEY FINDINGS Compared with the NC group, the MANF levels in the HLD and T2D groups increased significantly. After ER stress induced by GLU, PA, and TG, cell viability decreased, while MANF, c-cas3, ERS, and autophagy-related proteins increased, which was related to the concentration of GLU, PA, and TG. Compared with the BSA group, the number of mitochondria and autophagosomes in the PA group increased and the mitochondria were damaged. In the PA and TG plus CQ groups, the effect was further exaggerated. But after co-treatment with LRG, the effects of GLU, PA, and TG were attenuated. SIGNIFICANCE LRG protects islet β cells from ER stress by upregulating MANF to promote autophagy turnover.
Collapse
Affiliation(s)
- Jili Fu
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, Chongqing 400010, China
| | - Kija Malale Nchambi
- Department of Gastroenterology, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, Chongqing 400010, China
| | - Hao Wu
- Department of Hepatobiliary surgery, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, Chongqing 400010, China
| | - Xie Luo
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, Chongqing 400010, China
| | - Xizhou An
- Department of Hematology, The Children Hospital of Chongqing Medical University, Yuzhong District, Chongqing 400014, China
| | - Dongfang Liu
- Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Chongqing Medical University, 76, Linjiang Road, Yuzhong District, Chongqing 400010, China.
| |
Collapse
|