Heart failure (HF) is a leading cause of mortality among patients with cardiovascular disease and is often associated with myocardial apoptosis and endoplasmic reticulum stress (ERS). While hydrogen has demonstrated potential in reducing oxidative stress and ERS, recent evidence suggests that magnesium may aid in hydrogen release within the body, further enhancing these protective effects. This study aimed to investigate the cardioprotective effects of magnesium in reducing apoptosis and ERS through hydrogen release in a rat model of isoproterenol (ISO)-induced HF. Magnesium was administered orally to ISO-induced HF rats, which improved cardiac function, reduced myocardial fibrosis and cardiac hypertrophy, and lowered the plasma levels of creatine kinase-MB, cardiac troponin-I, and N-terminal B-type natriuretic peptide precursor in ISO-induced HF rats. It also inhibited cardiomyocyte apoptosis by upregulating B-cell lymphoma-2, downregulating Bcl-2-associated X protein, and suppressing ERS markers (glucose-related protein 78, activating transcription factor 4, and C/EBP-homologous protein). Magnesium also elevated hydrogen levels in blood, plasma, and cardiac tissue, as well as in artificial gastric juice and pure water, where hydrogen release lasted for at least four hours. Additionally, complementary in vitro experiments were conducted using H9C2 cardiomyocyte injury models, with hydrogen-rich culture medium as the intervention. Hydrogen-rich culture medium improved the survival and proliferation of ISO-treated H9C2 cells, reduced the cell surface area, inhibited apoptosis, and downregulated ERS pathway proteins. However, the protective effects of hydrogen were negated by tunicamycin (an inducer of ERS) in H9C2 cells. In conclusion, magnesium exerts significant cardioprotection by mitigating ERS and apoptosis through hydrogen release effects in ISO-induced HF.

Exogenous or endogenous factors such as hypoxia, nutritional deficiencies, acidic microenvironments and their own high metabolic demands usually lead to tumor endoplasmic reticulum dysfunction and trigger endoplasmic reticulum stress (ERS). ERS sensors intercept such stress signals, which subsequently initiate the unfolded protein response (UPR), enabling tumor cells to adapt robustly in the hostile environment. Many studies have found that the ERS response affects a variety of tumor-infiltrating immune cells and suppresses their anti-tumor responses through different mechanisms. Given that glioblastoma (GBM) are immunosuppressive "cold tumors" with a poor prognosis. This paper not only discusses the promotion of GBM growth by ERS response, but also reviews the mechanisms by which ERS response promotes an immunosuppressive microenvironment.

In nature, many animals respond to cold by entering hibernation, while in clinical settings, controlled cooling is used in transplantation and emergency medicine. However, the molecular mechanisms that enable cells to survive severe cold are still not fully understood. One key aspect of cold adaptation is the global downregulation of protein synthesis. Studying it in the nematode Caenorhabditis elegans, we find that the translation of most mRNAs continues in the cold, albeit at a slower rate, and propose that cold-specific gene expression is regulated primarily at the transcription level. Supporting this idea, we found that the transcription of certain cold-induced genes is linked to the activation of unfolded protein response (UPR) through the conserved IRE-1/XBP-1 signaling pathway. Our findings suggest that this pathway is triggered by cold-induced perturbations in proteins and lipids within the endoplasmic reticulum, and that its activation is beneficial for cold survival.

Lithium, which is widely used in medicine and batteries, has become increasingly prevalent in the environment, raising concerns about its impact on human health. Lithium carbonate (Li2CO3) is a common treatment and relapse prevention method for bipolar disorder. It can freely cross the placental barrier; however, lithium treatment is accompanied by side effects, particularly in women of reproductive age. Among these, neural tube defects (NTDs) have the most severe impact on nervous system development; however, their underlying mechanisms remain unclear. This study explored the potential mechanisms by which Li2CO3 exposure contributes to NTDs. Pregnant mice were intraperitoneally injected with Li2CO3 (360 mg/kg), which mimicked high-exposure scenarios such as an unintended pregnancy during lithium therapy or exposure to industrial contamination. Embryos were assessed for morphological changes, primary cilia length, and endoplasmic reticulum (ER) homeostasis using histological analysis, scanning electron microscopy, PCR array analysis, immunofluorescence, and quantitative real-time PCR. Network and bioinformatics analyses were used to identify primary molecular targets and pathways. We also evaluated the effects of inositol supplementation on cilia during Li2CO3 exposure. The results revealed that treatment with Li2CO3 at 360 mg/kg induced exencephaly in some embryos, reduced primary cilia length, and dysregulated cilia-associated gene expression in the neural tube. PCR Array, network metabolism, and immunofluorescence analyses revealed that HSP90AB1, a critical regulator of ER homeostasis, was upregulated in Li2CO3-treated embryos with NTDs. Li2CO3 exposure disturbed ER homeostasis in the developing brain. Interestingly, inositol supplementation partially rescued ciliogenesis impairment in lithium-treated NIH3T3 cells. Li2CO3 exposure disrupted primary ciliary development and ER homeostasis in the embryonic neural tube. Maintaining adequate maternal inositol levels during Li2CO3 exposure before and during pregnancy prevents NTDs. These findings help in better understanding and reassessing the risks associated with lithium, especially in terms of maternal and fetal health.

The endoplasmic reticulum (ER) stress sensor inositol-requiring enzyme 1α (IRE1α) is associated with lung infections where innate immune cells are drivers for progression and resolution ammatory cytokinesflammation. Yet, the role of IRE1α in pulmonary innate immune host defense during acute respiratory infection remains unexplored. Here, we found that activation of IRE1α in infected lungs compromises immunity against methicillin-resistant Staphylococcus aureus (MRSA)-induced primary and secondary pneumonia. Moreover, activation of IRE1α in MRSA-infected lungs and alveolar macrophages (AMs) leads to exacerbated production of inflammatory mediators followed by cell death. Ablation of myeloid IRE1α or global IRE1α inhibition confers protection against MRSA-induced pneumonia with improved survival, bacterial clearance, cytokine reduction, and lung injury. In addition, loss of myeloid IRE1α protects mice against MRSA-induced secondary to influenza pneumonia by promoting AM survival. Thus, activation of IRE1α is detrimental to pneumonia, and therefore, it shows potential as a target to control excessive unresolved lung inflammation.

The endoplasmic reticulum (ER) is a large organelle, found in all eukaryotes, that is essential for normal cellular function. This function encompasses protein folding and quality control, post-translational modifications, lipid regulation, and the storage of intracellular calcium, among others. These diverse processes are essential for maintaining proteome stability. Therefore, a robust surveillance system is established under stress to ensure cell homeostasis. Sources of stress can originate from the cellular environment, including nutrient deprivation, hypoxia, and low pH, as well as from endogenous signals within the cell, such as metabolic challenges and increased demands for protein production. When cellular homeostasis is altered by one of these triggers, ER primary functions are altered which leads to the accumulation of misfolded proteins. These impaired proteins trigger the activation of the Unfolded Protein Response (UPR) pathway. This response aims at reducing ER stress by implementing the induction of complex programs to restore cell homeostasis. However, extended ER stress can modify the UPR response, shifting its signals from promoting survival to triggering pathways that reprogram or eliminate affected cells.

Pathogenic fungal infections cause significant morbidity and mortality, particularly in immunocompromised patients. The frequent emergence of multidrug-resistant strains challenges existing antifungal therapies, driving the need to investigate novel antifungal agents that target new molecular moieties. Pathogenic fungi are subjected to various environmental stressors, including pH, temperature, and pharmacological agents, both in natural habitats and the host body. These stressors elevate the risk of misfolded or unfolded protein production within the endoplasmic reticulum (ER) which, if not promptly mitigated, can lead to the accumulation of these proteins in the ER lumen. This accumulation triggers an ER stress response, potentially jeopardizing fungal survival. The unfolded protein response (UPR) is a critical cellular defense mechanism activated by ER stress to restore the homeostasis of protein folding. In recent years, the regulatory role of the UPR in pathogenic fungi has garnered significant attention, particularly for its involvement in fungal adaptation, regulation of virulence, and drug resistance. In this review, we comparatively analyze the UPRs of fungi and mammals and examine the potential utility of the UPR as a molecular antifungal target in pathogenic fungi. By clarifying the specificity and regulatory functions of the UPR in pathogenic fungi, we highlight new avenues for identifying potential therapeutic targets for antifungal treatments.

Cystic fibrosis (CF) is a genetic disease due to mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The most frequent mutation (p.Phe508del) results in a misfolded protein (p.Phe508del-CFTR) with an altered transport to the membrane of the cells via the conventional protein secretion (CPS) pathway. Nevertheless, it can use unconventional protein secretion (UPS). Indeed, p.Phe508del-CFTR forms a complex with GRASP55 to assist its direct trafficking from the endoplasmic reticulum to the plasma membrane. While GRASP55 is a key player of UPS, it is also a key player of stress-induced autophagy. In parallel, the unfolded protein response (UPR), which is activated in the presence of misfolded proteins, is tightly linked to UPS and autophagy through the key effectors IRE1, PERK, and ATF6. A better understanding of how UPS, UPR, and stress-induced autophagy interact to manage protein trafficking in CF and other conditions could lead to novel therapeutic strategies. By enhancing or modulating these pathways, it may be possible to increase p.Phe508del-CFTR surface expression. In summary, this review highlights the critical roles of UPS- and UPR-induced autophagy in managing protein transport, offering new perspectives for therapeutic approaches.

The endoplasmic reticulum (ER) is an essential sensing organelle responsible for the folding and secretion of almost one-third of eukaryotic cells' total proteins. However, environmental, chemical, and genetic insults often lead to protein misfolding in the ER, accumulating misfolded proteins, and causing ER stress. To solve this, several mechanisms were reported to relieve ER stress by decreasing the ER protein load. Recently, we reported a novel ER surveillance mechanism by which proteins from the secretory pathway are refluxed to the cytosol to relieve the ER of its content. The refluxed proteins gain new prosurvival functions in cancer cells, thereby increasing cancer cell fitness. We termed this phenomenon ER to CYtosol Signaling (or 'ERCYS'). Here, we found that in mammalian cells, ERCYS is regulated by DNAJB12, DNAJB14, and the HSC70 cochaperone SGTA. Mechanistically, DNAJB12 and DNAJB14 bind HSC70 and SGTA - through their cytosolically localized J-domains to facilitate ER-protein reflux. DNAJB12 is necessary and sufficient to drive this phenomenon to increase AGR2 reflux and inhibit wt-p53 during ER stress. Mutations in DNAJB12/14 J-domain prevent the inhibitory interaction between AGR2-wt-p53. Thus, targeting the DNAJB12/14-HSC70/SGTA axis is a promising strategy to inhibit ERCYS and impair cancer cell fitness.

Most available evidence points to a proviral role for endoplasmic reticulum (ER) stress, as many viruses exploit it to promote viral replication. In contrast, few studies have linked ER stress to the antiviral immune response, and even fewer to the vaccine-induced immune response. In this work, we demonstrated that ER stress is a key molecular link in the immune response of teleost erythrocytes or red blood cells (RBCs) under vaccine stimulation. Moreover, the unfolded protein response (UPRER) triggered by ER stress may work together with autophagy and related cellular mechanisms as part of a coordinated immune response in RBCs. We unveiled biochemical changes in the lipid-protein profile of vaccine-treated RBCs by synchrotron radiation-based Fourier transform infrared microspectroscopy (SR-µFTIR) associated with the modulation of ER expansion, increased mitochondrial number, and vesicular structures detected by soft X-ray cryotomography (cryo-SXT). We found a positive correlation between both morphological and biochemical changes and the expression of genes related to UPRER, autophagy, mitochondrial stress, vesicle trafficking, and extracellular vesicle release. These processes in RBCs are ideal cellular targets for the development of more specific prophylactic tools with greater immunogenic capacity than currently available options.

Parkinson's disease (PD), a prevalent neurodegenerative disorder, demonstrates the critical involvement of endoplasmic reticulum stress (ERS) in its pathogenesis. This review comprehensively examines the role and molecular mechanisms of ERS in PD. ERS represents a cellular stress response triggered by imbalances in endoplasmic reticulum (ER) homeostasis, induced by factors such as hypoxia and misfolded protein aggregation, which activate the unfolded protein response (UPR) through the inositol-requiring enzyme 1 (IRE1), protein kinase R-like endoplasmic reticulum kinase (PERK), and activating transcription factor 6 (ATF6) pathways. Clinical, animal model, and cellular studies have consistently demonstrated a strong association between PD and ERS. Abnormal expression of ERS-related molecules in PD patients' brains and cerebrospinal fluid (CSF) correlates with disease progression. In animal models (e.g., Drosophila and mice), ERS inhibition alleviates dopaminergic neuronal damage. Cellular experiments reveal that PD-mimicking pathological conditions induce ERS, while interactions between ERS and mitochondrial dysfunction promote neuronal apoptosis. Mechanistically, (1) pathological aggregation of α-synuclein (α-syn) and ERS mutually reinforce dopaminergic neuron damage; (2) leucine-rich repeat kinase 2 (LRRK2) gene mutations induce ERS through thrombospondin-1 (THBS1)/transforming growth factor beta 1 (TGF-β1) interactions; (3) molecules such as Parkin and PTEN-induced kinase 1 (PINK1) regulate ERS in PD. Furthermore, ERS interacts with mitochondrial dysfunction, oxidative stress, and neuroinflammation to exacerbate neuronal injury. Emerging therapeutic strategies show significant potential, including artificial intelligence (AI)-assisted drug design targeting ERS pathways and precision medicine approaches exploring non-pharmacological interventions such as personalized electroacupuncture. Future research should focus on elucidating ERS-related mechanisms and identifying novel therapeutic targets to develop more effective treatments for PD patients, ultimately improving their quality of life.

The present study explores the x-box binding protein 1 (xbp1) gene in Haliotis discus hannai (Pacific abalone), focusing on its structure, expression, and functional role under heat stress. Southern blot revealed two copies of xbp1 in the intestine and mantle, one in the gill and muscle, and no detection in the digestive gland. mRNA expression level of xbp1 was highest in the gill, followed by the mantle, intestine, and muscle, with the digestive gland showing the lowest expression. Actinomycin D treatment demonstrated that xbp1 mRNA stability varied among tissues, with slower degradation in the gill and mantle, while rapid degradation was observed in the digestive gland. Heat stress caused a 20 bp fragment removal from xbp1 mRNA, producing spliced xbp1 (xbp1s), with a conserved inositol-requiring enzyme 1α (IRE1α) cleavage motif (5'- CAGCACCUGCUGAUCCUCUG -3'). Genome walking was used to obtain the promoter sequences of downstream genes regulated by xbp1s. Through sequence conservation analysis, the binding sites of xbp1s on these promoters were identified in Pacific abalone. Yeast one-hybrid (Y1H) assays confirmed xbp1s binding to these sites, and morpholino oligonucleotides (MO) treatment effectively suppressed xbp1s production. Western blot analysis demonstrated that heat stress induced the expression of HDEL-related proteins, while MO injection significantly reduced their expression under both basal and heat stress conditions. Immunofluorescence analysis revealed decreased endoplasmic reticulum (ER) chaperone glucose-regulated protein 78 (GRP78) levels and increased apoptosis in MO-treated abalone under heat stress, suggesting a compromised ER stress response. These findings underscore XBP1's crucial role in regulating ER stress management and apoptotic processes, providing new insights into the functional significance of xbp1 in abalone's response to thermal stress.

Aims: Thyroid hormones (TH) are major regulators of cell differentiation, growth, and metabolic rate. TH synthesis in the thyroid gland requires high amounts of H2O2 to oxidize iodide for the iodination of thyroglobulin (TG). Retinol Saturase (RetSat) is an oxidoreductase implicated in dihydroretinol formation and cellular sensitivity toward peroxides and ferroptosis. RetSat is highly expressed in metabolically active organs where it regulates lipid metabolism and the production of reactive oxygen species. Due to the high expression of RetSat in the thyroid gland and its role in peroxide sensitivity, we investigated the regulation and function of RetSat in the thyroid gland in appropriate mouse models. Results: RetSat is strongly expressed in thyrocytes, induced by hypothyroidism, and decreased by iodide overload in mice. Thyrocyte-specific deletion of RetSat increased circulating thyroid-stimulating hormone levels, altered thyroid morphology, and disturbed metabolic homeostasis in a diet- and sex-dependent manner without major effects on the concentrations of circulating TH. Moreover, deletion of RetSat increased TG protein levels but lowered TG iodination upon iodide overload. In cultured thyrocytes, acute RetSat depletion altered the expression of genes involved in TH biosynthesis and the response to endoplasmic reticulum stress. Innovation: This is the first report that specifically dissects the regulation and function of the oxidoreductase RetSat in the thyroid gland. Conclusion: Deletion of RetSat in thyrocytes induces compensatory feedback mechanisms to maintain TH homeostasis in mice. We conclude that RetSat in the thyroid gland is required for TH biosynthesis and secretion and metabolic homeostasis in mice. Antioxid. Redox Signal. 42, 463-479.

Ovarian cancer (OvCa) is a prevalent gynecological malignancy with an increasing incidence and high mortality rate. Although the role of the herpesvirus entry mediator (HVEM), encoded by the TNFRSF14 gene, is currently considered pivotal in various types of cancer, the regulation of tumor cell-expressed HVEM in OvCa remains inadequately understood.

Specimens were used to detect HVEM expression via quantitative RT-PCR and flow cytometry. The proliferation of the murine OvCa cell line ID8 was determined using the Cell Counting Kit-8, colony formation, and EdU staining assays. The immune constituents within the ascites fluid and spleen of tumor-bearing mice were analyzed by flow cytometry. Bioinformatics analysis was performed to explore cytokines, chemokines, and signaling pathways regulated by HVEM, and differential expression levels were confirmed via quantitative RT-PCR and western blot analysis.

Herein, we identified a significant upregulation of HVEM in OvCa tissues compared with that in benign tissues and observed dominant expression of HVEM in CD45⁻EpCAM⁺ subsets in OvCa specimens. Tumor cell-expressed HVEM was found to promote OvCa cell proliferation by partly activating spliced X-box-binding protein 1 (XBP1s)-c-Myc signaling. In mouse models, knockdown of Tnfrsf14 in ID8 cells alleviated OvCa progression and specifically affected the frequency and function of T cells in the ascites fluid and spleen. In addition, tumor cell-expressed HVEM altered chemokine expression (CXCL1/9/10/11 and CCL2/4/5) and STAT signal activation (STAT5 and STAT6) in ID8 cells.

This study investigated the effects of HVEM on OvCa and validated its potential as a therapeutic marker for treating OvCa.

Skin wound healing is a dynamic process consisting of multiple cellular and molecular events that must be tightly coordinated to repair the injured tissue efficiently. The healing pace is decided by the type of injuries, the depth and size of the wounds, and whether wound infections occur. However, aging, comorbidities, genetic factors, hormones, and nutrition also impact healing outcomes. During wound healing, cells undergo robust processes of synthesizing new proteins and degrading multifunctional proteins. This imposes an increasing burden on the endoplasmic reticulum (ER), causing ER stress. Unfolded protein response (UPR) represents a collection of highly conserved stress signaling pathways originated from the ER to maintain protein homeostasis and modulate cell physiology. UPR is known to be beneficial for tissue healing. However, when excessive ER stress exceeds ER's folding potential, UPR pathways trigger cell apoptosis, interrupting tissue regeneration. Understanding how UPR pathways modulate the skin's response to injuries is critical for new interventions toward the control of acute and chronic wounds. Herein, in this review, we focus on the participation of the canonical and noncanonical UPR pathways during different stages of wound healing, summarize the available evidence demonstrating UPR's unique position in balancing homeostasis and pathophysiology of healing tissues, and highlight the understudied areas where therapeutic opportunities may arise.

[Figure: see text].

The endoplasmic reticulum (ER) is an important organelle that controls the intracellular and extracellular environments. The ER is responsible for folding almost one-third of the total protein population in the eukaryotic cell. Disruption of ER-protein folding is associated with numerous human diseases, including metabolic disorders, neurodegenerative diseases, and cancer. During ER perturbations, the cells deploy various mechanisms to increase the ER-folding capacity and reduce ER-protein load by minimizing the number of substrates entering the ER to regain homeostasis. These mechanisms include signaling pathways, degradation mechanisms, and other processes that mediate the reflux of ER content to the cytosol. In this review, we will discuss the recent discoveries of five different ER quality control mechanisms, including the unfolded protein response (UPR), ER-associated-degradation (ERAD), pre-emptive quality control, ER-phagy and ER to cytosol signaling (ERCYS). We will discuss the roles of these processes in decreasing ER-protein load and inter-mechanism crosstalk.

Cells rely on the endoplasmic reticulum (ER) to fold and assemble newly synthesized transmembrane and secretory proteins - essential for cellular structure-function and for both intracellular and intercellular communication. To ensure the operative fidelity of the ER, eukaryotic cells leverage the unfolded protein response (UPR) - a stress-sensing and signalling network that maintains homeostasis by rebalancing the biosynthetic capacity of the ER according to need. The metazoan UPR can also redirect signalling from cytoprotective adaptation to programmed cell death if homeostasis restoration fails. As such, the UPR benefits multicellular organisms by preserving optimally functioning cells while removing damaged ones. Nevertheless, dysregulation of the UPR can be harmful. In this Review, we discuss the UPR and its regulatory processes as a paradigm in health and disease. We highlight important recent advances in molecular and mechanistic understanding of the UPR that enable greater precision in designing and developing innovative strategies to harness its potential for therapeutic gain. We underscore the rheostatic character of the UPR, its contextual nature and critical open questions for its further elucidation.

The loss of insulin secretory function associated with type 1 diabetes (T1D) is attributed to the immune-mediated destruction of beta cells. Yet, at onset of T1D, patients often have a significant beta cell mass remaining while T cell infiltration of pancreatic islets is sporadic. Thus, we investigated the hypothesis that the remaining beta cells in T1D are largely dysfunctional using live human pancreas tissue slices prepared from organ donors with recently diagnosed T1D. Beta cells in slices from donors with T1D had significantly diminished Ca2+ mobilization and insulin secretion responses to glucose. Beta cell function was equally impaired in T cell-infiltrated and non-infiltrated islets. Fixed tissue staining and gene expression profiling of laser-capture microdissected islets revealed significant decreases of proteins and genes in the glucose stimulus secretion coupling pathway. From these data, we posit that functional defects occur in the remaining mass of beta cells during human T1D pathogenesis.

The endoplasmic reticulum (ER) stress response controls the balance between cellular survival and death. Here, we implicate SCOTIN, an interferon-inducible ER protein, in activating the ER stress response and modulating cell fate through its proline-rich domain (PRD)-mediated cytosolic condensation. SCOTIN overexpression leads to the formation of condensates enveloping multiple layers of the ER, accompanied by morphological signs of organelle stress. Luminal BiP chaperone proteins are sequestered within these SCOTIN condensates, which elicit ER stress responses. The colocalization of luminal BiP with SCOTIN is strictly contingent upon the PRD-mediated condensation of SCOTIN in the cytosolic compartment, closely associated with the ER membrane. The cysteine-rich domain (CRD) of SCOTIN, along with the condensation-prone PRD domain, is required for ER stress induction. We propose that membrane-associated condensation transduces signals across the ER membrane, leading to the induction of BiP assembly and the ER stress response.

The progressive loss of retinal ganglion cell (RGC) axons leading to irreversible loss of vision is the pathological hallmark of glaucoma. However, the pathological mechanisms of RGC degeneration are not completely understood. Here, we investigated the role of chronic endoplasmic reticulum (ER) stress in glaucomatous neurodegeneration. To evaluate whether chronic ER stress-induced transcriptional factors, activating transcription factor 4 (ATF4), and C/EBP homologous protein (CHOP) are induced in RGCs; we utilized human donor tissue and the microbead occlusion model of glaucoma. Additionally, we performed the intravitreal injection of adeno-associated virus (AAV) 2 to express CHOP selectively in RGCs in C57BL/6 mice and evaluated its effect on RGC function and structure by pattern electroretinogram (PERG) and whole-mount retina staining with the RBPMS antibody. Here, we report that the ATF4-CHOP pathway is activated in the retinas of human glaucoma donor eyes and a mouse model of ocular hypertension. Further, the expression of CHOP in RGCs led to a significant loss of function, as evidenced by reduced PERG. Notably, the expression of CHOP in the retina induced a significant structural loss of RGCs within 15 weeks of injection. Altogether, our studies indicate that the expression of CHOP in RGCs leads to neurodegeneration in mice.

Numerous studies have identified similarities in blood transcriptomic signatures of tuberculosis (TB) phenotypes between mice and humans, including type 1 interferon production and innate immune cell activation. However, murine infection pathophysiology is distinct from human disease. We hypothesized that this is partly due to differences in the relative importance of biological pathways across species. To address this animal-to-human gap, we applied a systems modeling framework, Translatable Components Regression, to identify the axes of variation in the preclinical data most relevant to human TB disease state. Among the pathways our cross-species model pinpointed as highly predictive of human TB phenotype was the infection-induced unfolded protein response. To validate this mechanism, we confirmed that this cellular stress pathway modulates immune functions in Mycobacterium tuberculosis-infected mouse macrophages. Our work demonstrates how systems-level computational models enhance the value of animal studies for elucidating complex human pathophysiology.

Glioma is the most common primary malignant brain tumor, accounting for the majority of brain cancer-related deaths. Considering the limited efficacy of conventional therapies, novel molecular targeted therapies have been developed to improve outcomes and minimize toxicity. Glucose-regulated protein 78 (GRP78), a molecular chaperone primarily localized in the endoplasmic reticulum (ER), has received increasing attention for its role in glioma progression and resistance to conventional therapies. Overexpressed in gliomas, GRP78 supports tumor growth, survival, and therapeutic resistance by maintaining cellular homeostasis and regulating multiple signaling pathways. Its aberrant expression correlates with higher tumor grades and poorer patient prognosis. Beyond its intracellular functions, GRP78's presence on the cell surface and its role in the tumor microenvironment underscore its potential as a therapeutic target. Recent studies have explored innovative strategies to target GRP78, including small molecule inhibitors, monoclonal antibodies, and chimeric antigen receptor (CAR) T cell therapy, showing significant potential in glioma treatment. This review explores the biological characteristics of GRP78, its role in glioma pathophysiology, and the potential of GRP78-targeted therapy as a novel strategy to overcome treatment resistance and improve clinical outcomes. GRP78-targeted therapy, either alone or in combination with conventional treatments, could be a novel and attractive strategy for future glioma treatment.

Hepatocellular carcinoma is one of the deadliest and fastest-growing cancers. Among HCC etiologies, metabolic dysfunction-associated fatty liver disease (MAFLD) has served as a major HCC driver due to its great potential for increasing cirrhosis. The obesogenic environment fosters a positive energy balance and results in a continuous rise of obesity and metabolic syndrome. However, it is difficult to understand how metabolic complications lead to the poor prognosis of liver diseases and which molecular mechanisms are underpinning MAFLD-driven HCC development. Thus, suitable preclinical models that recapitulate human etiologies are essentially required. Numerous preclinical models have been created but not many mimicked anthropometric measures and the course of disease progression shown in the patients. Here we review the literature on adipose tissues, liver-related HCC etiologies and recently discovered genetic mutation signatures found in MAFLD-driven HCC patients. We also critically review current rodent models suggested for MAFLD-driven HCC study.

Melanocytes protect the body from ultraviolet radiation by synthesizing melanin. Tyrosinase, a key enzyme in melanin production, accumulates in the endoplasmic reticulum (ER) during melanin synthesis, potentially causing ER stress. However, regulating ER function for melanin synthesis has been less studied than controlling Tyrosinase activity.

This study investigates the regulatory mechanisms of melanin production, focusing on ER stress and the ER stress-induced response.

B16 mouse melanoma cells induced to undergo melanogenesis were treated with unfolded protein response (UPR) inhibitors or chemical chaperones, and their effects on melanogenesis were analyzed.

During melanogenesis in B16 cells stimulated by alpha-melanocyte-stimulating hormone (α-MSH), ER stress and UPR activation occurred, accompanied by increased Tyrosinase protein. Reducing IRE1 and ATF6 branch activity lowered melanin levels, while chemical chaperone treatment restored melanin production and increased Tyrosinase levels.

UPR activation, linked to elevated Tyrosinase levels, influences melanin production during melanogenesis. Modulating UPR can regulate melanin synthesis and provides a potential new approach for treating pigmentation disorders.

Although females typically have a survival advantage, those with PTEN functional abnormalities face a higher risk of developing tumors than males. However, the differences in how each sex responds to PTEN dysfunction have rarely been studied. We use Caenorhabditis elegans to investigate how male and hermaphrodite worms respond to dysfunction of the PTEN homolog daf-18. Our study reveals that male worms can counterbalance the negative effects of daf-18 deficiency, resulting in longer adult lifespan. The survival advantage depends on the loss of DAF-18 protein phosphatase activity, while its lipid phosphatase activity is dispensable. The deficiency in DAF-18 protein phosphatase activity leads to the failure of dephosphorylation of the endoplasmic reticulum membrane protein C18E9.2/SEC62, causing increased levels of unfolded and aggregated proteins in hermaphrodites. In contrast, males maintain proteostasis through a UNC-23/NEF-mediated protein ubiquitination and degradation process, providing them with a survival advantage. We find that sex determination is a key factor in regulating the differential expression of unc-23 between sexes in response to daf-18 loss. These findings highlight the unique role of the male sex determination pathway in regulating protein degradation.

Hematopoietic stem cells must mitigate myriad stressors throughout their lifetime to ensure normal blood cell generation. Here, we uncover unfolded protein response stress sensor inositol-requiring enzyme-1α (IRE1α) signaling in hematopoietic stem and progenitor cells (HSPCs) as a safeguard against myeloid leukemogenesis. Activated in part by an NADPH oxidase-2 mechanism, IRE1α-induced X-box binding protein-1 (XBP1) mediated repression of pro-leukemogenic programs exemplified by the Wnt-β-catenin pathway. Transcriptome analysis and genome-wide mapping of XBP1 targets in HSPCs identified an '18-gene signature' of XBP1-repressed β-catenin targets that were highly expressed in acute myeloid leukemia (AML) cases with worse prognosis. Accordingly, IRE1α deficiency cooperated with a myeloproliferative oncogene in HSPCs to cause a lethal AML in mice, while genetic induction of XBP1 suppressed the leukemia stem cell program and activity of patient-derived AML cells. Thus, IRE1α-XBP1 signaling safeguards the integrity of the blood system by restricting pro-leukemogenic programs in HSPCs.

Abdominal aortic aneurysms (AAA) are a life-threatening cardiovascular disease for which there is a lack of effective therapy preventing aortic rupture. During AAA formation, pathological vascular remodeling is driven by vascular smooth muscle cell (VSMC) dysfunction and apoptosis, for which the mechanisms regulating loss of VSMCs within the aortic wall remain poorly defined. Using single-cell RNA-Seq of human AAA tissues, we identified increased activation of the endoplasmic reticulum stress response pathway, PERK/eIF2α/ATF4, in aortic VSMCs resulting in upregulation of an apoptotic cellular response. Mechanistically, we reported that aberrant TNF-α activity within the aortic wall induces VSMC ATF4 activation through the PERK endoplasmic reticulum stress response, resulting in progressive apoptosis. In vivo targeted inhibition of the PERK pathway, with VSMC-specific genetic depletion (Eif2ak3fl/fl Myh11-CreERT2) or pharmacological inhibition in the elastase and angiotensin II-induced AAA model preserved VSMC function, decreased elastin fragmentation, attenuated VSMC apoptosis, and markedly reduced AAA expansion. Together, our findings suggest that cell-specific pharmacologic therapy targeting the PERK/eIF2α/ATF4 pathway in VSMCs may be an effective intervention to prevent AAA expansion.

Nonalcoholic fatty liver disease (NAFLD), characterized by hepatic lipid deposition, is one of the most prevalent chronic metabolic disorders globally, and its pharmaceutical treatments are still limited. Excessive lipid accumulation triggers endoplasmic reticulum (ER) stress and autophagy flux dysfunction, which are important mechanisms for NAFLD. Trehalose (Tre), a natural disaccharide, has been identified to reduce hepatic steatosis and glucose intolerance. However, its underlying mechanisms for NAFLD remain unclear. In this study, a high-fat-diet (HFD)-induced mouse NAFLD model and a saturated fatty acid palmitic acid (PA)-stimulated cell model were constructed. The results indicated that Tre supplementation ameliorated hepatocyte lipid deposition in vitro, as well as hepatic steatosis and hyperlipidemia in vivo. Mechanistically, Tre alleviated both autophagy flux dysfunction and endoplasmic reticulum (ER) stress. Under the stimulation of HFD or PA, Tre remarkably increased the expression and nucleic translocation of the lysosomal master protein transcription factor EB (TFEB), while decreasing the accumulation of p62 and also decreasing the ER stress markers (inositol-requiring enzyme 1 (IRE1α), XBP-1, CHOP, and BIP). Similar results were observed in an ER stressor tunicamycin (TM)-induced in vivo and in vitro models. In addition, the transcriptomic analysis of NAFLD patients revealed significant differences in ER stress-related and autophagy-related biomarkers, including TFEB, ATG7, IRE1α, and CHOP. Molecular docking results demonstrated a strong affinity between Tre and both IRE1α and TFEB. Overall, Tre protected hepatocytes from lipotoxicity-related ER stress and autophagy dysfunction, and its regulatory effect on the IRE1α-TFEB signaling pathway may be a critical mechanism. These findings suggest that Tre, as a bioactive substance with significant medicinal potential, holds considerable promise for drug development and clinical application in treating NAFLD.

Protein disulfide isomerase (PDI) is a member of the mercaptan isomerase family, primarily located in the endoplasmic reticulum (ER). At least 21 PDI family members have been identified. PDI plays a key role in protein folding, correcting misfolded proteins, and catalyzing disulfide bond formation, rearrangement, and breaking. It also acts as a molecular chaperone. Dysregulation of PDI activity is thus linked to diseases such as cancer, infections, immune disorders, thrombosis, neurodegenerative diseases, and metabolic disorders. In particular, elevated intracellular PDI levels can enhance cancer cell proliferation, metastasis, and invasion, making it a potential cancer marker. Cancer cells require extensive protein synthesis, with disulfide bond formation by PDI being a critical producer. Thus, cancer cells have higher PDI levels than normal cells. Targeting PDI can induce ER stress and activate the Unfolded Protein Response (UPR) pathway, leading to cancer cell apoptosis. This review discusses the structure and function of PDI, PDI inhibitors in cancer therapy, and the limitations of current inhibitors, proposing especially future directions for developing new PDI inhibitors.

Endoplasmic reticulum (ER) stress is one of the major events accompanying myocardial ischemia-reperfusion (IR) injury, as hypoxia and oxidative stress disrupt protein folding in the ER. As a result, the unfolded protein response (UPR) is activated through different sensors including inositol-requiring enzyme 1α (IRE1α) and protein kinase R-like ER kinase (PERK). Failure of the UPR to reduce ER stress induces cellular dysfunction. Matrix metalloproteinase-2 (MMP-2) is a ubiquitous protease that is activated intracellularly in response to oxidative stress and partially localizes near the ER. However, its role in ER homeostasis is unknown. We hypothesized that MMP-2 is involved in the regulation of the UPR and ER stress-mediated apoptosis during IR injury. Isolated mouse hearts subjected to IR injury showed impaired recovery of post-ischemic contractile function compared to aerobically perfused controls. Ventricular extracts from IR hearts had higher levels of glucose-regulated protein-78 and protein disulfide isomerase and lower levels of IRE1α and PERK compared to aerobic controls. MMP-2 inhibitors, ARP-100 or ONO-4817, given 10 min before ischemia, improved cardiac post-ischemic recovery and preserved IRE1α level in hearts subjected to 30 min ischemia/40 min reperfusion. IR also increased the levels of CHOP and mitochondrial Bax and caspase-3 and -9 activities, indicating induction of apoptosis, all of which were attenuated by MMP-2 inhibitors, regardless of the reperfusion time. Immunoprecipitation showed an association between MMP-2 and IRE1α in aerobic and IR hearts. During myocardial IR injury MMP-2 may impair the UPR and induce apoptosis by proteolysis of IRE1α. Inhibition of MMP-2 activity protects against cardiac contractile dysfunction in part by preserving IRE1α and preventing the progression to myocardial cell death.

MicroRNA plays a crucial role in post-transcriptional gene regulation and has recently emerged as a factor linked to aging, but the underlying regulatory mechanisms remain incompletely understood. In this study, we observed lifespan-extending effects in miR-80-deficient Caenorhabditis elegans at 20°C but not 25°C. At 20°C, miR-80 deletion leads to NLP-45 upregulation, which positively correlates to increased abu transcripts and extended lifespan. Supportively, we identified miR-80 binding regions in the 5' and 3' UTR of nlp-45. As the temperature rises to 25°C, wildtype increases miR-80 levels, but removal of miR-80 is accompanied by decreased nlp-45 expression, suggesting intervention from other temperature-sensitive mechanisms. These findings support the concept that microRNAs and neuropeptide-like proteins can form molecular regulatory networks involving downstream molecules to regulate lifespan, and such regulatory effects vary on environmental conditions. This study unveils the role of an axis of miR-80/NLP-45/UPRER components in regulating longevity, offering new insights on strategies of aging attenuation and health span prolongation.

The endoplasmic reticulum, a key cellular organelle, regulates a wide variety of cellular activities. Endoplasmic reticulum autophagy, one of the quality control systems of the endoplasmic reticulum, plays a pivotal role in maintaining endoplasmic reticulum homeostasis by controlling endoplasmic reticulum turnover, remodeling, and proteostasis. In this review, we briefly describe the endoplasmic reticulum quality control system, and subsequently focus on the role of endoplasmic reticulum autophagy, emphasizing the spatial and temporal mechanisms underlying the regulation of endoplasmic reticulum autophagy according to cellular requirements. We also summarize the evidence relating to how defective or abnormal endoplasmic reticulum autophagy contributes to the pathogenesis of neurodegenerative diseases. In summary, this review highlights the mechanisms associated with the regulation of endoplasmic reticulum autophagy and how they influence the pathophysiology of degenerative nerve disorders. This review would help researchers to understand the roles and regulatory mechanisms of endoplasmic reticulum-phagy in neurodegenerative disorders.

Endoplasmic reticulum (ER) is an essential organelle involved in vesicular transport, calcium handling, protein synthesis and folding, and lipid biosynthesis and metabolism. ER stress occurs when ER homeostasis is disrupted by the accumulation of unfolded and/or misfolded proteins in the ER lumen. Adaptive pathways of the unfolded protein response (UPR) are activated to maintain ER homeostasis. In obesity and type 2 diabetes mellitus (T2DM), accumulating data indicate that persistent ER stress due to maladaptive UPR interacts with insulin/leptin signaling, which may be the potential and central mechanistic link between obesity-/T2DM-induced metabolic dysregulation (chronic hyperglycemia, dyslipidemia and lipotoxicity in cardiomyocytes), insulin/leptin resistance and the development of diabetic cardiomyopathy (DiabCM). Meanwhile, these pathological conditions further exacerbate ER stress. However, their interrelationships and the underlying molecular mechanisms are not fully understood. A deeper understanding of ER stress-mediated pathways in DiabCM is needed to develop novel therapeutic strategies. The aim of this review is to discuss the crosstalk between ER stress and leptin/insulin signaling and their involvement in the development of DiabCM focusing on mitochondria-associated ER membranes and chronic inflammation. We also present the current direction of drug development and important considerations for translational research into targeting ER stress for the treatment of DiabCM.

Decoy receptor 3 (DcR3), a soluble receptor in the tumor necrosis factor receptor superfamily, regulates the functions of monocytes, macrophages, dendritic cells, and T cells. Previous studies have demonstrated that DcR3 suppresses B cell proliferation in vitro and ameliorates autoimmune diseases in animal models; however, whether and how DcR3 regulates antibody production is unclear. Using a DcR3 transgenic mouse model, we found that DcR3 impaired the T cell-dependent antigen-stimulated antibody response. The number of Ag-specific antibody-secreting cells was transiently reduced, but the concentration of specific antibodies continued to decrease in the DcR3 transgenic mice, implying a direct suppression of antibody production by DcR3. In vitro assays showed that the DcR3-Fc fusion protein attenuated T cell-dependent induced antibody production and reduced the expression of secretory Igh and Xbp1. We found that nuclear factor κB (NF-κB) activity was essential for the expression of Xbp1 in activated B cells. DcR3-Fc attenuated anti-CD40-induced NF-κB activity and Xbp1 promoter activity. Furthermore, DcR3-Fc decreased the expression of Xbp1 in Blimp1+ antibody-secreting cells. Restoration of spliced XBP1 (X-box binding protein 1) in DcR3-treated B cells increased the secretory Ighg1 transcript levels, suggesting that reducing XBP1 is one of the mechanisms by which DcR3 regulates antibody production both in vitro and in vivo. Collectively, these results indicate that in addition to blocking proliferation, DcR3 impairs NF-κB activation, subsequently decreasing the expression of Xbp1, eventually leading to a reduction in antibody secretion.

The endoplasmic reticulum (ER) is a dynamic organelle that is a site of the synthesis of proteins and lipids, contributing to the regulation of proteostasis, lipid metabolism, redox balance, and calcium storage/-dependent signaling events. The disruption of ER homeostasis due to the accumulation of misfolded proteins in the ER causes ER stress which activates the unfolded protein response (UPR) system through the activation of IRE1, PERK, and ATF6. Activation of UPR is observed in various cancers and therefore, its association with process of carcinogenesis has been of importance. Tumor cells effectively utilize the UPR system to overcome ER stress. Moreover, ER stress and autophagy are the stress response mechanisms operating together to maintain cellular homeostasis. In human cancers, ER stress-driven autophagy can function as either pro-survival or pro-death in a context-dependent manner. ER stress-mediated autophagy can have crosstalk with other types of cell death pathways including apoptosis and ferroptosis. In this connection, the present review has evaluated the role of ER stress in the regulation of autophagy-mediated tumorigenesis and its interactions with other cell death mechanisms such as apoptosis and ferroptosis. We have also comprehensively discussed the effect of ER stress-mediated autophagy on cancer progression and chemotherapeutic resistance.

Alzheimer's disease (AD) dysfunctional unfolded protein response (UPR) is revealed by amyloid-β aggregates. Normally, UPR reacts to endoplasmic reticulum stress by resolving misfolded/aggregated proteins, and UPR failure induces brain-cell apoptosis consistent with AD pathology. Peripheral blood mononuclear cells (PBMC) and immunocyte brain infiltrates are involved in AD pathogenesis, whose risk is lowered by the Bacillus Calmette Guerin (BCG) vaccine. Hypothetically, BCG prevents AD caused by UPR-driven apoptosis in PBMC brain infiltrates, corrected by BCG-vaccinated PBMC brain infiltrates.

To reveal whether BCG shifts the UPR towards cell survival. Method: PBMC proteins from 6 individuals were compared by immuno-electrophoresis before and after BCG hypervaccination. Cryopreserved PBMC provided an opportunity to analyze the BCG impact on the UPR, although their donor destiny to develop AD was unknown. UPR signaling responsive to BCG was recorded to examine if BCG can influence UPR signaling and thereby explain the previously demonstrated AD prevention by BCG.

UPR signal levels were scored according to positive versus negative cell survival odds by the BCG impact on a dozen UPR signals. The balance between positive and negative scores of individuals emphasizes the impact of the BCG vaccine on the UPR. The antiapoptotic UPR signals under BCG show opposite trends to UPR signals in AD brains, reported by the literature. In conclusion, 3/6 individuals had superior PBMC survival chances under BCG.

These results suggest that the UPR is part of the mechanism responsible for reducing the risk of AD, as previously shown among BCG-treated bladder cancer patients.

A hallmark of Alzheimer disease (AD) and tauopathies, severe neurodegenerative diseases, is the progressive aggregation of Tau, also known as microtubule-associated Tau protein. Full-length Tau1-441, also known as 2N4R, contains two N-terminal inserts that bind to tubulin. This facilitates the self-assembly of tubulin simultaneously enhancing stability of cell microtubules. Other Tau isoforms have one (1N4R) or zero (0N4R) N-terminal inserts, which makes 2N4R Tau more and 0N4R less effective in promoting microtubule self-assembly. A growing body of evidence indicates that lipids can alter the aggregation rate of Tau isoforms. However, the role of N-terminal inserts in Tau-lipid interactions remains unclear. In this study, we utilized a set of biophysical methods to determine the extent to which N-terminal inserts alter interactions of Tau isoforms with cholesterol, one of the most important lipids in plasma membranes. Our results showed that 2 N insert prevents amyloid-driven aggregation of Tau at the physiological concentration of cholesterol, while the absence of this N-terminal repeat (1N4R and 0N4R Tau) resulted in the self-assembly of Tau into toxic amyloid fibrils. We also found that the presence of cholesterol in the lipid bilayers caused a significant increase in the cytotoxicity of 1N4R and 0N4R Tau to neurons. This effect was not observed for 2N4R Tau fibrils formed in the presence of lipid membranes with low, physiological, and elevated concentrations of cholesterol. Using molecular assays, we found that Tau aggregates primarily exert cytotoxicity by damaging cell endosomes, endoplasmic reticulum, and mitochondria.

The prevalence of drug-induced liver injury (DILI) and viral liver infections presents significant challenges in modern healthcare and contributes to considerable morbidity and mortality worldwide. Concurrently, metabolic dysfunctionassociated steatotic liver disease (MASLD) has emerged as a major public health concern, reflecting the increasing rates of obesity and leading to more severe complications such as fibrosis and hepatocellular carcinoma. X-box binding protein 1 (XBP1) is a distinct transcription factor with a basic-region leucine zipper structure, whose activity is regulated by alternative splicing in response to disruptions in endoplasmic reticulum (ER) homeostasis and the unfolded protein response (UPR) activation. XBP1 interacts with a key signaling component of the highly conserved UPR and is critical in determining cell fate when responding to ER stress in liver diseases. This review aims to elucidate the emerging roles and molecular mechanisms of XBP1 in liver pathogenesis, focusing on its involvement in DILI, viral liver infections, MASLD, fibrosis/cirrhosis, and liver cancer. Understanding the multifaceted functions of XBP1 in these liver diseases offers insights into potential therapeutic strategies to restore ER homeostasis and mitigate liver damage.