Transforming growth factor-&beta; and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis

doi:10.3748/wjg.v19.i48.9366

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 19, Issue 48

This Article

Academic Content and Language Evaluation of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (5115)

All Articles published online

The chart showing PDF series, HTML series, Tables (1-8) series.

Item

Count

PDF

323

HTML

2717

Tables (1-8)

135

Sum=3175

Publishing Process of This Article

The chart showing Browse series, Download series.

Item

Count

Browse

1003

Download

937

Sum=1940

Dec 28, 2013 (publication date) through Apr 18, 2024

Times Cited of This Article

Times Cited (1)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Brief Article

World J Gastroenterol. Dec 28, 2013; 19(48): 9366-9376
Published online Dec 28, 2013. doi: 10.3748/wjg.v19.i48.9366

Table 1 Gene specific primers for polymerase chain reaction amplification and dissociation analysis

Gene	Forward primer	Reverse primer
MCP1-2518	TTTCTTGACAGAGCAGAAGTGGGAG	TTGCTGGCTGAGTGTTCACATAGG
CCR2 190	ATACCAACGAGAGCGGTGAAGAAG	AAAGCAGATCAGAGATGGCCAGG
IL10-592	AAAGGAGCCTGGAACACATCCTGT	AAAGTTCCCAAGCAGCCCTTCCAT
IL10-1082	TCCAAGACAACACTACTAAGGCTTC	GCTGGATAGGAGGTCCCTTACTTT
TGF-β	CTACCGCTGCTGTGGCTACTGGT	TCACCAGCTCCATGTCGATAGTCT
TLR4-299	CCGATTAGCATACTTAGACTACTACCTC	CCTTTCAATAGTCACACTCACCAGG
TLR4-399	GCTTGAGTTTCAAAGGTTGCTGTTCTC	GCCCAAGAAGTTTGAACTCATGGTAA
hOGG1	ACCCTCCTACAGGTGCTGTTCAGT	CCTTTGGAACCCTTTCTGCGCTTT

MCP-1: Monocyte chemoattractant protein 1; CCR-2: Chemokine C-C motif receptor; IL10: Interleukin-10; TGF-β: Transforming growth factor-beta; TLR4: Toll-like receptor 4; hOGG1: Human 8-oxoguanine DNA glycosylase.

Table 2 Polymerase chain reaction profiles for candidate gene high resolution melt analysis

Gene	Annealing temperature	Extension temperature	Melt analysis range
MCP-1	58 °C	72 °C	74 to 84 °C
CCR-2	58 °C	72 °C	74 to 84 °C
IL10-592	57 °C	72 °C	75 to 85 °C
IL10-1082	59 °C	72 °C	70 to 81 °C
TGF-β	65 °C (20 s)	72 °C (20 s)	79 to 89 °C
TLR4 299	57 °C	68 °C	66 to 78 °C
TLR4 399	58 °C	70 °C	69 to 81 °C
hOGG1	57 °C	68 °C	78 to 88 °C

MCP-1: Monocyte chemoattractant protein 1; CCR-2: Chemokine C-C motif receptor; IL10: Interleukin-10; TGF-β: Transforming growth factor-beta; TLR4: Toll-like receptor 4; hOGG1: Human 8-oxoguanine DNA glycosylase.

Table 3 Patient characteristics grouped according to the presence or absence of hepatic fibrosis (univariate analysis) n (%)

Parameter	No fibrosis (n = 136)	Fibrosis present (n = 109)	P value
Male gender	72 (53)	89 (82)	0.0001
Age at biopsy (yr) (mean ± SD)	39.7 (14.9)	44.3 (12.4)	0.006
Alcohol (g/d) (median: range)	5 (0-120)	20 (0-200)	0.0001
Steatosis present¹	36 (37)	42 (53)	0.03
Serum ferritin (μg/L) (median: range)	531 (33-3000)	2134 (155-6000)	0.0001
HIC (μmol/g dw) (median: range)	124 (20-537)	218 (43-847)	< 0.0001
Iron grade
0	1 (1)	0
1	5 (4)	0
2	27 (20)	7 (6)
3	63 (46)	25 (23)
4	40 (29)	77 (71)	< 0.0001

¹Steatosis data available for 176 subjects (72% of total cohort).

Table 4 Allele frequency in candidate genes assessed in patient and control groups by high resolution melt analysis: Compared to published data for Caucasian ethnicity populations

Gene	Patient group	Control group	Published results¹
MCP1	A 0.729	A 0.736	A 0.695
MCP1	G 0.271	G 0.264	G0.305
CCR2	G 0.892	G 0.976	G 0.892
CCR2	A 0.108	A 0.024	A 0.108
TGFβ	G 0.918	G 0.892	G 0.887
TGFβ	C 0.082	C 0.108	C 0.113
hOGG1	C 0.695	C 0.694	C 0.776
hOGG1	G 0.305	G 0.306	G 0.224
IL10-1082	G 0.539	G 0.500	G0.531
IL10-1082	A 0.461	A 0.500	A 0.469
IL10-592	C 0.794	C 0.794	C 0.792
IL10-592	A 0.206	A 0.206	A 0.208
TLR4 299	A 0.934	A 0.930	A 0.967
TLR4 299	G 0.066	G 0.070	G 0.033
TLR4 399	C 0.934	C 0.931	C 0.955
TLR4 399	T 0.066	T 0.069	T 0.045

¹NCBI dbSNP (HapMap CEU-Utah residents with Northern and Western European ancestry from the CEPH collection). MCP-1: Monocyte chemoattractant protein 1; CCR-2: Chemokine C-C motif receptor; IL10: Interleukin-10; TGF-β: Transforming growth factor-beta; TLR4: Toll-like receptor 4; hOGG1: Human 8-oxoguanine DNA glycosylase.

Table 5 Genetic polymorphisms in Hereditary Haemochromatosis patients grouped according the presence or absence of advanced fibrosis and subjected to univariate analysis n (%)

Gene	No/minimal fibrosis (F0-2)	Advanced fibrosis (F3-4)	P value
MCP1
AA	99 (53.5)	28 (46.7)
AG	76 (41.1)	27 (45.0)
GG	10 (5.4)	5 (8.3)	0.546
CCR2
GG	142 (78.0)	50 (84.8)
AG	37 (20.3)	9 (15.3)
AA	3 (1.7)	0 (0)	0.401
TGFβ
GG	154 (83.2)	51 (85)
GC	31 (16.8)	9 (15)	0.749
hOGG1
CC	99 (53.8)	26 (43.3)
CG	64 (34.8)	25 (41.7)
GG	21 (11.4)	9 (15)	0.352
IL10-1082
GG	50 (27.1)	17 (28.3)
GA	97 (52.4)	33 (55.0)
AA	38 (20.5)	10 (16.7)	0.806
IL10-592
CC	120 (64.9)	37 (61.7)
AC	58 (31.3)	17 (28.3)
AA	7 (3.8)	6 (10.0)	0.173
TLR4 299
AA	159 (86.4)	54 (91.5)
AG	24 (13.0)	4 (6.8)
GG	1 (0.6)	1 (1.7)	0.305
TLR4 399
CC	161 (87.0)	53 (89.8)
CT	23 (12.4)	5 (8.5)
TT	1 (0.5)	1 (1.7)	0.502

Table 6 Multivariate ordered logistic regression analysis determining role of genetic polymorphisms in increasing hepatic fibrosis stage

Gene	OR	95%CI	P value	Adjusted P value¹
MCP1	1.11	0.69-1.80	0.660	0.681
CCR2	0.71	0.36-1.32	0.284	0.432
TGFβ	1.03	0.54-1.95	0.936	0.740
hOGG1	0.94	0.44-1.98	0.864	0.588
IL10-1082	1.10	0.65-1.88	0.720	0.897
IL10-592	0.82	0.50-1.35	0.441	0.639
TLR4 299	0.73	0.35-1.53	0.403	0.745
TLR4 399	0.87	0.42-1.81	0.706	0.990

¹Adjusted for age at biopsy: gender: iron grade and alcohol consumption. MCP-1: Monocyte chemoattractant protein 1; CCR-2: Chemokine C-C motif receptor; IL10: Interleukin-10; TGF-β: Transforming growth factor-beta; TLR4: Toll-like receptor 4; hOGG1: Human 8-oxoguanine DNA glycosylase.

Table 7 Genetic polymorphism frequencies in patients with heavy iron loading (Grade 3 and 4) grouped according to no fibrosis (F0) vs advanced fibrosis (F3/F4)

Gene	No fibrosis (F0) (n = 103)		Advanced fibrosis (F3/4) (n = 60)		P value	Adjusted P value¹
MCP1	AA 53/103	AG/GG	AA 28/60	AG/GG 32/60	0.555	0.433
MCP1	51.50%	50/103 48.5%	46.70%	53.3%	0.555	0.433
CCR2	GG 81/100	AG/AA	GG 50/59	AG/AA 9/59	0.549	0.277
CCR2	81%	19/100 19%	84.70%	15.3%	0.549	0.277
TGF β	GG 86/103	CG/CC 17/103	GG 51/60	CG/CC 9/60	0.800	0.968
TGF β	83.50%	16.5%	85%	15%	0.800	0.968
hOGG1	CC 54/102	CG/GG 48/102	CC 26/60	CG/GG 34/60	0.238	0.790
hOGG1	52.90%	47.1%	43.30%	56.7%	0.238	0.790
IL10-1082	AA/AG 75/103	GG 28/103	AA/AG 43/60	GG 17/60	0.874	0.998
IL10-1082	72.8%	27.20%	71.80%	28.30%	0.874	0.998
IL10-592	AA/AC 34/103	CC 66/103	AA/AC 23/60	CC 37/60	0.492	0.659
IL10-592	33.0%	67.0%	38.3%	61.7%	0.492	0.659
TLR4 299	AA 87/102	AG/GG 15/102	AA 54/59	AG/GG 5/59	0.248	0.848
TLR4 299	85.3%	14.7%	91.5%	8.5%	0.248	0.848
TLR4 399	CC 89/103	CT/TT 14/103	CC 53/59	CT/TT 6/59	0.524	0.985
TLR4 399	86.4%	13.6%	89.8%	10.2%	0.524	0.985

¹Adjusted for age:gender:alcohol consumption. MCP-1: Monocyte chemoattractant protein 1; CCR-2: Chemokine C-C motif receptor; IL10: Interleukin-10; TGF-β: Transforming growth factor-beta; TLR4: Toll-like receptor 4; hOGG1: Human 8-oxoguanine DNA glycosylase.

Table 8 Logistic regression analysis performed in subjects with HIC > 236 μmol/g dw and comparing outcome of F0 vs F3/4 (univariate analysis) (n = 47)

Factor	OR	95%CI	P value
Age	1.07	1.00-1.15	0.034
Alcohol	1.03	1.01-1.05	0.011
Female gender	0.27	0.05-1.55	0.140
MCP1	1.20	0.37-3.87	0.76
CCR2	0.74	0.13-4.12	0.73
TGFβ	0.58	0.09-3.52	0.553
hOGG1	1.50	0.47-4.77	0.492
IL10-1082	1.89	0.48-7.44	0.363
IL10-592	0.98	0.30-3.21	0.980
TLR4 299	1.17	0.77-7.79	0.868
TLR4 399	1.24	0.19-8.19	0.824

MCP-1: Monocyte chemoattractant protein 1; CCR-2: Chemokine C-C motif receptor; IL10: interleukin-10; TGF-β: Transforming growth factor-beta; TLR4: Toll-like receptor 4; hOGG1: Human 8-oxoguanine DNA glycosylase.

Citation: Wood MJ, Powell LW, Dixon JL, Subramaniam VN, Ramm GA. Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis. World J Gastroenterol 2013; 19(48): 9366-9376
URL: https://www.wjgnet.com/1007-9327/full/v19/i48/9366.htm
DOI: https://dx.doi.org/10.3748/wjg.v19.i48.9366