Analysis of single nucleotide polymorphisms in the region of CLDN2-MORC4 in relation to inflammatory bowel disease

Table 1 General study outline

Study design1	Cohort and disease	Number of families	Number of individuals	Women
Case control study	Healthy unrelated controls		333	162
	Swedish IBD families	191
	IBD		347	157
	CD		150	69
	UC		166	71
	IBD-U		31	17
Family based approach	Non-Swedish families	463
	IBD		715	398
	CD		528	297
	UC		151	83
	IBD-U		36	18

¹Including Claudin (CLDN)1, CLDN2, CLDN4. IBD: Inflammatory bowel disease; CD: Crohn’s disease; UC: Ulcerative colitis; IBD-U: Unclassified colitis.

Table 2 Single nucleotide polymorphism markers in the genetic regions of Claudin-1, Claudin-2 and Claudin-4

Candidate gene	SNP rs number1	MAF2	Assay ID3	Position in kbp relative candidate gene and location4	Coverage5
CLDN1	rs1491991	0.25	C_7550365_10	-66.3 (5’-flanking region)	CLDN16
	rs3732923	0.41	C_27509271_10	5.5 (intron 1)	CLDN1 (from promoter until first two thirds of intron 1)
	rs3732924	0.29	C_8528578_10	5.6 (intron 1)	CLDN1 (from promoter until first two thirds of intron 1)
	rs9848283	0.49	C_2057729_10	6.4 (intron 1)	CLDN1 (from promoter until first two thirds of intron 1)
	rs12629166	0.47	C_2057718_10	13.8 (intron 3)	CLDN1 (from second intron until 3’-flanking region)
	rs7620166	0.41	C_8528273_10	45.9 (3’-flanking region)	CLDN1 (from second intron until 3’-flanking region)
	rs567408	0.42	C_1587588_10	94.5 (3’-flanking region)	intergenic block
	rs536435	0.42	C_1587674_10	155.3 (3’-flanking region)	LOC391603
CLDN2	rs4409525	0.34	C_382795_10	-23.3 (5’-flanking region)	RIPPLY1, TBC1D8B
	rs5917027	0.48	C_11771710_10	-1.0 (5’-flanking region)	CLDN2, MORC4
	rs12014762	0.21	C_2013132_20	20.0 (3’-flanking region)	CLDN2, MORC4
CLDN4	rs4131376	0.43	C_26657639_10	-56.9 (5’-flanking region)	ABHD11, CLDN3, CLDN4, WBSCR27, WBSCR28
	rs8629	0.18	C_7493975_10	0.3 (exon 1)	ABHD11, CLDN3, CLDN4, WBSCR27, WBSCR28

¹Initially all of the selected single nucleotide polymorphism (SNP) markers were evaluated, using the Hapolview software 4.0[52], for linkage disequilibrium (LD) and association to inflammatory bowel disease (IBD) in a case-control study using a subset of Swedish IBD patients (73, 39 and 42 individuals with IBD, Crohn’s disease (CD) or ulcerative colitis, respectively). Because of significant associations to CD, SNP markers for claudin (CLDN)1 (rs7620166) and CLDN2 (rs12014762) were chosen for further evaluation on the complete case-control. Even though non of the CLDN4 SNP markers showed evidence of association to any of the disease categories rs8629 was included for further evaluation;

²Minor allele frequency (MAF) according to SNP data from the HapMap CEPH collection;

³TaqMan SNP genotyping assays (Applied Biosystems, Foster City, CA, United States);

⁴With respect to each candidate gene, SNP positions are defined relative a genomic reference sequence. The first nucleotide of a reference cDNA sequence has been designated +1, with the preceeding genomic position being -1. The following reference sequences have been used for CLDN1 NT_005612.15 (genomic) and NM_021101.3 (mRNA), CLDN2 NT_011651.16 (genomic) and NM_020384.2 (mRNA) and CLDN4 NT_007758.11 (genomic) and NM_001305.3 (mRNA);

⁵Linkage blocks have been defined using SNP data from the HapMap CEPH collection and the SNP browser software with 0.3 LDU (linkage disequilibrium units) as threshold for linkage block computation.

Table 3 Primers for polymerase chain reaction amplification and sequencing of Claudin-2

Candidate gene	Exon	Forward primer1	Reverse primer2	Size of PCR-product
CLDN2	1	GTAGGACCTGCTCTTTGAACTC23	TGAATTTAAAAGGCAGCAACTA23	708 bp
	1	TCAATCTTTCCCAGCCTCCA3	TTTCTGTCAAAAACTCCACTCC3
	2	TTGTAGAGAATGGGGAGGTGTGC23	TCAATTGCAGACTGAGGCCAAA2	599 bp
	2		TGCAGACTGAGGCCAAACTG3
	2	CTAGGCCCCTGGAGATTCAAGA23	TGTGCCCAAAAGCCCCAGAA23	682 bp
	2	TTCCTTTCTCATGTGTTATTTCTAA3	GAGAAAGGAAAAAAAAAACAAC3
	2	TGAGGGATTAGAGGTGTTCAA23	GCAGCACCTTCTGACACGA23	892 bp
	2	ATCCTACGGGACTTCTACTCA3	ACTCCACCTGCTACCGCCACT3

¹q, Q-solution for polymerase chain reaction (PCR)-amplification;

²Primer used for PCR;

³Primer used for sequencing. CLDN: Claudin.

Table 4 Inflammatory bowel disease-phenotypes were investigated by performing family-based and case-control approach in genetic association studies

	rs7620166 (CLDN1)		rs12014762 (CLDN2)		rs8629 (CLDN4)
		allelic OR (95%CI)	P value	allelic OR (95%CI)	P value	allelic OR (95%CI)	P value
IBD	Swedish case-control	1.33 (1.04-1.72)	0.025	1.39 (0.95-2.01)	0.083	1.21 (0.89-1.65)	0.225
	Non-Swedish families	0.87 (0.72-1.06)	0.177	1.25 (0.89-1.77)	0.195	1.09 (0.88-1.33)	0.432
CD	Swedish case-control	1.17 (0.86-1.60)	0.319	1.98 (1.17-3.35)	0.007	1.25 (0.84-1.85)	0.258
	Non-Swedish families	0.80 (0.64-1.00)	0.052	1.37 (0.91-2.07)	0.126	1.14 (0.89-1.46)	0.287
UC	Swedish case-control	1.35 (0.98-1.84)	0.064	1.27 (0.80-2.02)	0.304	1.18 (0.80-1.73)	0.409
	Non-Swedish families	1.19 (0.77-1.84)	0.436	0.91 (0.39-2.14)	0.827	1.15 (0.75-1.77)	0.512

The family-based association studies included a total of 463 families. For the single nucleotide polymorphism -markers rs7620166 [claudin (CLDN)1], rs12014762 (CLDN2) and rs8629 (CLDN4) genotyping failed for 5 [including 2 Crohn’s disease (CD)], 9 (including 3 CD) and 7 (including 2 CD) samples, respectively. Results were based on 191, 103 and 102 cases of inflammatory bowel disease (IBD), CD and ulcerative colitis (UC), respectively and 333 controls. OR (and its associated 95%CI) and P values (based on log likelihood ratio χ² statistics) were calculated for the T allele of rs7620166, the C allele of rs12014762, and the C allele of rs8629.

Table 5 Genotype-phenotype correlation between Claudin-2 marker (rs12014762) polymorphism and clinical characteristics of 677 patients with Crohn’s disease (all families)

rs12014762 Crohn’s disease	At least one C	T	P value
Sex
Male	265	47
Female	354	11
Age at diagnosis (yr)
Mean (SD)	24.48 (12.11)	24.36 (11.46)	0.90
Median (range)	22 (3-70)	22 (8-63)
Location at onset:	n = 583	n = 54
Pure colonic disease	78	6	0.64
Pure ileal disease	117	14	0.31
Ileocolonic disease	274	309	0.87
Any colonic disease	414	37	0.70
Any ileal disease	424	42	0.42
Upper digestive tract	118	12	0.73
Perineal disease	147	11	0.53
Granuloma	237/478	26/43	0.12
Penetrating disease	218/478	22/43	0.48
Strictures	221/478	15/43	0.15
Extra-digestive symptoms	190/619	15/58	0.44
Smoking habits	n = 505	n = 51
Non-smoker	272	21	0.08
Smoker	157	21	0.14
Ex-smoker	76	9	0.62

Table 6 Sequence variants identified by resequencing of selected gene regions

Gene1	Position of SNP	rs-number	Part of gene/predicted consequence	VAF/control2	VAF/patients2
CLDN2	c.-178-678C>G (g.29466911)	rs62605981	Intron/5’ gene flanking region3	0.175	0.139
	c.-178-104_-103delAT (g.29467485_29467486delAT)	rs72466477	Intron/5’ gene flanking region3	0.175	0.083

¹The following reference sequences have been used for claudin (CLDN)2 NT_011651.16 (genomic) and NM_020384.2 (mRNA);

²Variant allele frequencies (VAF) are defined with respect to the corresponding reference sequence;

³The intronic region of CLDN2, according to the CLDN2 reference mRNA (NM_020384), correspond to the promoter region described by Sakaguchi et al[34]. SNP: Single nucleotide polymorphism.

Table 7 Genetic association between inflammatory bowel disease-phenotype and either newly discovered Claudin-2 promoter polymorphisms or a nonsynonymous coding polymorphisms in MORC4 was analyzed by performing case-control studies

	rs62605981 (CLDN2)		rs72466477 (CLDN2)		rs6622126 (MORC4)
	allelic OR (95%CI)	P value	allelic OR (95%CI)	P value	allelic OR(95%CI)	P value
IBD	1.11 (0.71-1.73)	0.659	1.23 (0.79-1.91)	0.350	1.24 (0.91-1.70)	0.179
CD	0.83 (0.49-1.41)	0.501	1.16 (0.68-2.00)	0.584	1.61 (1.08-2.41)	0.018
UC	1.24 (0.69-2.26)	0.463	1.19 (0.68-2.06)	0.543	0.903 (0.61-1.33)	0.606

Results were based on 166, 89 and 89 cases of inflammatory bowel disease (IBD), Crohn’s disease (CD) and Ulcerative colitis (UC), respectively, available from the Swedish families and 333 controls (Table 1). OR (and its associated 95%CI) and P values (based on log likelihood ratio chi-square statistics) were calculated for the C allele of rs62605981, the AT allele of rs72466477, and the G allele of rs6622126. CLDN: Claudin.