Hepatitis B virus subgenotypes and basal core promoter mutations in Indonesia

doi:10.3748/wjg.15.4028

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 15, Issue 32

This Article

Citation of this article

Corresponding Author of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (1683)

All Articles published online

The chart showing PDF series, HTML series, Figures (1-2) series, Tables (1-6) series.

Item

Count

PDF

280

HTML

1096

Figures (1-2)

164

Tables (1-6)

143

Sum=1683

Aug 28, 2009 (publication date) through Apr 24, 2024

Times Cited of This Article

Times Cited (27)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Brief Articles

World J Gastroenterol. Aug 28, 2009; 15(32): 4028-4036
Published online Aug 28, 2009. doi: 10.3748/wjg.15.4028

Table 1 Primers used in this study

Primer	Nucleotide sequence (5’→3’)	Position	Polarity	Reference
Full S
Fgp2	CGCCATGGGAGGTTGGTCTTCCAAACCTCG	2848-2873	Forward	This study
Rgp2	GACAAGCTTAATGTATACCCAAAGACAAAAGAAAATTGG	803-835	Reverse
PreS (nested PCR)
HBPr94	GGTAAAAAGGGACTCACGATG	775-795	Reverse	[2]
HBPr134	TGCTGCTATGCCTCATCTTC	414-433	Forward
HBPr135	CAAAGACAAAAGAAAAATTGC	803-822	Reverse
HBx
Fgp3	CGCCATGGCTGCTAGGCTGTGCTGCCAAC	1374-1398	Forward	This study
Rgp3	CGCTCGAGGGCAGAGGGGAAAAAGTTGCATGGT	1811-1838	Reverse	This study
HBx (nested PCR)
HB1	GCCAAGTGTTTGCTGACGC	1175-1193	Forward	[37]
HB2	CCATACTGCGGAACTCCTAG	1266-1285	Forward
HB3	AAAGTTGCATGGTGCTGGTG	1804-1823	Reverse

Table 2 HBV genotype and serotype distribution in samples with different clinical diagnosis

Characteristics		n(%) in each clinical diagnosis
		CH (n = 61)	LC (n = 62)	HCC			Total (n = 171)	P
		CH (n = 61)	LC (n = 62)	With LC (n = 12)	Without LC (n = 36)	All HCC (n = 48)	Total (n = 171)	CH vs LC	CH vs All HCC	LC vs All HCC	CH vs LC vs All HCC
Genotype and subgenotype
B	B2	5 (8.2)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	5 (2.9)	NS	NS	NA	0.007
	B3	38 (62.3)	41 (66.1)	8 (66.7)	20 (55.6)	28 (58.3)	107 (62.6)	NS	NS	NS	NS
	B4	0 (0.0)	1 (1.6)	0 (0.0)	0 (0.0)	0 (0.0)	1 (0.6)	NS	NA	NS	NS
	B5	0 (0.0)	0 (0.0)	2 (16.7)	3 (8.3)	5 (10.4)	5 (2.9)	NA	0.034	0.032	0.002
	B7	3 (4.9)	2 (3.2)	0 (0.0)	3 (8.3)	3 (6.3)	8 (4.7)	NS	NS	NS	NS
Total genotype B		46 (75.4)	44 (71.0)	10 (83.3)	26 (72.2)	36 (75.0)	126 (73.7)	NS	NS	NS	NS
C	C1	12 (19.7)	13 (21.0)	2 (16.7)	10 (27.8)	12 (25.0)	37 (21.6)	NS	NS	NS	NS
	C2	1 (1.6)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (0.6)	NS	NS	NA	NS
	C3	2 (3.3)	5 (8.1)	0 (0.0)	0 (0.0)	0 (0.0)	7 (4.1)	NS	NS	NS	NS
Total genotype C		15 (24.6)	18 (29.0)	2 (16.7)	10 (27.8)	12 (25.0)	45 (26.3)	NS	NS	NS	NS
No. HBV genotype B/C (%-B)		46/15 (75.4)	44/18 (71.0)	10/2 (83.3)	26/10 (72.2)	36/12 (75.0)	126/45 (73.7)	NS	NS	NS	NS
Genotype and serotype
B	adw	0 (0.0)	0 (0.0)	0 (0.0)	1 (2.8)	1 (2.1)	1 (0.6)	NA	NS	NS	NS
	adw2	38 (62.3)	39 (62.9)	9 (75.0)	21 (58.3)	30 (62.5)	107 (62.6)	NS	NS	NS	NS
	adw3	3 (4.9)	1 (1.6)	0 (0.0)	0 (0.0)	0 (0.0)	4 (2.3)	NS	NS	NS	NS
	ayw	0 (0.0)	1 (1.6)	0 (0.0)	1 (2.8)	1 (2.1)	2 (1.2)	NS	NS	NS	NS
	ayw1	5 (8.2)	3 (4.8)	0 (0.0)	4 (11.1)	4 (8.3)	12 (7.0)	NS	NS	NS	NS
C	adrq+	14 (23.0)	17 (27.4)	2 (16.7)	9 (25.0)	11 (22.9)	42 (24.6)	NS	NS	NS	NS
	adw2	0 (0.0)	1 (1.6)	0 (0.0)	1 (2.8)	1 (2.1)	2 (1.2)	NS	NS	NS	NS
	ayr	1 (1.6)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (0.6)	NS	NS	NA	NS

CH: Chronic hepatitis; LC: Liver cirrhosis; HCC: Hepatocellular carcinoma; NS: Not significant; NA: Not applicable; HBV: Hepatitis B virus.

Table 3 Frequencies of some HBx mutations in HBV genotype B according to different clinical diagnosis

Amino acid substitutions	n(%) in each clinical diagnosis
	CH (n = 46)	LC (n = 44)	HCC			Total (n = 126)	P
	CH (n = 46)	LC (n = 44)	With LC (n = 10)	Without LC (n = 26)	All HCC (n = 36)	Total (n = 126)	CH vs LC	CH vs All HCC	LC vs All HCC	CH vs LC vs All HCC
T118N	23 (50.0)	6 (13.6)	4 (40.0)	7 (26.9)	11 (30.6)	40 (31.7)	< 0.001	NS	NS	0.028
I127N/T/S	5 (10.9)	16 (36.4)	2 (20.0)	2 (7.7)	4 (11.1)	25 (19.8)	0.009	NS	0.019	NS
K130M	8 (17.4)	23 (52.3)	5 (50.0)	11 (42.3)	16 (44.4)	47 (37.3)	0.001	0.015	NS	0.006
V131I	8 (17.4)	22 (50.0)	4 (40.0)	11 (42.3)	15 (41.6)	45 (35.7)	0.002	0.030	NS	0.012

Table 4 Prevalence of HBx and core promoter mutations in samples with different clinical diagnosis

Characteristics	n(%) in each clinical diagnosis
	CH (n = 61)	LC (n = 62)	HCC			Total (n = 171)	P
	CH (n = 61)	LC (n = 62)	With LC (n = 12)	Without LC (n = 36)	All HCC (n = 48)	Total (n = 171)	CH vs LC	CH vs All HCC	LC vs All HCC	CH vs LC vs All HCC
Genotype B/C (%B)	46/15 (75.4)	44/18 (71.0)	10/2 (83.3)	26/10 (72.2)	36/12 (75.0)	126/45 (73.7)	NS	NS	NS	NS
BCP mutations
C1726A/T1727(C/T)	24 (39.3)	8 (12.9)	4 (33.3)	7 (19.4)	11 (22.9)	43 (34.1)	0.002	NS	0.015	0.003
T1753V	11 (18.0)	29 (46.8)	2 (16.7)	9 (25.0)	11 (22.9)	51 (40.5)	0.015	NS	0.018	0.004
A1762T	12 (19.7)	38 (61.3)	6 (50.0)	21 (58.3)	27 (56.3)	77 (61.1)	< 0.001	< 0.001	NS	< 0.001
G1764A	13 (21.3)	38 (61.3)	5 (41.7)	21 (58.3)	26 (54.2)	77 (61.1)	< 0.001	0.0002	NS	< 0.001
C1766T	1 (1.6)	3 (4.8)	1 (8.3)	1 (2.8)	2 (4.2)	6 (4.8)	NS	NS	NS	NS
T1768A	1 (1.6)	2 (3.2)	1 (8.3)	2 (5.6)	3 (6.3)	6 (4.8)	NS	NS	NS	NS
A1762T/G1764A	12 (19.7)	37 (59.7)	5 (41.7)	21 (58.3)	26 (54.2)	75 (59.5)	< 0.001	0.0004	NS	< 0.001

Table 5 Single nucleotide polymorphisms in 1726/1727 of HBV Genotype B and C

SNP	n(%) in each HBV genotype and clinical diagnosis
	Genotype B						Genotype C
	CH (n = 46)	LC (n = 44)	HCC			P	CH (n = 15)	LC (n = 18)	HCC			P
	CH (n = 46)	LC (n = 44)	With LC (n = 10)	Without LC (n = 26)	All HCC (n = 36)	P	CH (n = 15)	LC (n = 18)	With LC (n = 2)	Without LC (n = 10)	All HCC (n = 12)	P
1726A	24 (52.2)	9 (20.5)	4 (40.0)	8 (30.8)	11 (33.3)	0.009	13 (86.7)	13 (72.2)	2 (100.0)	7 (70.0)	9 (75.0)	NS
1726C	19 (41.3)	35 (79.5)	6 (60.0)	18 (69.2)	24 (66.7)	0.001	2 (13.3)	5 (27.8)	0 (0.0)	3 (30.0)	4 (33.3)	NS
1726T	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	NS	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	NA
1727A	1 (2.2)	2 (4.5)	0 (0.0)	0 (0.0)	0 (0.0)	NS	8 (53.3)	11 (61.1)	2 (100.0)	2 (20.0)	4 (33.3)	NS
1727C	0 (0.0)	1 (2.3)	0 (0.0)	0 (0.0)	0 (0.0)	NS	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	NA
1727G	1 (2.2)	2 (4.5)	0 (0.0)	1 (3.8)	1 (2.8)	NS	4 (26.7)	2 (11.1)	0 (0.0)	5 (50.0)	5 (41.7)	NS
1727T	44 (95.7)	39 (88.6)	10 (100.0)	25 (96.2)	35 (97.2)	NS	3 (20.0)	5 (27.8)	0 (0.0)	3 (30.0)	3 (25.0)	NS
1726A/1727A	1 (2.2)	1 (2.3)	0 (0.0)	0 (0.0)	0 (0.0)	NS	7 (46.7)	10 (55.6)	2 (100.0)	2 (20.0)	4 (33.3)	NS
1726A/1727G	1 (2.2)	1 (2.3)	0 (0.0)	1 (3.8)	1 (2.8)	NS	4 (26.7)	2 (11.1)	0 (0.0)	5 (50.0)	5 (41.7)	NS
1726A/1727T	22 (47.8)	7 (15.9)	4 (40.0)	7 (26.9)	11 (30.6)	0.007	2 (13.3)	1 (5.6)	0 (0.0)	0 (0.0)	0 (0.0)	NS
1726C/1727A	0 (0.0)	1 (2.3)	0 (0.0)	0 (0.0)	0 (0.0)	NS	1 (6.7)	1 (5.6)	0 (0.0)	0 (0.0)	0 (0.0)	NS
1726C/1727G	0 (0.0)	1 (2.3)	0 (0.0)	0 (0.0)	0 (0.0)	NS	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	NA
1726C/1727T	19 (41.3)	32 (72.7)	6 (60.0)	18 (69.2)	24 (66.7)	0.006	1 (6.7)	4 (22.2)	0 (0.0)	3 (30.0)	3 (25.0)	NS

Table 6 Comparison of core promoter mutations in HBV genotype B and C

Characteristics	HBV genotype			P
Characteristics	B	C	All	P
No. (%) of patients	126 (73.7)	45 (26.3)	171 (100.0)	< 0.001
Age (mean ± SD)	44.3 ± 12.8	49.4 ± 13.3	45.6 ± 13.1	0.024
Male/Female (%Male)	95/31 (75.4)	32/13 (71.1)	127/44 (74.3)	NS
No. (%) of A1762T/G1764A	42 (33.3)	33 (73.3)	75 (43.9)	< 0.001
No. (%) of T1753V	26 (20.6)	25 (55.6)	51 (29.8)	< 0.001
No. (%) of C1726A/T1727 (C/T)	40 (31.7)	3 (6.7)	43 (25.1)	0.002

Citation: Utama A, Purwantomo S, Siburian MD, Dhenni R, Gani RA, Hasan I, Sanityoso A, Miskad UA, Akil F, Yusuf I, Achwan WA, Soemohardjo S, Lelosutan SA, Martamala R, Lukito B, Budihusodo U, Lesmana LA, Sulaiman A, Tai S. Hepatitis B virus subgenotypes and basal core promoter mutations in Indonesia. World J Gastroenterol 2009; 15(32): 4028-4036
URL: https://www.wjgnet.com/1007-9327/full/v15/i32/4028.htm
DOI: https://dx.doi.org/10.3748/wjg.15.4028