Predictive factors for interferon and ribavirin combination therapy in patients with chronic hepatitis C

Table 1 Primer sequences used to amplify ISDR and PePHD

Region	Primer direction	Sequence (5’ to 3’)	Nucleotide No
ISDR	Outer sense	TGGATGGAGTGCGGTTGCACAGGTA	6703-6727
	Outer antisense	TGTAAAACGACGGCCAG	7296-7320
	Inner sense	TCTTTCTCCGTGGAGGTGGTATTGC	6722-6741
	Inner antisense	CAGGAAACAGCTATGACC	7275-7294
PePHD	Outer sense	TGACTACCCATACAGGCTCT	2180-2199
	Outer antisense	AAGGAAGGAGAGATTGCCAT	2725-2744
	Inner sense	AAGGTTAGGATGTATGTGGG	2238-2257
	Inner antisense	ATTGAGGACCACCGAGTTCT	2689-2708

ISDR: Interferon sensitivity determining region; PePHD: PKR-eIF2α phosphorylation homology domain; PKR: RNA-activated protein kinase.

Table 2 Characteristics of the complete response group patients before IFN-α and ribavirin combination therapy

	Age(yr)	Sex	ALT	Transfusionhistory1	HCV RNAtiter2	ISDRType3	No. of AminoAcid Mutationsof PePHD
A-1	50	M	178	×	3.92	1	0
A-2	49	F	135	○	3.27	1	1
A-3	40	M	106	×	4.16	1	1
A-4	45	M	218	○	5.48	1	0
A-5	51	F	92	×	4.04	1	0
A-6	41	M	143	×	3.75	2	0
A-7	56	F	167	×	4.24	2	0
A-8	58	M	86	×	5.26	2	0
A-9	49	M	99	○	5.12	2	1
A-10	40	F	129	○	4.41	2	0
A-11	54	F	201	×	3.73	2	1
A-12	53	M	179	×	4.21	2	1
A-13	52	M	234	×	4.25	2	0
A-14	47	M	311	×	5.11	2	0
A-15	49	M	86	×	6.12	3	1
A-16	53	F	220	×	5.91	3	0
A-17	47	F	194	×	4.82	3	0
A-18	49	M	246	×	5.44	3	1
A-19	51	M	441	○	5.22	3	2
A-20	47	F	305	○	4.85	3	0
A-21	55	M	119	×	3.73	3	0

ISDR: Interferon sensitivity determining region; PePHD: PKR-eIF2α phosphorylation homology domain.

¹○ indicates history of transfusion and × indicates no history of transfusion.

²The unit of HCV RNA titer before treatment (log copies/mL).

³ISDR type: 1 (wild type, no amino acid substitution), 2 (intermediate type, 1-3 amino acid substitutions), 3 (mutant type, ≥ 4 amino acid substitutions).

Table 3 Characteristics of the no-response group patients before IFN-α and ribavirin combination therapy

	Age(yr)	Sex	ALT	Transfusionhistory1	HCV RNAtiter2	ISDRtype3	No. of AminoAcid Mutationsof PePHD
B-1	53	M	185	×	5.25	1	0
B-2	48	M	320	×	6.11	1	0
B-3	44	F	125	○	4.88	1	0
B-4	49	F	175	×	5.72	1	0
B-5	54	M	151	○	6.21	1	0
B-6	58	F	190	×	5.14	1	0
B-7	62	F	212	×	6.35	1	0
B-8	64	M	252	○	7.11	1	0
B-9	45	M	145	×	6.82	1	0
B-10	49	M	138	×	4.95	1	0
B-11	42	F	120	○	5.54	1	0
B-12	55	M	95	×	6.25	1	0
B-13	53	M	142	×	6.73	1	0
B-14	55	F	185	×	6.76	1	0
B-15	57	M	258	×	4.85	1	0
B-16	53	F	175	○	6.33	2	0
B-17	49	M	241	×	5.81	2	0
B-18	44	M	183	×	6.32	2	0
B-19	59	F	167	×	5.89	2	0
B-20	54	M	171	○	6.14	2	0
B-21	52	F	217	×	6.23	2	0
B-22	55	M	222	×	5.88	2	0
B-23	63	F	235	×	6.32	2	0
B-24	47	F	161	×	6.47	2	0
B-25	51	M	96	○	5.31	2	0
B-26	54	F	80	×	5.85	2	0
B-27	55	F	192	○	6.42	3	0
B-28	58	M	234	×	5.93	3	0
B-29	48	M	341	×	4.98	3	0

ALT: Alanine aminotransferase; ISDR: Interferon sensitivity determining region.

¹○ indicates history of transfusion and × indicates no history of transfusion.

²The unit of HCV RNA titer before treatment (log copies/mL).

³ISDR type: 1 (wild type, no amino acid substitution), 2 (intermediate type, 1-3 amino acid substitutions), 3 (mutant type, ≥ 4 amino acid substitutions).

Table 4 Statistical analysis of age, ALT and HCV RNA titer before treatment

Group	Male:Female	Age (yr)	ALT	HCV RNA titerbefore treatment
A	13:08	49.3 ± 5.0a	185.2 ± 89.1	4.62 ± 0.80b
B	16:13	52.8 ± 5.7a	186.5 ± 61.7	5.95 ± 0.61b

ALT: Alanine aminotransferase. The data of age, ALT and HCV RNA titer before treatment are shown in mean ± SD. A: Complete response group. B: No-response group.

^aP = 0.032 between A and B.

^bP = 0.001 between A and B.

Table 5 Logistic regression analysis of ISDR

ISDR type1	Crude OR	95% CI	Adjusted OR2	95% CI2
Wild	1.00		1.00
Intermediate	2.46	0.64-9.39	3.57	0.66-19.36
Mutant	7.00	1.29-37.91	9.67	1.16-80.65

¹ISDR wild type had no mutation. Intermediate type had 1-3 mutations and mutant type had more than 4 mutations.

²After adjustment for age and HCV RNA titer before treatment. OR: Odds ratio; 95% CI: 95% confidence interval.