|
1
|
Wu X, Zhang Z, Zhang L, Daniels DJ. Role of cytomegalovirus in glioblastoma development: promoter or culprit? Virol J 2025; 22:194. [PMID: 40514716 PMCID: PMC12164097 DOI: 10.1186/s12985-025-02826-3] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/02/2025] [Accepted: 06/07/2025] [Indexed: 06/16/2025] Open
Abstract
Glioblastoma is the most common primary malignant tumor of the central nervous system, with a median survival of less than two years. While the etiology of glioblastoma is unclear, viral infection has emerged as a potential contributing factor. Cytomegalovirus (CMV) was first reported to be associated with glioblastoma in 2002. Since then, many studies have detected CMV in glioblastoma tissues suggesting it may plays a role in the glioblastoma progression. While there is no direct evidence confirmings CMV as an oncogenic virus, studies have demonstrated that CMV promotes glioblastoma development in cell and animal models, with several CMV-related genes implicated in tumorigenesis. Importantly, adjuvant CMV antiviral therapy has been proven to improve glioblastoma patient survival. This review focuses on clinical studies regarding the relationship between CMV and glioblastoma, the mechanism of CMV in tumorigenesis, advances in animal models of CMV-induced glioblastoma, and key directions for future investigations.
Collapse
Affiliation(s)
- Xiaoxin Wu
- State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, National Clinical Research Centre for Infectious Diseases, the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, 310003, Zhejiang, China.
- Department of Neurologic Surgery, Mayo Clinic, Rochester, MN, 55905, USA.
| | - Zhengyu Zhang
- Medical Records Department, the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, 310003, Zhejiang, China
| | - Liang Zhang
- Department of Neurologic Surgery, Mayo Clinic, Rochester, MN, 55905, USA
| | - David J Daniels
- Department of Neurologic Surgery, Mayo Clinic, Rochester, MN, 55905, USA.
- Department of Molecular Pharmacology and Experimental Therapeutics, Mayo Clinic, Rochester, MN, 55905, USA.
| |
Collapse
|
|
2
|
Dunn DM, Pack LJ, Munger JC. RAF1 promotes successful human cytomegalovirus replication and is regulated by AMPK-mediated phosphorylation during infection. J Virol 2025; 99:e0186624. [PMID: 39902964 PMCID: PMC11915854 DOI: 10.1128/jvi.01866-24] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/24/2024] [Accepted: 12/03/2024] [Indexed: 02/06/2025] Open
Abstract
RAF1 is a key player in growth factor receptor signaling, which has been linked to multiple viral infections, including human cytomegalovirus (HCMV) infection. Although HCMV remains latent in most individuals, it can cause acute infection in immunocompromised populations, such as transplant recipients, neonates, and cancer patients. Current treatments are suboptimal, highlighting the need for novel therapies. Multiple points in the growth factor signaling pathway are important for HCMV infection, but the relationship between HCMV and RAF1, a component of the mitogen-activated protein kinase (MAPK) cascade, is not well understood. The AMP-activated protein kinase (AMPK) is a known regulator of RAF1, and AMPK activity is induced by HCMV infection, which is important for productive HCMV replication. Our data indicate that HCMV infection induces AMPK-specific changes in RAF1 protein phosphorylation, including increasing phosphorylation at RAF1-Ser621, a known AMPK phospho-site, which results in increased binding to the 14-3-3 scaffolding protein, an important aspect of RAF1 protein activation. Inhibition of RAF1, either pharmacologically or via shRNA or CRISPR-mediated targeting, inhibits viral replication and spread in both fibroblasts and epithelial cells. Collectively, our data indicate that HCMV infection and AMPK activation modulate RAF1 activity, which is important for viral replication. IMPORTANCE Human cytomegalovirus (HCMV) infection is a widespread infection impacting approximately 60-90% of the global population. Although latent in healthy individuals, acute infection in immunocompromised populations, such as neonates, transplant recipients, and cancer patients, can result in retinal and gastrointestinal problems, hearing loss, and even death. Current antivirals are suboptimal due to the development of viral resistance or toxicity in patients, highlighting the need for novel treatments. Our research suggests a new potential target, RAF1, which is a regulator of cellular growth and proliferation. We find that RAF1 is phosphorylated by AMP-activated protein kinase, and that inhibition of RAF1 negatively impacts viral infection. Furthermore, drugs currently used to treat certain cancers also inhibit RAF1 and may have an additional anti-HCMV therapeutic effect in HCMV-susceptible cancer patients.
Collapse
Affiliation(s)
- Diana M. Dunn
- Department of Biochemistry and Biophysics, University of Rochester, Rochester, New York, USA
| | - Ludia J. Pack
- Department of Biochemistry and Biophysics, University of Rochester, Rochester, New York, USA
| | - Joshua C. Munger
- Department of Biochemistry and Biophysics, University of Rochester, Rochester, New York, USA
| |
Collapse
|
|
3
|
Blanco R, Muñoz JP. Human Cytomegalovirus Infection and Breast Cancer: A Literature Review of Clinical and Experimental Data. BIOLOGY 2025; 14:174. [PMID: 40001942 PMCID: PMC11851556 DOI: 10.3390/biology14020174] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Subscribe] [Scholar Register] [Received: 10/31/2024] [Revised: 12/05/2024] [Accepted: 12/09/2024] [Indexed: 02/27/2025]
Abstract
Breast cancer (BC) remains a significant global health challenge, highlighting the need for continued research into novel risk factors, diagnostic approaches, and personalized treatments. Among emerging risk factors, viral infections have been implicated as potential contributors to breast carcinogenesis and BC progression. Recent evidence suggests that specific oncogenic strains of human cytomegalovirus (HCMV) may have the capacity to transform human mammary epithelial cells. This review assesses clinical data regarding HCMV presence in both tumor and non-tumor breast tissues, examining the role of HCMV oncoproteins in BC development and progression. Current findings indicate a higher prevalence of HCMV infection in breast carcinomas compared to non-tumor tissues, associated with an elevated risk of BC. Additionally, the HCMV-driven breast carcinogenesis model proposed here suggests that HCMV oncoproteins may activate multiple oncogenic pathways, fostering cell proliferation, survival, and tumor development. A deeper understanding of the role of HCMV in BC could enhance risk stratification and support the creation of targeted therapeutic strategies.
Collapse
Affiliation(s)
| | - Juan P. Muñoz
- Laboratorio de Bioquímica, Departamento de Química, Facultad de Ciencias, Universidad de Tarapacá, Arica 1000007, Chile
| |
Collapse
|
|
4
|
Ohman MS, Albright ER, Gelbmann CB, Kalejta RF. The Pentamer glycoprotein complex inhibits viral Immediate Early transcription during Human Cytomegalovirus infections. Proc Natl Acad Sci U S A 2024; 121:e2408078121. [PMID: 39292744 PMCID: PMC11441559 DOI: 10.1073/pnas.2408078121] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/22/2024] [Accepted: 08/16/2024] [Indexed: 09/20/2024] Open
Abstract
The Pentamer complex of Human Cytomegalovirus (HCMV) consists of the viral glycoproteins gH, gL, UL128, UL130, and UL131 and is incorporated into infectious virions. HCMV strains propagated extensively in vitro in fibroblasts carry UL128, UL130, or UL131 alleles that do not make a functional complex and thus lack Pentamer function. Adding functional Pentamer to such strains decreases virus growth in fibroblasts. Here, we show that the Pentamer inhibits productive HCMV replication in fibroblasts by repressing viral Immediate Early (IE) transcription. We show that ectopic expression of the viral IE1 protein, a target of Pentamer-mediated transcriptional repression, complements the growth defect of a Pentamer-positive virus. Furthermore, we show that the Pentamer also represses viral IE transcription in cell types where HCMV in vitro latency is studied. Finally, we identify UL130 as a functional subunit of the Pentamer for IE transcriptional repression and demonstrate that cyclic AMP Response Element (CRE) and NFkB sites within the Major Immediate Early Promoter that drives IE1 transcription contribute to this repression. We conclude that the HCMV Pentamer represses viral IE transcription.
Collapse
Affiliation(s)
- Michael S. Ohman
- Institute for Molecular Virology and McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, WI53706
| | - Emily R. Albright
- Institute for Molecular Virology and McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, WI53706
| | - Christopher B. Gelbmann
- Institute for Molecular Virology and McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, WI53706
| | - Robert F. Kalejta
- Institute for Molecular Virology and McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, WI53706
| |
Collapse
|
|
5
|
Walter RM, Majumder K, Kalejta RF. ATRX restricts Human Cytomegalovirus (HCMV) viral DNA replication through heterochromatinization and minimizes unpackaged viral genomes. PLoS Pathog 2024; 20:e1012516. [PMID: 39236084 PMCID: PMC11407672 DOI: 10.1371/journal.ppat.1012516] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/01/2024] [Revised: 09/17/2024] [Accepted: 08/20/2024] [Indexed: 09/07/2024] Open
Abstract
ATRX limits the accumulation of human cytomegalovirus (HCMV) Immediate Early (IE) proteins at the start of productive, lytic infections, and thus is a part of the cell-intrinsic defenses against infecting viruses. ATRX is a chromatin remodeler and a component of a histone chaperone complex. Therefore, we hypothesized ATRX would inhibit the transcription of HCMV IE genes by increasing viral genome heterochromatinization and decreasing its accessibility. To test this hypothesis, we quantitated viral transcription and genome structure in cells replete with or depleted of ATRX. We found ATRX did indeed limit viral IE transcription, increase viral genome chromatinization, and decrease viral genome accessibility. The inhibitory effects of ATRX extended to Early (E) and Late (L) viral protein accumulation, viral DNA replication, and progeny virion output. However, we found the negative effects of ATRX on HCMV viral DNA replication were independent of its effects on viral IE and E protein accumulation but correlated with viral genome heterochromatinization. Interestingly, the increased number of viral genomes synthesized in ATRX-depleted cells were not efficiently packaged, indicating the ATRX-mediated restriction to HCMV viral DNA replication may benefit productive infection by increasing viral fitness. Our work mechanistically describes the antiviral function of ATRX and introduces a novel, pro-viral role for this protein, perhaps explaining why, unlike during infections with other herpesviruses, it is not directly targeted by a viral countermeasure in HCMV infected cells.
Collapse
Affiliation(s)
- Ryan M. Walter
- Institute for Molecular Virology and McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, Wisconsin, United States of America
| | - Kinjal Majumder
- Institute for Molecular Virology and McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, Wisconsin, United States of America
| | - Robert F. Kalejta
- Institute for Molecular Virology and McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, Wisconsin, United States of America
| |
Collapse
|
|
6
|
Yang X, Jiang S, Liu F, Li Z, Liu W, Zhang X, Nan F, Li J, Yu M, Wang Y, Wang B. HCMV IE1/IE1mut Therapeutic Vaccine Induces Tumor Regression via Intratumoral Tertiary Lymphoid Structure Formation and Peripheral Immunity Activation in Glioblastoma Multiforme. Mol Neurobiol 2024; 61:5935-5949. [PMID: 38261253 PMCID: PMC11249408 DOI: 10.1007/s12035-024-03937-8] [Citation(s) in RCA: 5] [Impact Index Per Article: 5.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/01/2023] [Accepted: 01/07/2024] [Indexed: 01/24/2024]
Abstract
Glioblastoma multiforme (GBM), a highly malignant invasive brain tumor, is associated with poor prognosis and survival and lacks an effective cure. High expression of the human cytomegalovirus (HCMV) immediate early protein 1 (IE1) in GBM tissues is strongly associated with their malignant progression, presenting a novel target for therapeutic strategies. Here, the bioluminescence imaging technology revealed remarkable tumor shrinkage and improved survival rates in a mouse glioma model treated with HCMV IE1/IE1mut vaccine. In addition, immunofluorescence data demonstrated that the treated group exhibited significantly more and larger tertiary lymphoid structures (TLSs) than the untreated group. The presence of TLS was associated with enhanced T cell infiltration, and a large number of proliferating T cells were found in the treated group. Furthermore, the flow cytometry results showed that in the treatment group, cytotoxic T lymphocytes exhibited partial polarization toward effector memory T cells and were activated to play a lethal role in the peripheral immunological organs. Furthermore, a substantial proportion of B cells in the draining lymph nodes expressed CD40 and CD86. Surprisingly, quantitative polymerase chain reaction indicated that a high expression of cytokines, including chemokines in brain tumors and immune tissues, induced the differentiation, development, and chemokine migration of immune cells in the treated group. Our study data demonstrate that IE1 or IE1mut vaccination has a favorable effect in glioma mice models. This study holds substantial implications for identifying new and effective therapeutic targets within GBM.
Collapse
Affiliation(s)
- Xiaoli Yang
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China
| | - Shasha Jiang
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China
| | - Fengjun Liu
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China
| | - Zonghui Li
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China
| | - Wenxuan Liu
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China
| | - Xianjuan Zhang
- Department of Clinical Laboratory, The Affiliated Hospital of Qingdao University, Qingdao, People's Republic of China
| | - Fulong Nan
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China
| | - Jun Li
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China
| | - Meng Yu
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China
| | - Yunyang Wang
- Department of Endocrinology and Metabolism, Affiliated Hospital of Qingdao University, Qingdao, China.
| | - Bin Wang
- Department of Pathogenic Biology, School of Basic Medicine, Qingdao University, Qingdao, China.
| |
Collapse
|
|
7
|
Maliano MR, Yetming KD, Kalejta RF. Triple lysine and nucleosome-binding motifs of the viral IE19 protein are required for human cytomegalovirus S-phase infections. mBio 2024; 15:e0016224. [PMID: 38695580 PMCID: PMC11237493 DOI: 10.1128/mbio.00162-24] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/19/2024] [Accepted: 02/29/2024] [Indexed: 06/13/2024] Open
Abstract
Herpesvirus genomes are maintained as extrachromosomal plasmids within the nuclei of infected cells. Some herpesviruses persist within dividing cells, putting the viral genome at risk of being lost to the cytoplasm during mitosis because karyokinesis (nuclear division) requires nuclear envelope breakdown. Oncogenic herpesviruses (and papillomaviruses) avoid genome loss during mitosis by tethering their genomes to cellular chromosomes, thereby ensuring viral genome uptake into newly formed nuclei. These viruses use viral proteins with DNA- and chromatin-binding capabilities to physically link viral and cellular genomes together in a process called tethering. The known viral tethering proteins of human papillomavirus (E2), Epstein-Barr virus (EBNA1), and Kaposi's sarcoma-associated herpesvirus (LANA) each contain two independent domains required for genome tethering, one that binds sequence specifically to the viral genome and another that binds to cellular chromatin. This latter domain is called a chromatin tethering domain (CTD). The human cytomegalovirus UL123 gene encodes a CTD that is required for the virus to productively infect dividing fibroblast cells within the S phase of the cell cycle, presumably by tethering the viral genome to cellular chromosomes during mitosis. The CTD-containing UL123 gene product that supports S-phase infections is the IE19 protein. Here, we define two motifs in IE19 required for S-phase infections: an N-terminal triple lysine motif and a C-terminal nucleosome-binding motif within the CTD.IMPORTANCEThe IE19 protein encoded by human cytomegalovirus (HCMV) is required for S-phase infection of dividing cells, likely because it tethers the viral genome to cellular chromosomes, thereby allowing them to survive mitosis. The mechanism through which IE19 tethers viral genomes to cellular chromosomes is not understood. For human papillomavirus, Epstein-Barr virus, and Kaposi's sarcoma-associated herpesvirus, viral genome tethering is required for persistence (latency) and pathogenesis (oncogenesis). Like these viruses, HCMV also achieves latency, and it modulates the properties of glioblastoma multiforme tumors. Therefore, defining the mechanism through which IE19 tethers viral genomes to cellular chromosomes may help us understand, and ultimately combat or control, HCMV latency and oncomodulation.
Collapse
Affiliation(s)
- Minor R. Maliano
- Institute for Molecular Virology, University of Wisconsin–Madison, Madison, Wisconsin, USA
- McArdle Laboratory for Cancer Research, University of Wisconsin–Madison, Madison, Wisconsin, USA
| | - Kristen D. Yetming
- Institute for Molecular Virology, University of Wisconsin–Madison, Madison, Wisconsin, USA
- McArdle Laboratory for Cancer Research, University of Wisconsin–Madison, Madison, Wisconsin, USA
- Molecular Biology, Charles River Laboratories, Wayne, Pennsylvania, USA
| | - Robert F. Kalejta
- Institute for Molecular Virology, University of Wisconsin–Madison, Madison, Wisconsin, USA
- McArdle Laboratory for Cancer Research, University of Wisconsin–Madison, Madison, Wisconsin, USA
| |
Collapse
|
|
8
|
Trivic A, Milovanovic J, Kablar D, Tomic A, Folic M, Jotic A, Tomanovic N, Tomic AM, Djoric I, Jankovic M. Friend or Foe? Exploring the Role of Cytomegalovirus (HCMV) Infection in Head and Neck Tumors. Biomedicines 2024; 12:872. [PMID: 38672226 PMCID: PMC11048144 DOI: 10.3390/biomedicines12040872] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/05/2024] [Revised: 03/27/2024] [Accepted: 04/03/2024] [Indexed: 04/28/2024] Open
Abstract
Although not regarded as an oncogenic pathogen, the human cytomegalovirus (HCMV) has been associated with a wide array of malignancies. Conversely, a number of studies report on possible anti-tumor properties of the virus, apparently mediated via HCMV-galvanized T-cell tumor killing; these were recently being investigated in clinical trials for the purposes of anti-cancer treatment by means of dendritic cell vaccines and HCMV-specific cytotoxic T cells. In the present study, we have analyzed the relation between a complement of head-and-neck tumors and HCMV infection across 73 countries worldwide using Spearman correlation, univariate and multivariate regression analysis. Intriguingly, HCMV was found to be pro-oncogenic in patients with nasopharyngeal carcinoma; contrarywise, the virus manifested an inverse (i.e., anti-tumor) association with the tumors of the lip/oral region and the salivary glands. Although this putative protective effect was noted initially for thyroid neoplasia and hypopharyngeal tumors as well, after multivariate regression analysis the connection did not hold. There was no association between laryngeal cancer and HCMV infection. It would appear that, depending on the tissue, HCMV may exert both protective and oncogenic effects. The globally observed protective feature of the virus could potentially be utilized in future therapeutic approaches for salivary tumors and neoplasia in the lip/oral region. As correlation does not necessarily imply causation, more in-depth molecular analyses from comprehensive clinical studies are warranted to substantiate our findings.
Collapse
Affiliation(s)
- Aleksandar Trivic
- Clinic for Otorhinolaryngology and Maxillofacial Surgery, University Clinical Center of Serbia, 2 Pasterova Street, 11000 Belgrade, Serbia; (A.T.); (J.M.); (M.F.); (A.J.)
- Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (N.T.); (A.M.T.); (I.D.)
| | - Jovica Milovanovic
- Clinic for Otorhinolaryngology and Maxillofacial Surgery, University Clinical Center of Serbia, 2 Pasterova Street, 11000 Belgrade, Serbia; (A.T.); (J.M.); (M.F.); (A.J.)
- Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (N.T.); (A.M.T.); (I.D.)
| | - Djurdjina Kablar
- Department for Pathology, Pathohistology and Medical Cytology, University Clinical Centre of Serbia, 11000 Belgrade, Serbia;
| | - Ana Tomic
- Center for Radiology Imaging, University Clinical Center of Serbia, 2 Pasterova Street, 11000 Belgrade, Serbia;
| | - Miljan Folic
- Clinic for Otorhinolaryngology and Maxillofacial Surgery, University Clinical Center of Serbia, 2 Pasterova Street, 11000 Belgrade, Serbia; (A.T.); (J.M.); (M.F.); (A.J.)
- Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (N.T.); (A.M.T.); (I.D.)
| | - Ana Jotic
- Clinic for Otorhinolaryngology and Maxillofacial Surgery, University Clinical Center of Serbia, 2 Pasterova Street, 11000 Belgrade, Serbia; (A.T.); (J.M.); (M.F.); (A.J.)
- Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (N.T.); (A.M.T.); (I.D.)
| | - Nada Tomanovic
- Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (N.T.); (A.M.T.); (I.D.)
- Institute of Pathology, 1 Dr. Subotica Street, 11000 Belgrade, Serbia
| | - Ana Marija Tomic
- Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (N.T.); (A.M.T.); (I.D.)
- Institute of Pathology, 1 Dr. Subotica Street, 11000 Belgrade, Serbia
| | - Igor Djoric
- Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (N.T.); (A.M.T.); (I.D.)
- Clinic of Neurosurgery, University Clinical Center of Serbia, Institute of Radiology, 4 Dr. Koste Todorovića Street, 11000 Belgrade, Serbia
| | - Marko Jankovic
- Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (N.T.); (A.M.T.); (I.D.)
- Department of Virology, Institute of Microbiology and Immunology, 1 Dr. Subotica Street, 11000 Belgrade, Serbia
| |
Collapse
|
|
9
|
Jankovic M, Knezevic T, Tomic A, Milicevic O, Jovanovic T, Djunic I, Mihaljevic B, Knezevic A, Todorovic-Balint M. Human Cytomegalovirus Oncoprotection across Diverse Populations, Tumor Histologies, and Age Groups: The Relevance for Prospective Vaccinal Therapy. Int J Mol Sci 2024; 25:3741. [PMID: 38612552 PMCID: PMC11012084 DOI: 10.3390/ijms25073741] [Citation(s) in RCA: 2] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/31/2024] [Revised: 03/18/2024] [Accepted: 03/22/2024] [Indexed: 04/14/2024] Open
Abstract
The oncogenicity of the human cytomegalovirus (CMV) is currently being widely debated. Most recently, mounting clinical evidence suggests an anti-cancer effect via CMV-induced T cell-mediated tumor destruction. However, the data were mostly obtained from single-center studies and in vitro experiments. Broad geographic coverage is required to offer a global perspective. Our study examined the correlation between country-specific CMV seroprevalence (across 73 countries) and the age-standardized incidence rate (of 34 invasive tumors). The populations studied were stratified according to decadal age periods as the immunologic effects of CMV seropositivity may depend upon age at initial infection. The International Agency for Research on Cancer of the World Health Organization (IARC WHO) database was used. The multivariate linear regression analysis revealed a worldwide inverse correlation between CMV seroprevalence and the incidences of 62.8% tumors. Notably, this inverse link persists for all cancers combined (Spearman's ρ = -0.732, p < 0.001; β = -0.482, p < 0.001, adjusted R2 = 0.737). An antithetical and significant correlation was also observed in particular age groups for the vast majority of tumors. Our results corroborate the conclusions of previous studies and indicate that this oncopreventive phenomenon holds true on a global scale. It applies to a wide spectrum of cancer histologies, additionally supporting the idea of a common underlying mechanism-CMV-stimulated T cell tumor targeting. Although these results further advance the notion of CMV-based therapies, in-depth investigation of host-virus interactions is still warranted.
Collapse
Affiliation(s)
- Marko Jankovic
- Department of Virology, Institute of Microbiology and Immunology, 1 Dr Subotica Street, 11000 Belgrade, Serbia;
- Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia; (T.K.); (A.T.); (O.M.); (I.D.); (B.M.); (M.T.-B.)
| | - Tara Knezevic
- Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia; (T.K.); (A.T.); (O.M.); (I.D.); (B.M.); (M.T.-B.)
| | - Ana Tomic
- Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia; (T.K.); (A.T.); (O.M.); (I.D.); (B.M.); (M.T.-B.)
| | - Ognjen Milicevic
- Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia; (T.K.); (A.T.); (O.M.); (I.D.); (B.M.); (M.T.-B.)
- Institute of Medical Statistics and Informatics, 15 Dr Subotica Street, 11000 Belgrade, Serbia
| | - Tanja Jovanovic
- Institute for Biocides and Medical Ecology, 16 Trebevicka Street, 11000 Belgrade, Serbia;
| | - Irena Djunic
- Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia; (T.K.); (A.T.); (O.M.); (I.D.); (B.M.); (M.T.-B.)
- Clinic of Hematology, University Clinical Centre of Serbia, 2 Dr Koste Todorovica Street, 11000 Belgrade, Serbia
| | - Biljana Mihaljevic
- Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia; (T.K.); (A.T.); (O.M.); (I.D.); (B.M.); (M.T.-B.)
- Clinic of Hematology, University Clinical Centre of Serbia, 2 Dr Koste Todorovica Street, 11000 Belgrade, Serbia
| | - Aleksandra Knezevic
- Department of Virology, Institute of Microbiology and Immunology, 1 Dr Subotica Street, 11000 Belgrade, Serbia;
- Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia; (T.K.); (A.T.); (O.M.); (I.D.); (B.M.); (M.T.-B.)
| | - Milena Todorovic-Balint
- Faculty of Medicine, University of Belgrade, 8 Dr Subotica Street, 11000 Belgrade, Serbia; (T.K.); (A.T.); (O.M.); (I.D.); (B.M.); (M.T.-B.)
- Clinic of Hematology, University Clinical Centre of Serbia, 2 Dr Koste Todorovica Street, 11000 Belgrade, Serbia
| |
Collapse
|
|
10
|
Hotchkiss KM, Batich KA, Mohan A, Rahman R, Piantadosi S, Khasraw M. Dendritic cell vaccine trials in gliomas: Untangling the lines. Neuro Oncol 2023; 25:1752-1762. [PMID: 37289203 PMCID: PMC10547519 DOI: 10.1093/neuonc/noad088] [Citation(s) in RCA: 15] [Impact Index Per Article: 7.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 06/09/2023] Open
Abstract
Glioblastoma is a deadly brain tumor without any significantly successful treatments to date. Tumor antigen-targeted immunotherapy platforms including peptide and dendritic cell (DC) vaccines, have extended survival in hematologic malignancies. The relatively "cold" tumor immune microenvironment and heterogenous nature of glioblastoma have proven to be major limitations to translational application and efficacy of DC vaccines. Furthermore, many DC vaccine trials in glioblastoma are difficult to interpret due to a lack of contemporaneous controls, absence of any control comparison, or inconsistent patient populations. Here we review glioblastoma immunobiology aspects that are relevant to DC vaccines, review the clinical experience with DC vaccines targeting glioblastoma, discuss challenges in clinical trial design, and summarize conclusions and directions for future research for the development of effective DC vaccines for patients.
Collapse
Affiliation(s)
- Kelly M Hotchkiss
- Department of Neurosurgery, The Preston Robert Tisch Brain Tumor Center at Duke, Duke University Medical Center, Durham, North Carolina, USA
| | - Kristen A Batich
- Department of Neurosurgery, The Preston Robert Tisch Brain Tumor Center at Duke, Duke University Medical Center, Durham, North Carolina, USA
| | - Aditya Mohan
- Department of Neurosurgery, The Preston Robert Tisch Brain Tumor Center at Duke, Duke University Medical Center, Durham, North Carolina, USA
| | - Rifaquat Rahman
- Department of Radiation Oncology, Dana-Farber/Brigham and Women’s Cancer Center, Harvard Medical School, Boston, Massachusetts, USA
| | - Steven Piantadosi
- Department of Surgery, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA(S.P.)
| | - Mustafa Khasraw
- Department of Neurosurgery, The Preston Robert Tisch Brain Tumor Center at Duke, Duke University Medical Center, Durham, North Carolina, USA
| |
Collapse
|
|
11
|
Dunn DM, Pack LJ, Munger JC. Raf1 promotes successful Human Cytomegalovirus replication and is regulated by AMPK-mediated phosphorylation during infection. BIORXIV : THE PREPRINT SERVER FOR BIOLOGY 2023:2023.07.26.550702. [PMID: 37546879 PMCID: PMC10402018 DOI: 10.1101/2023.07.26.550702] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Grants] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 08/08/2023]
Abstract
Raf1 is a key player in growth factor receptor signaling, which has been linked to multiple viral infections, including Human Cytomegalovirus (HCMV) infection. Although HCMV remains latent in most individuals, it can cause acute infection in immunocompromised populations such as transplant recipients, neonates, and cancer patients. Current treatments are suboptimal, highlighting the need for novel treatments. Multiple points in the growth factor signaling pathway are important for HCMV infection, but the relationship between HCMV and Raf1, a component of the mitogen-activated protein kinase (MAPK) cascade, is not well understood. The AMP-activated protein kinase (AMPK) is a known regulator of Raf1, and AMPK activity is both induced by infection and important for HCMV replication. Our data indicate that HCMV infection induces AMPK-specific changes in Raf1 phosphorylation, including increasing phosphorylation at Raf1-Ser621, a known AMPK phospho-site, which results in increased binding to the 14-3-3 scaffolding protein, an important aspect of Raf1 activation. Inhibition of Raf1, either pharmacologically or via shRNA or CRISPR-mediated targeting, inhibits viral replication and spread in both fibroblasts and epithelial cells. Collectively, our data indicate that HCMV infection and AMPK activation modulate Raf1 activity, which are important for viral replication.
Collapse
Affiliation(s)
- Diana M. Dunn
- Department of Biochemistry and Biophysics, University of Rochester, Rochester, NY, USA
| | - Ludia J. Pack
- Department of Biochemistry and Biophysics, University of Rochester, Rochester, NY, USA
| | - Joshua C. Munger
- Department of Biochemistry and Biophysics, University of Rochester, Rochester, NY, USA
| |
Collapse
|
|
12
|
Peredo-Harvey I, Bartek J, Ericsson C, Yaiw KC, Nistér M, Rahbar A, Söderberg-Naucler C. Higher Human Cytomegalovirus (HCMV) Specific IgG Antibody Levels in Plasma Samples from Patients with Metastatic Brain Tumors Are Associated with Longer Survival. MEDICINA (KAUNAS, LITHUANIA) 2023; 59:1248. [PMID: 37512060 PMCID: PMC10384986 DOI: 10.3390/medicina59071248] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Subscribe] [Scholar Register] [Received: 05/09/2023] [Revised: 06/04/2023] [Accepted: 06/30/2023] [Indexed: 07/30/2023]
Abstract
Background: Human cytomegalovirus (HCMV) has been detected in tissue samples from patients with glioblastoma but little is known about the systemic immunological response to HCMV in these patients. Objectives: To investigate the presence and clinical significance of HCMV antibodies levels in plasma samples obtained from patients with brain tumors. Materials and Methods: HCMV-specific IgG and IgM antibody levels were determined in 59 plasma samples collected from brain tumor patients included in a prospective study and in 114 healthy individuals. We examined if the levels of HCMV specific antibodies varied in patients with different brain tumor diagnoses compared to healthy individuals, and if antibody levels were predictive for survival time. Results: HCMV specific IgG antibodies were detected by ELISA in 80% and 89% of patients with GBM and astrocytoma grades II-III, respectively, in all samples (100%) from patients with secondary GBM and brain metastases, as well as in 80% of healthy donors (n = 114). All plasma samples were negative for HCMV-IgM. Patients with brain metastases who had higher plasma HCMV-IgG titers had longer survival times (p = 0.03). Conclusions: HCMV specific IgG titers were higher among all brain tumor patient groups compared with healthy donors, except for patients with secondary GBM. Higher HCMV specific IgG levels in patients with brain metastases but not in patients with primary brain tumors were associated with prolonged survival time.
Collapse
Affiliation(s)
- Inti Peredo-Harvey
- Department of Neurosurgery, Karolinska University Hospital, SE-17176 Stockholm, Sweden
- Department of Medicine Solna, Microbial Pathogenesis Unit, BioClinicum, Karolinska Institutet, SE-17164 Solna, Sweden
| | - Jiri Bartek
- Department of Neurosurgery, Karolinska University Hospital, SE-17176 Stockholm, Sweden
- Department of Clinical Neuroscience, Karolinska Institutet, SE-17177 Stockholm, Sweden
- Department of Neurosurgery, Rigshospitalet, DK-2100 Copenhagen, Denmark
| | | | - Koon-Chu Yaiw
- Department of Medicine Solna, Microbial Pathogenesis Unit, BioClinicum, Karolinska Institutet, SE-17164 Solna, Sweden
- Division of Neurology, Karolinska University Hospital, SE-17176 Stockholm, Sweden
| | - Monica Nistér
- Department of Oncology-Pathology, BioClinicum, Karolinska Institutet, SE-17164 Solna, Sweden
| | - Afsar Rahbar
- Department of Medicine Solna, Microbial Pathogenesis Unit, BioClinicum, Karolinska Institutet, SE-17164 Solna, Sweden
- Division of Neurology, Karolinska University Hospital, SE-17176 Stockholm, Sweden
| | - Cecilia Söderberg-Naucler
- Department of Medicine Solna, Microbial Pathogenesis Unit, BioClinicum, Karolinska Institutet, SE-17164 Solna, Sweden
- Division of Neurology, Karolinska University Hospital, SE-17176 Stockholm, Sweden
- Institute of Biomedicine, Infection and Immunology Unit, MediCity Research Laboratory, Turku University, FI-20014 Turku, Finland
| |
Collapse
|
|
13
|
Dong XD, Li Y, Li Y, Sun C, Liu SX, Duan H, Cui R, Zhong Q, Mou YG, Wen L, Yang B, Zeng MS, Luo MH, Zhang H. EphA2 is a functional entry receptor for HCMV infection of glioblastoma cells. PLoS Pathog 2023; 19:e1011304. [PMID: 37146061 DOI: 10.1371/journal.ppat.1011304] [Citation(s) in RCA: 12] [Impact Index Per Article: 6.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/23/2022] [Revised: 05/17/2023] [Accepted: 03/20/2023] [Indexed: 05/07/2023] Open
Abstract
Human cytomegalovirus (HCMV) infection is associated with human glioblastoma, the most common and aggressive primary brain tumor, but the underlying infection mechanism has not been fully demonstrated. Here, we show that EphA2 was upregulated in glioblastoma and correlated with the poor prognosis of the patients. EphA2 silencing inhibits, whereas overexpression promotes HCMV infection, establishing EphA2 as a crucial cell factor for HCMV infection of glioblastoma cells. Mechanistically, EphA2 binds to HCMV gH/gL complex to mediate membrane fusion. Importantly, the HCMV infection was inhibited by the treatment of inhibitor or antibody targeting EphA2 in glioblastoma cells. Furthermore, HCMV infection was also impaired in optimal glioblastoma organoids by EphA2 inhibitor. Taken together, we propose EphA2 as a crucial cell factor for HCMV infection in glioblastoma cells and a potential target for intervention.
Collapse
Affiliation(s)
- Xiao-Dong Dong
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Yan Li
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
- Department of Pathology, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Ying Li
- MOE Key Laboratory of Tropical Disease Control, Shenzhen Centre for Infection and Immunity Studies (CIIS), School of Medicine, Shenzhen Campus of Sun Yat-sen University, Shenzhen, Guangdong, China
| | - Cong Sun
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Shang-Xin Liu
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Hao Duan
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Run Cui
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Qian Zhong
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Yong-Gao Mou
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Le Wen
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
- The Joint Center of Translational Precision Medicine, Guangzhou Institute of Pediatrics, Guangzhou Women and Children Medical Center; Wuhan Institute of Virology, Chinese Academy of Sciences, China
| | - Bo Yang
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
| | - Mu-Sheng Zeng
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Min-Hua Luo
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
| | - Hua Zhang
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
- MOE Key Laboratory of Tropical Disease Control, Shenzhen Centre for Infection and Immunity Studies (CIIS), School of Medicine, Shenzhen Campus of Sun Yat-sen University, Shenzhen, Guangdong, China
| |
Collapse
|
|
14
|
Yang T, Liu D, Fang S, Ma W, Wang Y. Cytomegalovirus and Glioblastoma: A Review of the Biological Associations and Therapeutic Strategies. J Clin Med 2022; 11:jcm11175221. [PMID: 36079151 PMCID: PMC9457369 DOI: 10.3390/jcm11175221] [Citation(s) in RCA: 17] [Impact Index Per Article: 5.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/04/2022] [Revised: 08/07/2022] [Accepted: 08/11/2022] [Indexed: 11/17/2022] Open
Abstract
Glioblastoma is the most common and aggressive malignancy in the adult central nervous system. Cytomegalovirus (CMV) plays a crucial role in the pathogenesis and treatment of glioblastoma. We reviewed the epidemiology of CMV in gliomas, the mechanism of CMV-related carcinogenesis, and its therapeutic strategies, offering further clinical practice insights. To date, the CMV infection rate in glioblastoma is controversial, while mounting studies have suggested a high infection rate. The carcinogenesis mechanism of CMV has been investigated in relation to various aspects, including oncomodulation, oncogenic features, tumor microenvironment regulation, epithelial–mesenchymal transition, and overall immune system regulation. In clinical practice, the incidence of CMV-associated encephalopathy is high, and CMV-targeting treatment bears both anti-CMV and anti-tumor effects. As the major anti-CMV treatment, valganciclovir has demonstrated a promising survival benefit in both newly diagnosed and recurrent glioblastoma as an adjuvant therapy, regardless of surgery and the MGMT promoter methylation state. Immunotherapy, including DC vaccines and adoptive CMV-specific T cells, is also under investigation, and preliminary results have been promising. There are still questions regarding the significance of CMV infection and the carcinogenic mechanism of CMV. Meanwhile, studies have demonstrated the clinical benefits of anti-CMV therapy in glioblastoma. Therefore, anti-CMV therapies are worthy of further recognition and investigation.
Collapse
Affiliation(s)
- Tianrui Yang
- Department of Neurosurgery, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China
| | - Delin Liu
- Department of Neurosurgery, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China
| | - Shiyuan Fang
- Department of Neurology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China
| | - Wenbin Ma
- Department of Neurosurgery, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China
- Correspondence: (W.M.); (Y.W.); Tel.: +86-137-0136-4566 (W.M.); +86-153-1186-0318 (Y.W.)
| | - Yu Wang
- Department of Neurosurgery, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China
- Correspondence: (W.M.); (Y.W.); Tel.: +86-137-0136-4566 (W.M.); +86-153-1186-0318 (Y.W.)
| |
Collapse
|
|
15
|
Ahn J, Shin C, Kim YS, Park JS, Jeun SS, Ahn S. Cytomegalovirus-Specific Immunotherapy for Glioblastoma Treatments. Brain Tumor Res Treat 2022; 10:135-143. [PMID: 35929110 PMCID: PMC9353163 DOI: 10.14791/btrt.2022.0010] [Citation(s) in RCA: 5] [Impact Index Per Article: 1.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/14/2022] [Revised: 05/25/2022] [Accepted: 06/15/2022] [Indexed: 11/20/2022] Open
Abstract
Over the last two decades, numerous studies have investigated the presence of human cytomegalovirus (CMV) within glioblastoma or gliomas; however, the results are severely conflicting. While a few researchers have suggested the potential benefits of cytotoxic T lymphocyte or dendritic cell-based vaccines for recurrent or newly diagnosed glioblastoma patients, several studies did not at all agree with the existence of CMV in glioblastoma cells. In this review, we summarized the conflicting results and issues about the detection of CMV in glioblastoma or glioma patients. We also provided the clinical data of published and unpublished clinical trials using CMV-specific immunotherapy for glioblastomas.
Collapse
Affiliation(s)
- Jaehyun Ahn
- College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Christopher Shin
- College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Yeo Song Kim
- Department of Neurosurgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Jae-Sung Park
- Department of Neurosurgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Sin-Soo Jeun
- Department of Neurosurgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Stephen Ahn
- Department of Neurosurgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea.
| |
Collapse
|
|
16
|
Daei Sorkhabi A, Sarkesh A, Saeedi H, Marofi F, Ghaebi M, Silvestris N, Baradaran B, Brunetti O. The Basis and Advances in Clinical Application of Cytomegalovirus-Specific Cytotoxic T Cell Immunotherapy for Glioblastoma Multiforme. Front Oncol 2022; 12:818447. [PMID: 35515137 PMCID: PMC9062077 DOI: 10.3389/fonc.2022.818447] [Citation(s) in RCA: 12] [Impact Index Per Article: 4.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/05/2021] [Accepted: 03/24/2022] [Indexed: 01/28/2023] Open
Abstract
A high percentage of malignant gliomas are infected by human cytomegalovirus (HCMV), and the endogenous expression of HCMV genes and their products are found in these tumors. HCMV antigen expression and its implications in gliomagenesis have emerged as a promising target for adoptive cellular immunotherapy (ACT) strategies in glioblastoma multiforme (GB) patients. Since antigen-specific T cells in the tumor microenvironments lack efficient anti-tumor immune response due to the immunosuppressive nature of glioblastoma, CMV-specific ACT relies on in vitro expansion of CMV-specific CD8+ T cells employing immunodominant HCMV antigens. Given the fact that several hurdles remain to be conquered, recent clinical trials have outlined the feasibility of CMV-specific ACT prior to tumor recurrence with minimal adverse effects and a substantial improvement in median overall survival and progression-free survival. This review discusses the role of HCMV in gliomagenesis, disease prognosis, and recent breakthroughs in harnessing HCMV-induced immunogenicity in the GB tumor microenvironment to develop effective CMV-specific ACT.
Collapse
Affiliation(s)
- Amin Daei Sorkhabi
- Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Aila Sarkesh
- Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Hossein Saeedi
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Faroogh Marofi
- Department of Hematology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Mahnaz Ghaebi
- Cancer Gene Therapy Research Center (CGRC), Zanjan University of Medical Sciences, Zanjan, Iran
| | - Nicola Silvestris
- Medical Oncology Unit, Department of Human Pathology "G. Barresi", University of Messina, Messina, Italy
| | - Behzad Baradaran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
- Neurosciences Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Oronzo Brunetti
- Medical Oncology Unit-Istituto di Ricovero e Cura a Carattere Scientifico (IRCCS) Istituto Tumori “Giovanni Paolo II” of Bari, Bari, Italy
| |
Collapse
|
|
17
|
Metabolic Reprogramming of Glioblastoma Cells during HCMV Infection Induces Secretome-Mediated Paracrine Effects in the Microenvironment. Viruses 2022; 14:v14010103. [PMID: 35062307 PMCID: PMC8777757 DOI: 10.3390/v14010103] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/25/2021] [Revised: 12/22/2021] [Accepted: 01/04/2022] [Indexed: 12/14/2022] Open
Abstract
Glioblastoma (GBM) is an aggressive primary central nervous system neoplasia with limited therapeutic options and poor prognosis. Following reports of cytomegalovirus (HCMV) in GBM tumors, the anti-viral drug Valganciclovir was administered and found to significantly increase the longevity of GBM patients. While these findings suggest a role for HCMV in GBM, the relationship between them is not clear and remains controversial. Treatment with anti-viral drugs may prove clinically useful; however, their results do not explain the underlying mechanism between HCMV infection and GBM progression. We hypothesized that HCMV infection would metabolically reprogram GBM cells and that these changes would allow for increased tumor progression. We infected LN-18 GBM cells and employed a Seahorse Bioanalyzer to characterize cellular metabolism. Increased mitochondrial respiration and glycolytic rates were observed following infection. These changes were accompanied by elevated production of reactive oxygen species and lactate. Due to lactate’s numerous tumor-promoting effects, we examined the impact of paracrine signaling of HCMV-infected GBM cells on uninfected stromal cells. Our results indicated that, independent of viral transmission, the secretome of HCMV-infected GBM cells was able to alter the expression of key metabolic proteins and epigenetic markers. This suggests a mechanism of action where reprogramming of GBM cells alters the surrounding tumor microenvironment to be permissive to tumor progression in a manner akin to the Reverse-Warburg Effect. Overall, this suggests a potential oncomodulatory role for HCMV in the context of GBM.
Collapse
|
|
18
|
Peredo-Harvey I, Rahbar A, Söderberg-Nauclér C. Presence of the Human Cytomegalovirus in Glioblastomas-A Systematic Review. Cancers (Basel) 2021; 13:cancers13205051. [PMID: 34680198 PMCID: PMC8533734 DOI: 10.3390/cancers13205051] [Citation(s) in RCA: 20] [Impact Index Per Article: 5.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/15/2021] [Revised: 09/30/2021] [Accepted: 10/04/2021] [Indexed: 12/29/2022] Open
Abstract
Simple Summary Whether the human cytomegalovirus (HCMV) is present in samples obtained from patients with glioblastoma (GBM) has been a matter under debate during the last two decades. Many investigators have demonstrated the presence of HCMV proteins and nucleic acids in GBM tumors, while some have not been able to detect it. It is important to evaluate current data and resolve these issues to clarify the possible role of the HCMV in GBM tumorigenesis and if this virus can serve as a potential target of therapy for these patients. In the present systematic review, we aim to review published research studies with a focus to identify differences and similarities in methods used for the detection of the HCMV in GBM samples found to be positive or negative for HCMV. Our data suggest that the HCMV is highly prevalent in glioblastomas and that optimized immunohistochemistry techniques are required to detect it. Abstract Glioblastoma is a malignant brain tumor with a dismal prognosis. The standard treatment has not changed in the past 15 years as clinical trials of new treatment protocols have failed. A high prevalence of the human cytomegalovirus (HCMV) in glioblastomas was first reported in 2002. The virus was found only in the tumor and not in the surrounding healthy brain tissue. Many groups have confirmed the presence of the HCMV in glioblastomas, but others could not. To resolve this discrepancy, we systematically reviewed 645 articles identified in different databases. Of these, 81 studies included results from 247 analyses of 9444 clinical samples (7024 tumor samples and 2420 blood samples) by different techniques, and 81 articles included 191 studies that identified the HCMV in 2529 tumor samples (36% of all tumor samples). HCMV proteins were often detected, whereas HCMV nucleic acids were not reliably detected by PCR methods. Optimized immunohistochemical techniques identified the virus in 1391 (84,2%) of 1653 samples. These data suggest that the HCMV is highly prevalent in glioblastomas and that optimized immunohistochemistry techniques are required to detect it.
Collapse
Affiliation(s)
- Inti Peredo-Harvey
- Department of Neurosurgery, Karolinska University Hospital, 171 76 Stockholm, Sweden;
- Department of Medicine, Solna, BioClinicum, Karolinska Institutet, 171 64 Stockholm, Sweden;
| | - Afsar Rahbar
- Department of Medicine, Solna, BioClinicum, Karolinska Institutet, 171 64 Stockholm, Sweden;
- Department of Neurology, Karolinska University Hospital, 171 76 Stockholm, Sweden
| | - Cecilia Söderberg-Nauclér
- Department of Medicine, Solna, BioClinicum, Karolinska Institutet, 171 64 Stockholm, Sweden;
- Department of Neurology, Karolinska University Hospital, 171 76 Stockholm, Sweden
- Correspondence:
| |
Collapse
|
|
19
|
Dapash M, Castro B, Hou D, Lee-Chang C. Current Immunotherapeutic Strategies for the Treatment of Glioblastoma. Cancers (Basel) 2021; 13:4548. [PMID: 34572775 PMCID: PMC8467991 DOI: 10.3390/cancers13184548] [Citation(s) in RCA: 10] [Impact Index Per Article: 2.5] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/16/2021] [Revised: 08/24/2021] [Accepted: 08/24/2021] [Indexed: 12/17/2022] Open
Abstract
Glioblastoma (GBM) is a lethal primary brain tumor. Despite extensive effort in basic, translational, and clinical research, the treatment outcomes for patients with GBM are virtually unchanged over the past 15 years. GBM is one of the most immunologically "cold" tumors, in which cytotoxic T-cell infiltration is minimal, and myeloid infiltration predominates. This is due to the profound immunosuppressive nature of GBM, a tumor microenvironment that is metabolically challenging for immune cells, and the low mutational burden of GBMs. Together, these GBM characteristics contribute to the poor results obtained from immunotherapy. However, as indicated by an ongoing and expanding number of clinical trials, and despite the mostly disappointing results to date, immunotherapy remains a conceptually attractive approach for treating GBM. Checkpoint inhibitors, various vaccination strategies, and CAR T-cell therapy serve as some of the most investigated immunotherapeutic strategies. This review article aims to provide a general overview of the current state of glioblastoma immunotherapy. Information was compiled through a literature search conducted on PubMed and clinical trials between 1961 to 2021.
Collapse
Affiliation(s)
- Mark Dapash
- Pritzker School of Medicine, University of Chicago, Chicago, IL 60637, USA;
- Department of Neurological Surgery, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA; (B.C.); (D.H.)
| | - Brandyn Castro
- Department of Neurological Surgery, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA; (B.C.); (D.H.)
- Department of Neurosurgery, University of Chicago, Chicago, IL 60637, USA
| | - David Hou
- Department of Neurological Surgery, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA; (B.C.); (D.H.)
| | - Catalina Lee-Chang
- Department of Neurological Surgery, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA; (B.C.); (D.H.)
- Northwestern Medicine Malnati Brain Tumor Institute, Lurie Comprehensive Cancer Center, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA
| |
Collapse
|
|
20
|
Mihelson N, McGavern DB. Viral Control of Glioblastoma. Viruses 2021; 13:v13071264. [PMID: 34209584 PMCID: PMC8310222 DOI: 10.3390/v13071264] [Citation(s) in RCA: 10] [Impact Index Per Article: 2.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/02/2021] [Revised: 06/23/2021] [Accepted: 06/24/2021] [Indexed: 12/11/2022] Open
Abstract
Glioblastoma multiforme (GBM) is a universally lethal cancer of the central nervous system. Patients with GBM have a median survival of 14 months and a 5-year survival of less than 5%, a grim statistic that has remained unchanged over the last 50 years. GBM is intransigent for a variety of reasons. The immune system has a difficult time mounting a response against glioblastomas because they reside in the brain (an immunologically dampened compartment) and generate few neoantigens relative to other cancers. Glioblastomas inhabit the brain like sand in the grass and display a high degree of intra- and inter-tumoral heterogeneity, impeding efforts to therapeutically target a single pathway. Of all potential therapeutic strategies to date, virotherapy offers the greatest chance of counteracting each of the obstacles mounted by GBM. Virotherapy can xenogenize a tumor that is deft at behaving like “self”, triggering adaptive immune recognition in an otherwise immunologically quiet compartment. Viruses can also directly lyse tumor cells, creating damage and further stimulating secondary immune reactions that are detrimental to tumor growth. In this review, we summarize the basic immune mechanisms underpinning GBM immune evasion and the recent successes achieved using virotherapies.
Collapse
|
|
21
|
Zhang W, Bream JH, Leng SX, Margolick JB. Validation of Preamplification to Improve Quantification of Cytomegalovirus DNA Using Droplet Digital Polymerase Chain Reaction. Anal Chem 2021; 93:3710-3716. [PMID: 33596050 PMCID: PMC10074994 DOI: 10.1021/acs.analchem.0c02890] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/29/2022]
Abstract
Subclinical cytomegalovirus (CMV) replication is associated with strong cellular immune response and chronic inflammation, which could contribute to aging-related conditions such as cardiovascular disease and frailty. However, because of very low levels of CMV DNA present in people with chronic CMV infection, it has been difficult to explore the virologic and immunologic mechanisms of chronic low-level CMV infection and a sensitive method to monitor CMV replication is needed. Droplet digital PCR (ddPCR) has been shown to have higher precision and reproducibility than real-time quantitative PCR (qPCR) in quantifying low levels of CMV DNA, but it is not always sensitive enough for this purpose. Through rigorous validation experiments, we demonstrated that sensitivity and precision of quantification of very low levels of CMV DNA by ddPCR can be significantly increased by preamplification of samples with 10-20 cycles of conventional PCR, especially when testing CMV DNA in the presence of cellular DNA. With preamplification, we could reliably quantify down to two copies of CMV DNA, as opposed to five copies without preamplification. Further studies are needed to determine if ddPCR with preamplification can facilitate mechanistic studies of the characteristics and consequences of chronic CMV infection in aging adults.
Collapse
Affiliation(s)
- Weiying Zhang
- Department of Molecular Microbiology and Immunology, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland
| | - Jay H. Bream
- Department of Molecular Microbiology and Immunology, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland
- Graduate Program in Immunology, Johns Hopkins School of Medicine, Baltimore, Maryland
| | - Sean X. Leng
- Division of Geriatric Medicine and Gerontology, Department of Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland
| | - Joseph B. Margolick
- Department of Molecular Microbiology and Immunology, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland
| |
Collapse
|
|
22
|
Human Cytomegalovirus Induces the Expression of the AMPKa2 Subunit to Drive Glycolytic Activation and Support Productive Viral Infection. J Virol 2021; 95:JVI.01321-20. [PMID: 33268515 PMCID: PMC8092818 DOI: 10.1128/jvi.01321-20] [Citation(s) in RCA: 9] [Impact Index Per Article: 2.3] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/18/2022] Open
Abstract
Human Cytomegalovirus (HCMV) infection modulates cellular metabolism to support viral replication. Calcium/calmodulin-dependent kinase kinase (CaMKK) and AMP-activated protein kinase (AMPK) regulate metabolic activation and have been found to be important for successful HCMV infection. Here, we explored the contributions that specific CaMKK isoforms and AMPK subunit isoforms make toward HCMV infection. Our results indicate that various CaMKK and AMPK isoforms contribute to infection in unique ways. For example, CaMKK1 is important for HCMV infection at a low multiplicity of infection, but is dispensable for AMPK activation at the earliest times of infection, which our data suggest is more reliant on CaMKK2. Our results also indicate that HCMV specifically induces the expression of the non-ubiquitous AMPKa2 catalytic subunit, found to be important for both HCMV-mediated glycolytic activation and high titer infection. Further, we find that AMPK-mediated glycolytic activation is important for infection, as overexpression of GLUT4, the high capacity glucose transporter, partially rescues viral replication in the face of AMPK inhibition. Collectively, our data indicate that HCMV infection selectively induces the expression of specific metabolic regulatory kinases, relying on their activity to support glycolytic activation and productive infection.IMPORTANCE Viruses are obligate parasites that depend on the host cell to provide the energy and molecular building blocks to mass produce infectious viral progeny. The processes that govern viral modulation of cellular resources have emerged as critical for successful infection. Here, we find that HCMV depends on two kinase isoforms to support infection, CaMKK1 and AMPKa2. We find that HCMV specifically induces expression of the AMPKa2 subunit to induce metabolic activation and drive robust viral replication. These results suggest that HCMV has evolved mechanisms to target specific metabolic regulatory kinase subunits to support productive infection, thereby providing insight into how HCMV hijacks cellular metabolism for its replication, and sheds light on potential viral therapeutic vulnerabilities.
Collapse
|
|
23
|
Tu J, Fang Y, Han D, Tan X, Jiang H, Gong X, Wang X, Hong W, Wei W. Activation of nuclear factor-κB in the angiogenesis of glioma: Insights into the associated molecular mechanisms and targeted therapies. Cell Prolif 2020; 54:e12929. [PMID: 33300633 PMCID: PMC7848966 DOI: 10.1111/cpr.12929] [Citation(s) in RCA: 12] [Impact Index Per Article: 2.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/05/2020] [Revised: 09/28/2020] [Accepted: 10/01/2020] [Indexed: 02/06/2023] Open
Abstract
Glioma is the most commonly observed primary intracranial tumour and is associated with massive angiogenesis. Glioma neovascularization provides nutrients for the growth and metabolism of tumour tissues, promotes tumour cell division and proliferation, and provides conditions ideal for the infiltration and migration of tumour cells to distant places. Growing evidence suggests that there is a correlation between the activation of nuclear factor (NF)‐κB and the angiogenesis of glioma. In this review article, we highlighted the functions of NF‐κB in the angiogenesis of glioma, showing that NF‐κB activation plays a pivotal role in the growth and progression of glioma angiogenesis and is a rational therapeutic target for antiangiogenic strategies aimed at glioma.
Collapse
Affiliation(s)
- Jiajie Tu
- Institute of Clinical Pharmacology, Key Laboratory of Anti-Inflammatory and Immune Medicine, Ministry of Education, Anhui Collaborative Innovation Center of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Hefei, China
| | - Yilong Fang
- Institute of Clinical Pharmacology, Key Laboratory of Anti-Inflammatory and Immune Medicine, Ministry of Education, Anhui Collaborative Innovation Center of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Hefei, China
| | - Dafei Han
- Institute of Clinical Pharmacology, Key Laboratory of Anti-Inflammatory and Immune Medicine, Ministry of Education, Anhui Collaborative Innovation Center of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Hefei, China
| | - Xuewen Tan
- Institute of Clinical Pharmacology, Key Laboratory of Anti-Inflammatory and Immune Medicine, Ministry of Education, Anhui Collaborative Innovation Center of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Hefei, China
| | - Haifeng Jiang
- Institute of Clinical Pharmacology, Key Laboratory of Anti-Inflammatory and Immune Medicine, Ministry of Education, Anhui Collaborative Innovation Center of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Hefei, China
| | - Xun Gong
- Institute of Clinical Pharmacology, Key Laboratory of Anti-Inflammatory and Immune Medicine, Ministry of Education, Anhui Collaborative Innovation Center of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Hefei, China
| | - Xinming Wang
- Department of Neurosurgery, The First Affiliated Hospital of Anhui Medical University, Hefei, China
| | - Wenming Hong
- Department of Neurosurgery, The First Affiliated Hospital of Anhui Medical University, Hefei, China
| | - Wei Wei
- Institute of Clinical Pharmacology, Key Laboratory of Anti-Inflammatory and Immune Medicine, Ministry of Education, Anhui Collaborative Innovation Center of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Hefei, China
| |
Collapse
|
|
24
|
HSATII RNA is induced via a noncanonical ATM-regulated DNA damage response pathway and promotes tumor cell proliferation and movement. Proc Natl Acad Sci U S A 2020; 117:31891-31901. [PMID: 33257565 DOI: 10.1073/pnas.2017734117] [Citation(s) in RCA: 17] [Impact Index Per Article: 3.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/30/2022] Open
Abstract
Pericentromeric human satellite II (HSATII) repeats are normally silent but can be actively transcribed in tumor cells, where increased HSATII copy number is associated with a poor prognosis in colon cancer, and in human cytomegalovirus (HCMV)-infected fibroblasts, where the RNA facilitates viral replication. Here, we report that HCMV infection or treatment of ARPE-19 diploid epithelial cells with DNA-damaging agents, etoposide or zeocin, induces HSATII RNA expression, and a kinase-independent function of ATM is required for the induction. Additionally, various breast cancer cell lines growing in adherent, two-dimensional cell culture express HSATII RNA at different levels, and levels are markedly increased when cells are infected with HCMV or treated with zeocin. High levels of HSATII RNA expression correlate with enhanced migration of breast cancer cells, and knockdown of HSATII RNA reduces cell migration and the rate of cell proliferation. Our investigation links high expression of HSATII RNA to the DNA damage response, centered on a noncanonical function of ATM, and demonstrates a role for the satellite RNA in tumor cell proliferation and movement.
Collapse
|
|
25
|
Lyon SM, Yetming KD, Paulus C, Nevels M, Kalejta RF. Human Cytomegalovirus Genomes Survive Mitosis via the IE19 Chromatin-Tethering Domain. mBio 2020; 11:e02410-20. [PMID: 32994332 PMCID: PMC7527735 DOI: 10.1128/mbio.02410-20] [Citation(s) in RCA: 10] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/24/2020] [Accepted: 08/26/2020] [Indexed: 12/12/2022] Open
Abstract
The genomes of DNA tumor viruses regain nuclear localization after nuclear envelope breakdown during mitosis through the action of a viral protein with a chromatin-tethering domain (CTD). Here, we report that the human cytomegalovirus (HCMV) genome is maintained during mitosis by the CTD of the viral IE19 protein. Deletion of the IE19 CTD or disruption of the IE19 splice acceptor site reduced viral genome maintenance and progeny virion formation during infection of dividing fibroblasts, both of which were rescued by IE19 ectopic expression. The discovery of a viral genome maintenance factor during productive infection provides new insight into the mode of HCMV infection implicated in birth defects, organ transplant failure, and cancer.IMPORTANCE Human cytomegalovirus (HCMV) is the leading infectious cause of birth defects, represents a serious complication for immunocompromised HIV/AIDS and organ transplant patients, and contributes to both immunosenescence and cardiovascular diseases. HCMV is also implicated in cancers such as glioblastoma multiforme (GBM) and infects ex vivo-cultured GBM tumor cells. In dividing tumor cells, the genomes of DNA tumor viruses regain nuclear localization after nuclear envelope breakdown during mitosis. This mitotic survival is mediated by a viral protein with a chromatin-tethering domain (CTD). Here, we report that the HCMV genome is maintained in dividing fibroblasts by the CTD of the viral IE19 protein. The discovery of a viral genome maintenance factor during productive infection could help explain viral genome dynamics within HCMV-positive tumors as well as during latency.
Collapse
Affiliation(s)
- Shelby M Lyon
- Institute for Molecular Virology, University of Wisconsin-Madison, Madison, Wisconsin, USA
- McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, Wisconsin, USA
| | - Kristen D Yetming
- Institute for Molecular Virology, University of Wisconsin-Madison, Madison, Wisconsin, USA
- McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, Wisconsin, USA
| | - Christina Paulus
- Biomedical Sciences Research Complex, University of St. Andrews, St. Andrews, United Kingdom
| | - Michael Nevels
- Biomedical Sciences Research Complex, University of St. Andrews, St. Andrews, United Kingdom
| | - Robert F Kalejta
- Institute for Molecular Virology, University of Wisconsin-Madison, Madison, Wisconsin, USA
- McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Madison, Wisconsin, USA
| |
Collapse
|
|
26
|
Yuan Z, Ye X, Zhu L, Zhang N, An Z, Zheng WJ. Virome assembly and annotation in brain tissue based on next-generation sequencing. Cancer Med 2020; 9:6776-6790. [PMID: 32738030 PMCID: PMC7520322 DOI: 10.1002/cam4.3325] [Citation(s) in RCA: 8] [Impact Index Per Article: 1.6] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/20/2019] [Revised: 06/20/2020] [Accepted: 07/01/2020] [Indexed: 12/15/2022] Open
Abstract
The glioblastoma multiforme (GBM) is one of the deadliest tumors. It has been speculated that virus plays a role in GBM but the evidences are controversy. Published researches are mainly limited to studies on the presence of human cytomegalovirus (HCMV) in GBM. No comprehensive assessment of the brain virome, the collection of viral material in the brain, based on recently sequenced data has been performed. Here, we characterized the virome from 111 GBM samples and 57 normal brain samples from eight projects in the SRA database by a tested and comprehensive assembly approach. The annotation of the assembled contigs showed that most viral sequences in the brain belong to the viral family Retroviridae. In some GBM samples, we also detected full genome sequence of a novel picornavirus recently discovered in invertebrates. Unlike previous reports, our study did not detect herpes virus such as HCMV in GBM from the data we used. However, some contigs that cannot be annotated with any known genes exhibited antibody epitopes in their sequences. These findings provide several avenues for potential cancer therapy: the newly discovered picornavirus could be a starting point to engineer novel oncolytic virus; and the exhibited antibody epitopes could be a source to explore potential drug targets for immune cancer therapy. By characterizing the virosphere in GBM and normal brain at a global level, the results from this study strengthen the link between GBM and viral infection which warrants the further investigation.
Collapse
Affiliation(s)
- Zihao Yuan
- School of Biomedical InformaticsUniversity of Texas Health Science Center at HoustonHoustonTXUSA
- Texas Therapeutics InstituteInstitute of Molecular MedicineMcGovern Medical SchoolUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - Xiaohua Ye
- Texas Therapeutics InstituteInstitute of Molecular MedicineMcGovern Medical SchoolUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - Lisha Zhu
- School of Biomedical InformaticsUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - Ningyan Zhang
- Texas Therapeutics InstituteInstitute of Molecular MedicineMcGovern Medical SchoolUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - Zhiqiang An
- Texas Therapeutics InstituteInstitute of Molecular MedicineMcGovern Medical SchoolUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - W. Jim Zheng
- School of Biomedical InformaticsUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| |
Collapse
|
|
27
|
Dunn DM, Munger J. Interplay Between Calcium and AMPK Signaling in Human Cytomegalovirus Infection. Front Cell Infect Microbiol 2020; 10:384. [PMID: 32850483 PMCID: PMC7403205 DOI: 10.3389/fcimb.2020.00384] [Citation(s) in RCA: 16] [Impact Index Per Article: 3.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/30/2020] [Accepted: 06/23/2020] [Indexed: 12/13/2022] Open
Abstract
Calcium signaling and the AMP-activated protein kinase (AMPK) signaling networks broadly regulate numerous aspects of cell biology. Human Cytomegalovirus (HCMV) infection has been found to actively manipulate the calcium-AMPK signaling axis to support infection. Many HCMV genes have been linked to modulating calcium signaling, and HCMV infection has been found to be reliant on calcium signaling and AMPK activation. Here, we focus on the cell biology of calcium and AMPK signaling and what is currently known about how HCMV modulates these pathways to support HCMV infection and potentially contribute to oncomodulation.
Collapse
Affiliation(s)
- Diana M Dunn
- Department of Biochemistry and Biophysics, School of Medicine and Dentistry, University of Rochester, Rochester, NY, United States
| | - Joshua Munger
- Department of Biochemistry and Biophysics, School of Medicine and Dentistry, University of Rochester, Rochester, NY, United States
| |
Collapse
|
|
28
|
Limam S, Missaoui N, Hmissa S, Yacoubi MT, Krifa H, Mokni M, Selmi B. Investigation of Human Cytomegalovirus and Human Papillomavirus in Glioma. Cancer Invest 2020; 38:394-405. [PMID: 32643440 DOI: 10.1080/07357907.2020.1793352] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/19/2022]
Abstract
The study investigated the human cytomegalovirus (HCMV) and human papillomavirus (HPV) in gliomas. A retrospective study was conducted on 112 samples. HCMV was investigated by PCR, in situ hybridization (ISH) and immunohistochemistry. HPV was tested by PCR and DNA ISH. HCMV was identified in 60 gliomas, including 55 GBM. However, RNA ISH and immunohistochemistry failed to detect HCMV positivity. HPV was identified in 44 GBM. No significant relationship was identified between HCMV and HPV and tumour characteristics (p > 0.05). Our findings support the HCMV and HPV presence in gliomas. Further assays are required to more explore the potential efficient antiviral management.
Collapse
Affiliation(s)
- Sarra Limam
- Pathology Department, Farhet Hached University Hospital, Sousse, Tunisia
| | - Nabiha Missaoui
- Research Unit UR14ES17, Medicine Faculty, Sousse University, Sousse, Tunisia.,Faculty of Sciences and Techniques of Sidi Bouzid, Kairouan University, Kairouan, Tunisia.,Pathology Department, Sahloul University Hospital, Sousse, Tunisia
| | - Sihem Hmissa
- Pathology Department, Sahloul University Hospital, Sousse, Tunisia
| | | | - Hedi Krifa
- Department of Neurosurgery, Sahloul University Hospital, Sousse, Tunisia
| | - Moncef Mokni
- Pathology Department, Farhet Hached University Hospital, Sousse, Tunisia
| | - Boulbeba Selmi
- Higher Institute of Biotechnology, Monastir University, Monastir, Tunisia
| |
Collapse
|
|
29
|
Ewald PW, Swain Ewald HA. The scope of viral causation of human cancers: interpreting virus density from an evolutionary perspective. Philos Trans R Soc Lond B Biol Sci 2020; 374:20180304. [PMID: 30955500 DOI: 10.1098/rstb.2018.0304] [Citation(s) in RCA: 5] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/13/2022] Open
Abstract
Most known oncogenic viruses of humans use DNA as their genomic material. Research over the past quarter century has revealed that their oncogenicity results largely from direct interference with barriers to oncogenesis. In contrast to viruses that have been accepted causes of particular cancers, candidate viral causes tend to have fewer viral than cellular genomes in the tumours. These low viral loads have caused researchers to conclude that the associated viruses are not primary causes of the associated cancers. Consideration of differential survival, reproduction and infiltration of cells in a tumour suggest, however, that viral loads could be low even when viruses are primary causes of cancer. Resolution of this issue has important implications for human health because medical research tends to be effective at preventing and controlling infectious diseases. Mathematical models may clarify the problem and help guide future research by assessing whether low viral loads are likely outcomes of the differential survival, reproduction, and infiltration of cells in a tumour and, more generally, the extent to which viruses contribute to cancer. This article is part of the theme issue 'Silent cancer agents: multi-disciplinary modelling of human DNA oncoviruses'.
Collapse
Affiliation(s)
- Paul W Ewald
- Department of Biology, University of Louisville , Louisville, KY 40292 , USA
| | - Holly A Swain Ewald
- Department of Biology, University of Louisville , Louisville, KY 40292 , USA
| |
Collapse
|
|
30
|
Kalejta RF, Albright ER. Expanding the Known Functional Repertoire of the Human Cytomegalovirus pp71 Protein. Front Cell Infect Microbiol 2020; 10:95. [PMID: 32226778 PMCID: PMC7080695 DOI: 10.3389/fcimb.2020.00095] [Citation(s) in RCA: 12] [Impact Index Per Article: 2.4] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/04/2020] [Accepted: 02/25/2020] [Indexed: 12/11/2022] Open
Abstract
The human cytomegalovirus pp71 protein is packaged within the tegument of infectious virions and performs multiple functions in host cells to prime them for productive, lytic replication. Here we review the known and hypothesized functions of pp71 in regulating proteolysis, infection outcome (lytic or latent), histone deposition, transcription, translation, immune evasion, cell cycle progression, and pathogenesis. We also highlight recent advances in CMV-based vaccine candidates informed by an improved understanding of pp71 function.
Collapse
Affiliation(s)
| | - Emily R. Albright
- McArdle Laboratory for Cancer Research, Institute for Molecular Virology, University of Wisconsin – Madison, Madison, WI, United States
| |
Collapse
|
|
31
|
Maleki F, Sadigh ZA, Sadeghi F, Muhammadnejad A, Farahmand M, Parvin M, Shirkoohi R. Human cytomegalovirus infection in Iranian glioma patients correlates with aging and tumor aggressiveness. J Med Virol 2020; 92:1266-1276. [PMID: 31944314 DOI: 10.1002/jmv.25673] [Citation(s) in RCA: 12] [Impact Index Per Article: 2.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/19/2019] [Accepted: 01/08/2020] [Indexed: 12/18/2022]
Abstract
Human cytomegalovirus (HCMV), as a ubiquitous and opportunistic virus, is a matter for consideration in broad-spectrum diseases, specifically in immunocompromised individuals. In recent decades, many studies that have evaluated the role of HCMV in inflammation and malignancies, especially in high-grade gliomas, have reported inconsistent results. Thus, this study was conducted to analyze 97 primary gliomas for human CMV UL83 gene and protein through TaqMan real-time polymerase chain reaction and immunohistochemistry, respectively. The results were positive for the UL83 gene and pp65 protein in 71% and 24% of samples, respectively. The frequency of HCMV was significantly higher in glioblastomas than other glioma grades (P < .01 and P < .05 for the UL83 gene and protein, respectively). In addition, the association between the prevalence of HCMV and aging strengthened the virus reactivation hypothesis in gliomas. In conclusion, a high frequency of HCMV infection was found in gliomas that correlated with tumor aggressiveness and age. This study recommends a thorough investigation to determine HCMV infection in gliomas to improve the existing knowledge of its role in glial tumors, its prognostic value, and possible efficient antiviral target therapy.
Collapse
Affiliation(s)
- Faezeh Maleki
- Human Viral Vaccine Department, Razi Vaccine and Serum Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Karaj, Alborz Province, Iran
| | - Zohreh-Azita Sadigh
- Human Viral Vaccine Department, Razi Vaccine and Serum Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Karaj, Alborz Province, Iran
| | - Farzin Sadeghi
- Department of Microbiology, Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol, Iran
| | - Ahad Muhammadnejad
- Department of Molecular Genetics, Cancer Biology Research Center, Cancer Institute of Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran
| | - Mohammad Farahmand
- Department of Virology, School of Public Health, Tehran University of Medical Sciences, Tehran, Tehran Province, Iran
| | - Mahmoud Parvin
- Department of Pathology, Shahid Labbafinejad Medical Center, Shahid Beheshti University of Medical Sciences, Tehran, Tehran Province, Iran
| | - Reza Shirkoohi
- Department of Molecular Genetics, Cancer Biology Research Center, Cancer Institute of Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran.,Department of Molecular Genetics, Cancer Research Center, Cancer Institute of Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran
| |
Collapse
|
|
32
|
Singh P, Neumann DM. Persistent HCMV infection of a glioblastoma cell line contributes to the development of resistance to temozolomide. Virus Res 2019; 276:197829. [PMID: 31790777 DOI: 10.1016/j.virusres.2019.197829] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/30/2019] [Revised: 10/26/2019] [Accepted: 11/28/2019] [Indexed: 02/07/2023]
Abstract
Glioblastoma multiforme (GBM) is the most aggressive form of primary human gliomas. While chemotherapy using the DNA alkylating agent temozolomide (TMZ) is a first line treatment for GBMs, the development of resistance to TMZ is a common limitation to successful treatment. Human Cytomegalovirus (HCMV) is a ubiquitous β-herpesvirus that establishes a lifelong infection latent infection in host haematopoetic cells, where lytic replication of the virus is silenced. HCMV can also establish a persistent infection in hosts, where low levels of virus are lytically produced. Furthermore, multiple studies have identified HCMV DNA and/or proteins in human GBM samples, and have shown that acute infection with HCMV confers a glioblastoma stem cell (GSC) phenotype, further supporting an oncomodulatory role for HCMV in GBM progression and severity. In this current study, we examined the long-term effects of HCMV persistence to cell viability, cell proliferation, and the development of TMZ resistance over time using a glioblastoma cell line known as LN-229. Persistent HCMV infections were established and maintained in this cell line for 30 weeks without the addition of new virus. Here, we report that HCMV persistence in this cell line resulted in increased cell viability, increased cell proliferation, and a marked resistance to the DNA alkylating agent, TMZ, over time, suggesting that low levels of lytically replicating HCMV could contribute to tumor progression in GBM.
Collapse
Affiliation(s)
- Pankaj Singh
- Department of Ophthalmology and Visual Sciences, University of Wisconsin-Madison, Madison, WI, USA
| | - Donna M Neumann
- Department of Ophthalmology and Visual Sciences, University of Wisconsin-Madison, Madison, WI, USA.
| |
Collapse
|
|
33
|
Blaylock RL. Accelerated cancer aggressiveness by viral oncomodulation: New targets and newer natural treatments for cancer control and treatment. Surg Neurol Int 2019; 10:199. [PMID: 31768279 PMCID: PMC6826277 DOI: 10.25259/sni_361_2019] [Citation(s) in RCA: 6] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/17/2019] [Accepted: 06/19/2019] [Indexed: 12/12/2022] Open
Abstract
An infectious etiology for a number of cancers has been entertained for over 100 years and modern studies have confirmed that a number of viruses are linked to cancer induction. While a large number of viruses have been demonstrated in a number of types of cancers, most such findings have been dismissed in the past as opportunistic infections, especially with persistent viruses with high rates of infectivity of the world’s populations. More recent studies have clearly shown that while not definitely causing these cancers, these viruses appear capable of affecting the biology of these tumors in such a way as to make them more aggressive and more resistant to conventional treatments. The term oncomodulatory viruses has been used to describe this phenomenon. A number of recent studies have shown a growing number of ways these oncomodulatory viruses can alter the pathology of these tumors by affecting cell-signaling, cell metabolism, apoptosis mechanisms, cell-cell communication, inflammation, antitumor immunity suppression, and angiogenesis. We are also learning that much of the behavior of tumors depends on cancer stem cells and stromal cells within the tumor microenvironment, which participate in extensive, dynamic crosstalk known to affect tumor behavior. Cancer stem cells have been found to be particularly susceptible to infection by human cytomegalovirus. In a number of studies, it has been shown that while only a select number of cells are actually infected with the virus, numerous viral proteins are released into cancer and stromal cells in the microenvironment and these viral proteins are known to affect tumor behavior and aggressiveness.
Collapse
|
|
34
|
Nauclér CS, Geisler J, Vetvik K. The emerging role of human cytomegalovirus infection in human carcinogenesis: a review of current evidence and potential therapeutic implications. Oncotarget 2019; 10:4333-4347. [PMID: 31303966 PMCID: PMC6611507 DOI: 10.18632/oncotarget.27016] [Citation(s) in RCA: 50] [Impact Index Per Article: 8.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/20/2019] [Accepted: 05/29/2019] [Indexed: 12/12/2022] Open
Abstract
It is well-established that infections with viruses harboring oncogenic potential increase the cancer risk. Virus induced oncogenic processes are influenced by a complex and unique combination of host and environmental risk factors that are currently not fully understood. Many of the oncogenic viruses exhibit a prolonged, asymptomatic latency after a primary infection, and cause cancer in only a minority of carriers. From an epidemiologic point of view, it is therefore difficult to determine their role in cancer development. However, recent evidence suggests a neoplastic potential of one additional ubiquitous virus; human Cytomegalovirus (HCMV). Emerging data presents HCMV as a plausible cancer-causing virus by demonstrating its presence in >90% of common tumor types, while being absent in normal tissue surrounding the tumor. HCMV targets many cell types in tumor tissues, and can cause all the ten proposed hallmarks of cancer. This virus exhibits cellular tumor-promoting and immune-evasive strategies, hijacks proangiogenic and anti-apoptotic mechanisms and induces immunosuppressive effects in the tumor micro-environment. Recognizing new cancer-causing mechanisms may increase the therapeutic potential and prophylactic options for virus associated cancer forms. Such approaches could limit viral spread, and promote anti-viral and immune controlling strategies if given as add on to standard therapy to potentially improve the prognosis of cancer patients. This review will focus on HCMV-related onco-viral mechanisms and the potential of HCMV as a new therapeutic target in HCMV positive cancer forms.
Collapse
Affiliation(s)
- Cecilia Söderberg Nauclér
- Department of Medicine, Unit of Microbial Pathogenesis, Center for Molecular Medicine, Karolinska Institutet, Solna, Stockholm, Sweden
| | - Jürgen Geisler
- Department of Oncology, Akershus University Hospital (AHUS), Lørenskog, Norway.,Institute of Clinical Medicine, University of Oslo, Oslo, Norway
| | - Katja Vetvik
- Institute of Clinical Medicine, University of Oslo, Oslo, Norway.,Department of Breast and Endocrine Surgery, AHUS, Lørenskog, Norway
| |
Collapse
|
|
35
|
Brown MP, Ebert LM, Gargett T. Clinical chimeric antigen receptor-T cell therapy: a new and promising treatment modality for glioblastoma. Clin Transl Immunology 2019; 8:e1050. [PMID: 31139410 PMCID: PMC6526894 DOI: 10.1002/cti2.1050] [Citation(s) in RCA: 29] [Impact Index Per Article: 4.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/30/2019] [Revised: 04/15/2019] [Accepted: 04/22/2019] [Indexed: 12/27/2022] Open
Abstract
Chimeric antigen receptor (CAR)-T cell therapy is now approved in the United States and Europe as a standard treatment for relapsed/refractory B-cell malignancies. It has also been approved recently by the Therapeutic Goods Administration in Australia and may soon be publicly reimbursed. This advance has accentuated scientific, clinical and commercial interest in adapting this exciting technology for the treatment of solid cancers where it is widely recognised that the challenges of overcoming a hostile tumor microenvironment are most acute. Indeed, CAR-T cell technology may be of the greatest value for those cancers that lack pre-existing immunity because they are immunologically 'cold', or have a low somatic tumor mutation load, or both. These cancers are generally not amenable to therapeutic immune checkpoint blockade, but CAR-T cell therapy may be effective because it provides an abundant supply of autologous tumor-specific T cells. This is achieved by using genetic engineering to re-direct autologous T-cell cytotoxicity towards a tumor-associated antigen, bypassing endogenous T-cell requirements for antigen processing, MHC-dependent antigen presentation and co-stimulation. One of the most challenging solid cancers is glioblastoma, which has among the least permissive immunological milieu of any cancer, and which is almost always fatal. Here, we argue that CAR-T cell technology may counter some glioblastoma defences and provide a beachhead for furthering our eventual therapeutic aims of restoring effective antitumor immunity. Although clinical investigation of CAR-T cell therapy for glioblastoma is at an early stage, we discuss three recently published studies, which feature significant differences in target antigen, CAR-T cell phenotype, route of administration and tumor response. We discuss the lessons, which may be learned from these studies and which may guide further progress in the field.
Collapse
Affiliation(s)
- Michael P Brown
- Translational Oncology Laboratory Centre for Cancer Biology University of South Australia and SA Pathology Adelaide SA Australia.,Cancer Clinical Trials Unit Royal Adelaide Hospital Adelaide SA Australia.,School of Medicine University of Adelaide Adelaide SA Australia
| | - Lisa M Ebert
- Translational Oncology Laboratory Centre for Cancer Biology University of South Australia and SA Pathology Adelaide SA Australia
| | - Tessa Gargett
- Translational Oncology Laboratory Centre for Cancer Biology University of South Australia and SA Pathology Adelaide SA Australia
| |
Collapse
|
|
36
|
Das P, Hasan MH, Mitra D, Bollavarapu R, Valente EJ, Tandon R, Raucher D, Hamme AT. Design, Synthesis, and Preliminary Studies of Spiro-isoxazoline-peroxides against Human Cytomegalovirus and Glioblastoma ∥. J Org Chem 2019; 84:6992-7006. [PMID: 31066280 DOI: 10.1021/acs.joc.9b00746] [Citation(s) in RCA: 12] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/27/2023]
Abstract
The association between glioblastoma (GBM) and human cytomegalovirus (HCMV) infection has been the intensely debated topic over the decades for developing new therapeutic options. In this regard, the peroxides from natural and synthetic sources served as potential antiviral and anticancer agents in the past. Herein, a concise and efficient strategy has been demonstrated to access a novel class of peroxides containing a spiro-isoxazoline to primarily investigate the biological activities. The synthetic compounds were evaluated for in vitro antiviral and antiproliferative activity against HCMV and glioblastoma cell line (GBM6), respectively. While compound 13m showed moderate anti-CMV activity (IC50 = 19 μM), surprisingly, an independent biological assay for compound 13m revealed its antiproliferative activity against the human glioblastoma cell line (GBM6) with an IC50 of 10 μM. Hence, the unification of an isoxazoline and peroxide heterocycles could be a potential direction to initiate the HCMV-GBM drug discovery program.
Collapse
Affiliation(s)
- Prasanta Das
- Department of Chemistry and Biochemistry , Jackson State University , Jackson , Mississippi 39217 , United States
| | | | | | | | - Edward J Valente
- Department of Chemistry , University of Portland , Portland , Oregon 97203 , United States
| | | | | | - Ashton T Hamme
- Department of Chemistry and Biochemistry , Jackson State University , Jackson , Mississippi 39217 , United States
| |
Collapse
|
|
37
|
Adnan Ali SM, Mirza Y, Ahmad Z, Zahid N, Enam SA. Human Papillomavirus and Human Cytomegalovirus Infection and Association with Prognosis in Patients with Primary Glioblastoma in Pakistan. World Neurosurg 2019; 121:e931-e939. [DOI: 10.1016/j.wneu.2018.10.018] [Citation(s) in RCA: 8] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/18/2018] [Revised: 10/01/2018] [Accepted: 10/03/2018] [Indexed: 01/07/2023]
|
|
38
|
Curtis NL, Bolanos-Garcia VM. The Anaphase Promoting Complex/Cyclosome (APC/C): A Versatile E3 Ubiquitin Ligase. Subcell Biochem 2019; 93:539-623. [PMID: 31939164 DOI: 10.1007/978-3-030-28151-9_18] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 03/25/2023]
Abstract
In the present chapter we discuss the essential roles of the human E3 ubiquitin ligase Anaphase Promoting Complex/Cyclosome (APC/C) in mitosis as well as the emerging evidence of important APC/C roles in cellular processes beyond cell division control such as regulation of genomic integrity and cell differentiation of the nervous system. We consider the potential incipient role of APC/C dysregulation in the pathophysiology of the neurological disorder Alzheimer's disease (AD). We also discuss how certain Deoxyribonucleic Acid (DNA) and Ribonucleic Acid (RNA) viruses take control of the host's cell division regulatory system through harnessing APC/C ubiquitin ligase activity and hypothesise the plausible molecular mechanisms underpinning virus manipulation of the APC/C. We also examine how defects in the function of this multisubunit protein assembly drive abnormal cell proliferation and lastly argue the potential of APC/C as a promising therapeutic target for the development of innovative therapies for the treatment of chronic malignancies such as cancer.
Collapse
Affiliation(s)
- Natalie L Curtis
- Faculty of Health and Life Sciences, Department of Biological and Medical Sciences, Oxford Brookes University, Oxford, OX3 0BP, England, UK
| | - Victor M Bolanos-Garcia
- Faculty of Health and Life Sciences, Department of Biological and Medical Sciences, Oxford Brookes University, Oxford, OX3 0BP, England, UK.
| |
Collapse
|
|
39
|
Qin Z, Zhang L, Xu Y, Zhang X, Fang X, Qian D, Liu X, Liu T, Li L, Yu H, Wang B. TLR3 regulates PD-L1 expression in human cytomegalovirus infected glioblastoma. INTERNATIONAL JOURNAL OF CLINICAL AND EXPERIMENTAL PATHOLOGY 2018; 11:5318-5326. [PMID: 31949612 PMCID: PMC6963014] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Subscribe] [Scholar Register] [Received: 09/16/2018] [Accepted: 10/25/2018] [Indexed: 06/10/2023]
Abstract
Glioblastoma, the most common primary brain tumor of adults, is characterized by poor survival rates. Programmed death ligand 1 (PD-L1, CD274) has been implicated in the immune escape of glioblastoma. The presence of human cytomegalovirus (HCMV) in glioblastoma multiforme (GBM) has sparked considerable interest and controversy. The exposure of toll-like receptor 3 (TLR3) to pathogens induces an antiviral state in cells or in animals. In the current study, the expression of PD-L1 and TLR3 in HCMV-infected glioma specimens was observed to be higher compared to the control. We therefore investigated if PD-L1 expression in glioblastoma is mediated by TLR3 triggering in HCMV infected glioblastoma. TLR3 siRNA transfections were utilized to identify the induction of PD-L1 via TLR3 triggering in HCMV infected cell lines. Also, IL-8 and TGF-β were detected by ELISA for the antitumor role of TLR3. Thus, we propose a novel immune treatment using a combination of PD-L1 blockade with TLR3 triggering against HCMV infected glioblastoma.
Collapse
Affiliation(s)
- Ziying Qin
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Li Zhang
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Yujiao Xu
- Qingdao Hospital of Integrated Traditional and Western MedicineQingdao, Shandong, PR China
| | - Xianjuan Zhang
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Xiaolu Fang
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Dongmeng Qian
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Xiaoke Liu
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Ting Liu
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Ling Li
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Hong Yu
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| | - Bin Wang
- Department of Pathogenic Biology, Qingdao University Medical CollegeQingdao, Shandong, PR China
| |
Collapse
|
|
40
|
Rahman M, Dastmalchi F, Karachi A, Mitchell D. The role of CMV in glioblastoma and implications for immunotherapeutic strategies. Oncoimmunology 2018; 8:e1514921. [PMID: 30546954 PMCID: PMC6287786 DOI: 10.1080/2162402x.2018.1514921] [Citation(s) in RCA: 41] [Impact Index Per Article: 5.9] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/24/2018] [Revised: 08/09/2018] [Accepted: 08/17/2018] [Indexed: 12/27/2022] Open
Abstract
Controversy surrounds the role of cytomegalovirus (CMV) in glioblastoma (GBM). However, several studies have shown that CMV nucleic acids and proteins are present within GBM tumor tissue. CMV has been implicated in GBM pathogenesis by affecting tumor stem cell factors, angiogenesis and immune pathways. Anti-viral therapy has not been found to definitively improve outcomes for patients with GBM. Several studies have leveraged CMV by targeting CMV antigens using ex-vivo expanded T cells or dendritic cell vaccines. The initial results from these studies are promising and larger studies are underway.
Collapse
Affiliation(s)
- Maryam Rahman
- Lillian S. Wells Department of Neurosurgery, UF Brain Tumor Immunotherapy Program, Preston A. Wells, Jr. Center for Brain Tumor Therapy, University of Florida, Gainesville, FL, USA
| | - Farhad Dastmalchi
- Lillian S. Wells Department of Neurosurgery, UF Brain Tumor Immunotherapy Program, Preston A. Wells, Jr. Center for Brain Tumor Therapy, University of Florida, Gainesville, FL, USA
| | - Aida Karachi
- Lillian S. Wells Department of Neurosurgery, UF Brain Tumor Immunotherapy Program, Preston A. Wells, Jr. Center for Brain Tumor Therapy, University of Florida, Gainesville, FL, USA
| | - Duane Mitchell
- Lillian S. Wells Department of Neurosurgery, UF Brain Tumor Immunotherapy Program, Preston A. Wells, Jr. Center for Brain Tumor Therapy, University of Florida, Gainesville, FL, USA
| |
Collapse
|
|
41
|
|
|
42
|
Luo XH, Meng Q, Rao M, Liu Z, Paraschoudi G, Dodoo E, Maeurer M. The impact of inflationary cytomegalovirus-specific memory T cells on anti-tumour immune responses in patients with cancer. Immunology 2018; 155:294-308. [PMID: 30098205 DOI: 10.1111/imm.12991] [Citation(s) in RCA: 23] [Impact Index Per Article: 3.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/25/2018] [Revised: 07/12/2018] [Accepted: 07/20/2018] [Indexed: 12/15/2022] Open
Abstract
Human cytomegalovirus (CMV) is a ubiquitous, persistent beta herpesvirus. CMV infection contributes to the accumulation of functional antigen-specific CD8+ T-cell pools with an effector-memory phenotype and enrichment of these immune cells in peripheral organs. We review here this 'memory T-cell inflation' phenomenon and associated factors including age and sex. 'Collateral damage' due to CMV-directed immune reactivity may occur in later stages of life - arising from CMV-specific immune responses that were beneficial in earlier life. CMV may be considered an age-dependent immunomodulator and a double-edged sword in editing anti-tumour immune responses. Emerging evidence suggests that CMV is highly prevalent in patients with a variety of cancers, particularly glioblastoma. A better understanding of CMV-associated immune responses and its implications for immune senescence, especially in patients with cancer, may aid in the design of more clinically relevant and tailored, personalized treatment regimens. 'Memory T-cell inflation' could be applied in vaccine development strategies to enrich for immune reactivity where long-term immunological memory is needed, e.g. in long-term immune memory formation directed against transformed cells.
Collapse
Affiliation(s)
- Xiao-Hua Luo
- Therapeutic Immunology Unit, Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden.,Department of Haematology, The First Affiliated Hospital of Chongqing Medical University, Yuzhong District, Chongqing, China
| | - Qingda Meng
- Therapeutic Immunology Unit, Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden
| | - Martin Rao
- Therapeutic Immunology Unit, Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden
| | - Zhenjiang Liu
- Therapeutic Immunology Unit, Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden
| | - Georgia Paraschoudi
- Therapeutic Immunology Unit, Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden
| | - Ernest Dodoo
- Therapeutic Immunology Unit, Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden.,Department of Neurosurgery, Karolinska University Hospital, Stockholm, Sweden
| | - Markus Maeurer
- Therapeutic Immunology Unit, Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden.,Centre for Allogeneic Stem Cell Transplantation, Karolinska University Hospital, Stockholm, Sweden
| |
Collapse
|
|
43
|
Cuoco JA, Benko MJ, Busch CM, Rogers CM, Prickett JT, Marvin EA. Vaccine-Based Immunotherapeutics for the Treatment of Glioblastoma: Advances, Challenges, and Future Perspectives. World Neurosurg 2018; 120:302-315. [PMID: 30196171 DOI: 10.1016/j.wneu.2018.08.202] [Citation(s) in RCA: 17] [Impact Index Per Article: 2.4] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/11/2018] [Revised: 08/24/2018] [Accepted: 08/27/2018] [Indexed: 02/06/2023]
Abstract
Glioblastoma is a highly aggressive neoplasm with an extremely poor prognosis. Despite maximal gross resection and chemoradiotherapy, these grade IV astrocytomas consistently recur. Glioblastoma cells exhibit numerous pathogenic mechanisms to decrease tumor immunogenicity while promoting gliomagenesis, which manifests clinically as a median survival of less than 2 years and few long-term survivors. Recent clinical trials of vaccine-based immunotherapeutics against glioblastoma have demonstrated encouraging results in prolonging progression-free survival and overall survival. Several vaccine-based treatments have been trialed, such as peptide and heat-shock proteins, dendritic cell-based vaccines, and viral-based immunotherapy. In this literature review, we discuss the immunobiology of glioblastoma, significant current and completed vaccine-based immunotherapy clinical trials, and broad clinical challenges and future directions of glioblastoma vaccine-based immunotherapeutics.
Collapse
Affiliation(s)
- Joshua A Cuoco
- New York Institute of Technology College of Osteopathic Medicine, Glen Head, New York, USA.
| | - Michael J Benko
- Carilion Clinic, Section of Neurosurgery, Roanoke, Virginia, USA; Virginia Tech Carilion School of Medicine, Roanoke, Virginia, USA; Virginia Tech School of Neuroscience, Blacksburg, Virginia, USA; Edward Via College of Osteopathic Medicine, Blacksburg, Virginia, USA
| | - Christopher M Busch
- Carilion Clinic, Section of Neurosurgery, Roanoke, Virginia, USA; Virginia Tech Carilion School of Medicine, Roanoke, Virginia, USA; Virginia Tech School of Neuroscience, Blacksburg, Virginia, USA; Edward Via College of Osteopathic Medicine, Blacksburg, Virginia, USA
| | - Cara M Rogers
- Carilion Clinic, Section of Neurosurgery, Roanoke, Virginia, USA; Virginia Tech Carilion School of Medicine, Roanoke, Virginia, USA; Virginia Tech School of Neuroscience, Blacksburg, Virginia, USA; Edward Via College of Osteopathic Medicine, Blacksburg, Virginia, USA
| | - Joshua T Prickett
- Carilion Clinic, Section of Neurosurgery, Roanoke, Virginia, USA; Virginia Tech Carilion School of Medicine, Roanoke, Virginia, USA; Virginia Tech School of Neuroscience, Blacksburg, Virginia, USA; Edward Via College of Osteopathic Medicine, Blacksburg, Virginia, USA
| | - Eric A Marvin
- Carilion Clinic, Section of Neurosurgery, Roanoke, Virginia, USA; Virginia Tech Carilion School of Medicine, Roanoke, Virginia, USA; Virginia Tech School of Neuroscience, Blacksburg, Virginia, USA; Edward Via College of Osteopathic Medicine, Blacksburg, Virginia, USA
| |
Collapse
|
|
44
|
Deshpande RP, Panigrahi M, Y B V K C, Babu PP. Profiling of microRNAs modulating cytomegalovirus infection in astrocytoma patients. Neurol Sci 2018; 39:1895-1902. [PMID: 30090984 DOI: 10.1007/s10072-018-3518-8] [Citation(s) in RCA: 16] [Impact Index Per Article: 2.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/19/2018] [Accepted: 07/31/2018] [Indexed: 01/23/2023]
Abstract
Astrocytoma is recognized as the most common neoplasm of the brain with aggressive progression. The therapeutic regime for glioblastoma, the most aggressive astrocytoma, often consists of aggressive chemo and radiotherapy. The present holistic approaches, however, have failed to influence the quality life of patients. Therefore, it is necessary to understand the underlying mechanisms of its progression for updated therapeutic evaluation. Human cytomegalovirus (HCMV) is reported to be associated with glioblastoma progression. The hypothesis still remains controversial due to the lack of concrete evidences. Here, we report the profile of miRNAs encoded by human host and the cytomegalovirus (CMV) involved in modulation of CMV infection in surgically resected human astrocytoma tissue samples of various malignancy grades (n = 24). Total RNA from the control brain and tumor tissues was extracted by TriZol reagent. The expression levels of the mature form of miRNA were detected by real-time PCR. Primarily, we found the upregulation of miR-210-3p, miR-155-5p, miR-UL-112-3p, miR-183-5p, and miR-223-5p in high-grade astrocytic tumors as compared with low-grade tumor tissues. miR-214-3p is significantly expressed in control brain tissues and its expression decreased with astrocytoma grade progression. This miRNA was reported to be associated with antiviral proprieties. Among CMV-encoded miRNA, miR-UL-112-3p was significantly upregulated in glioblastoma tissue samples and may be involved in providing immune escape to the virus as well as involved in modulating the immune microenvironment of glioblastoma. Taken together, we conclude the possible involvement of miRNAs in modulating the CMV dependent astrocytoma progression.
Collapse
Affiliation(s)
- Ravindra Pramod Deshpande
- Department of Biotechnology and Bioinformatics, School of Life Sciences, University of Hyderabad, Hyderabad, Telangana State, 500046, India
| | - Manas Panigrahi
- Krishna Institute of Medical Sciences, Secunderabad, Telangana State, India
| | | | - Phanithi Prakash Babu
- Department of Biotechnology and Bioinformatics, School of Life Sciences, University of Hyderabad, Hyderabad, Telangana State, 500046, India.
| |
Collapse
|
|
45
|
The Human Cytomegalovirus, from Oncomodulation to Oncogenesis. Viruses 2018; 10:v10080408. [PMID: 30081496 PMCID: PMC6115842 DOI: 10.3390/v10080408] [Citation(s) in RCA: 119] [Impact Index Per Article: 17.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/30/2018] [Revised: 07/30/2018] [Accepted: 08/01/2018] [Indexed: 12/13/2022] Open
Abstract
Besides its well-described impact in immunosuppressed patients, the role of human cytomegalovirus (HCMV) in the pathogenesis of cancer has been more recently investigated. In cancer, HCMV could favor the progression and the spread of the tumor, a paradigm named oncomodulation. Although oncomodulation could account for part of the protumoral effect of HCMV, it might not explain the whole impact of HCMV infection on the tumor and the tumoral microenvironment. On the contrary cases have been reported where HCMV infection slows down the progression and the spread of the tumor. In addition, HCMV proteins have oncogenic properties per se, HCMV activates pro-oncogenic pathways in infected cells, and recently the direct transformation of cells following HCMV infection has been described, which gave rise to tumors when injected in mice. Thus, beyond the oncomodulation model, this review will assess the direct transforming role of HMCV-infected cells and the potential classification of HCMV as an oncovirus.
Collapse
|
|
46
|
Human Cytomegalovirus Productively Replicates In Vitro in Undifferentiated Oral Epithelial Cells. J Virol 2018; 92:JVI.00903-18. [PMID: 29848590 DOI: 10.1128/jvi.00903-18] [Citation(s) in RCA: 8] [Impact Index Per Article: 1.1] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/23/2018] [Accepted: 05/23/2018] [Indexed: 12/12/2022] Open
Abstract
Human cytomegalovirus (HCMV) productive replication in vitro is most often studied in fibroblasts. In vivo, fibroblasts amplify viral titers, but transmission and pathogenesis require the infection of other cell types, most notably epithelial cells. In vitro, the study of HCMV infection of epithelial cells has been almost exclusively restricted to ocular epithelial cells. Here we present oral epithelial cells with relevance for viral interhost transmission as an in vitro model system to study HCMV infection. We discovered that HCMV productively replicates in normal oral keratinocytes (NOKs) and telomerase-immortalized gingival cells (hGETs). Our work introduces oral epithelial cells for the study of HCMV productive infection, drug screening, and vaccine development.IMPORTANCE The ocular epithelial cells currently used to study HCMV infections in vitro have historical significance based upon their role in retinitis, an HCMV disease most often seen in AIDS patients. However, with the successful implementation of highly active antiretroviral therapy (HAART) regimens, the incidence of HCMV retinitis has rapidly declined, and therefore, the relevance of studying ocular epithelial cell HCMV infection has decreased as well. Our introduction here of oral epithelial cells provides two alternative in vitro models for the study of HCMV infection that complement and extend the physiologic relevance of the ocular system currently in use.
Collapse
|
|
47
|
Abstract
Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.
Collapse
|
|
48
|
Rajagopalan D, Jha S. An epi(c)genetic war: Pathogens, cancer and human genome. Biochim Biophys Acta Rev Cancer 2018; 1869:333-345. [DOI: 10.1016/j.bbcan.2018.04.003] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/29/2017] [Revised: 03/22/2018] [Accepted: 04/09/2018] [Indexed: 02/08/2023]
|
|
49
|
Hu M, Wang B, Qian D, Wang M, Huang R, Wei L, Li L, Zhang L, Liu DX. Human cytomegalovirus immediate-early protein promotes survival of glioma cells through interacting and acetylating ATF5. Oncotarget 2018; 8:32157-32170. [PMID: 28473657 PMCID: PMC5458275 DOI: 10.18632/oncotarget.17150] [Citation(s) in RCA: 16] [Impact Index Per Article: 2.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/08/2017] [Accepted: 04/03/2017] [Indexed: 01/03/2023] Open
Abstract
Human cytomegalovirus (HCMV), a widespread beta-herpes virus, infects a high percentage of gliomas. HCMV is specifically detected in human gliomas at a low level of expression raises the possibility that it may regulate the malignant phenotype in a chronic manner. Although HCMV is not recognized as an oncogenic virus, it might dysregulate signaling pathways involved in initiation and promotion of malignancy.Here, our immunohistochemical staining reveals that nucleus staining of the HCMV 86-kDa immediate-early protein (IE86) is markedly increased in GBM (58.56%) compared with that in nontumorous samples (4.20%) and low-grade glioma(19.56%). IE86 staining positively correlates with the staining of activating transcription factor 5 (ATF5) which is essential for glioma cell viability and proliferation suggesting that HCMV IE86 could have important implications in glioma biology. Moreover, we find that the IE86 overexpression enhances glioma cell's growth in vitro and in vivo. We demonstrate that IE86 protein physically interacts with, and acetylates ATF5 thereby promoting glioma cell survival. Therefore, our findings illustrate the biological significance of HCMV infection in accelerating glioma progression, and provide novel evidence that HCMV infection may serve as a therapeutic target in human glioma.
Collapse
Affiliation(s)
- Ming Hu
- Department of Basic Medical Sciences, Qingdao University, Qingdao 266071, China
| | - Bin Wang
- Department of Basic Medical Sciences, Qingdao University, Qingdao 266071, China
| | - Dongmeng Qian
- Department of Basic Medical Sciences, Qingdao University, Qingdao 266071, China
| | - Mengyuan Wang
- College of life sciences, Qingdao University, Qingdao 266071, China
| | - Rui Huang
- Department of Basic Medical Sciences, Qingdao University, Qingdao 266071, China
| | - Li Wei
- The Hospital of People's Liberation Army, Weifang 261000, China
| | - Ling Li
- Department of Basic Medical Sciences, Qingdao University, Qingdao 266071, China
| | - Li Zhang
- Department of Basic Medical Sciences, Qingdao University, Qingdao 266071, China
| | - David X Liu
- Department of Pharmaceutical Sciences, Washington State University College of Pharmacy, Spokane, WA 992082, USA
| |
Collapse
|
|
50
|
Umaña AC, Iwahori S, Kalejta RF. Direct Substrate Identification with an Analog Sensitive (AS) Viral Cyclin-Dependent Kinase (v-Cdk). ACS Chem Biol 2018; 13:189-199. [PMID: 29215867 DOI: 10.1021/acschembio.7b00972] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.6] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/30/2022]
Abstract
Viral cyclin-dependent kinases (v-Cdks) functionally emulate their cellular Cdk counterparts. Such viral mimicry is an established phenomenon that we extend here through chemical genetics. Kinases contain gatekeeper residues that limit the size of molecules that can be accommodated within the enzyme active site. Mutating gatekeeper residues to smaller amino acids allows larger molecules access to the active site. Such mutants can utilize bio-orthoganol ATPs for phosphate transfer and are inhibited by compounds ineffective against the wild type protein, and thus are referred to as analog-sensitive (AS) kinases. We identified the gatekeeper residues of the v-Cdks encoded by Epstein-Barr virus (EBV) and human cytomegalovirus (HCMV) and mutated them to generate AS kinases. The AS-v-Cdks are functional and utilize different ATP derivatives with a specificity closely matching their cellular ortholog, AS-Cdk2. The AS derivative of the EBV v-Cdk was used to transfer a thiolated phosphate group to targeted proteins which were then purified through covalent capture and identified by mass spectrometry. Pathway analysis of these newly identified direct substrates of the EBV v-Cdk extends the potential influence of this kinase into all stages of gene expression (transcription, splicing, mRNA export, and translation). Our work demonstrates the biochemical similarity of the cellular and viral Cdks, as well as the utility of AS v-Cdks for substrate identification to increase our understanding of both viral infections and Cdk biology.
Collapse
Affiliation(s)
- Angie C. Umaña
- Institute for Molecular Virology
and McArdle Laboratory for Cancer Research, University of Wisconsin—Madison, Madison, Wisconsin 53706, United States
| | - Satoko Iwahori
- Institute for Molecular Virology
and McArdle Laboratory for Cancer Research, University of Wisconsin—Madison, Madison, Wisconsin 53706, United States
| | - Robert F. Kalejta
- Institute for Molecular Virology
and McArdle Laboratory for Cancer Research, University of Wisconsin—Madison, Madison, Wisconsin 53706, United States
| |
Collapse
|