|
1
|
Borsotti E, Nava FL, Benedicenti F, Cini L, Magarotto A, Ferrari D, Cantù P, Vitellaro M, Rausa E, Cavalcoli F. Hereditary Colorectal Cancer Syndromes: Small Bowel Cancer Risk and Endoscopic Surveillance Strategies. Diagnostics (Basel) 2025; 15:819. [PMID: 40218169 PMCID: PMC11988710 DOI: 10.3390/diagnostics15070819] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/10/2025] [Revised: 03/05/2025] [Accepted: 03/20/2025] [Indexed: 04/14/2025] Open
Abstract
Background: Hereditary colorectal cancer syndromes, including familial adenomatous polyposis (FAP), Lynch syndrome (LS), and Peutz-Jeghers syndrome (PJS), are associated with an increased risk of small bowel cancer (SBC). Due to the low incidence and non-specific presentation of SBC, effective surveillance strategies are essential for early detection and management. This review aims to evaluate and compare current endoscopic techniques for small bowel surveillance in these patients. Methods: A comprehensive review was conducted using peer-reviewed studies sourced from PubMed. Various endoscopic modalities, including capsule endoscopy (CE), device-assisted enteroscopy (DAE), and intraoperative enteroscopy (IOE), were assessed for their diagnostic yield, safety, and clinical utility. Surveillance recommendations of the different syndromes were also examined. Results: CE offers high sensitivity but lacks histological sampling capability. DAE, including double-balloon enteroscopy (DBE) and single-balloon enteroscopy (SBE), enables direct visualization, biopsy, and therapeutic interventions, albeit with greater procedural complexity. In FAP, duodenal surveillance follows the Spigelman classification to stratify cancer risk, while jejunal and ileal polyps remain less studied. LS patients have an increased SBC risk, warranting tailored endoscopic approaches. In PJS, surveillance aims to mitigate intussusception risks and allow early malignancy detection. Conclusions: Optimized surveillance strategies in hereditary colorectal cancer syndromes require a multimodal approach, integrating advanced endoscopic techniques with genetic risk stratification. Centralized care in tertiary centers improves outcomes by ensuring standardized surveillance protocols and enhancing early cancer detection. Artificial intelligence (AI) applied to CE and DAE is shaping promising prospects for the future surveillance of small bowel polyps by enhancing diagnostic accuracy and reducing the duration of the diagnostic process. Further research should investigate AI-assisted imaging and molecular biomarkers to optimize screening strategies.
Collapse
Affiliation(s)
- Edoardo Borsotti
- Gastroenterology and Digestive Endoscopy Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (E.B.); (L.C.); (A.M.); (P.C.); (F.C.)
| | - Francesca Laura Nava
- Colorectal Surgery Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, 20133 Milan, Italy;
| | - Felice Benedicenti
- Gastroenterology and Digestive Endoscopy Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (E.B.); (L.C.); (A.M.); (P.C.); (F.C.)
| | - Laura Cini
- Gastroenterology and Digestive Endoscopy Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (E.B.); (L.C.); (A.M.); (P.C.); (F.C.)
| | - Andrea Magarotto
- Gastroenterology and Digestive Endoscopy Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (E.B.); (L.C.); (A.M.); (P.C.); (F.C.)
| | - Davide Ferrari
- Unit of Hereditary Digestive Tract Tumors, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (D.F.); (M.V.); (E.R.)
| | - Paolo Cantù
- Gastroenterology and Digestive Endoscopy Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (E.B.); (L.C.); (A.M.); (P.C.); (F.C.)
| | - Marco Vitellaro
- Unit of Hereditary Digestive Tract Tumors, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (D.F.); (M.V.); (E.R.)
| | - Emanuele Rausa
- Unit of Hereditary Digestive Tract Tumors, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (D.F.); (M.V.); (E.R.)
| | - Federica Cavalcoli
- Gastroenterology and Digestive Endoscopy Unit, Fondazione IRCCS Istituto Nazionale dei Tumori, Via Venezian 1, 20133 Milan, Italy; (E.B.); (L.C.); (A.M.); (P.C.); (F.C.)
| |
Collapse
|
|
2
|
Martinov Nestorov J, Sokic-Milutinovic A, Pavlovic Markovic A, Krstic M. Could Capsule Endoscopy Be Useful in Detection of Suspected Small Bowel Bleeding and IBD-10 Years of Single Center Experience. Diagnostics (Basel) 2024; 14:862. [PMID: 38732278 PMCID: PMC11083052 DOI: 10.3390/diagnostics14090862] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/16/2024] [Revised: 04/12/2024] [Accepted: 04/14/2024] [Indexed: 05/13/2024] Open
Abstract
A retrospective study in patients who underwent video capsule endoscopy (VCE) between 2006 and 2016 was conducted in the Clinic for gastroenterology and Hepatology, University Clinical Center of Serbia. A total of 245 patients underwent VCE. In 198 patients the indication was obscure gastrointestinal bleeding (OGIB), with 92 patients having overt and the other 106 occult bleeding. The remaining 47 patients underwent VCE due to suspected small bowel (SB) disease (i.e., Von Hippel-Lindau syndrome, familial adenomatous polyposis, Peutz Jeghers syndrome, Crohn's disease, prolonged diarrhea, abdominal pain, congenital lymphangiectasia, protein-losing enteropathy, tumors, refractory celiac disease, etc.). VCE identified a source of bleeding in 38.9% of patients (in the obscure overt group in 48.9% of patients, and in the obscure occult group in 30.2% of patients). The most common findings were angiodysplasias, tumors, Meckel's diverticulum and Crohn's disease. In the smaller group of patients with an indication other than OGIB, 38.3% of patients had positive VCE findings. The most common indication is OGIB, and the best candidates are patients with overt bleeding; patients with IBD should be evaluated in this setting.
Collapse
Affiliation(s)
- Jelena Martinov Nestorov
- School of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (A.S.-M.); (A.P.M.); (M.K.)
- Clinic for Gastroenterology and Hepatology, University Clinical Center of Serbia, 11000 Belgrade, Serbia
| | - Aleksandra Sokic-Milutinovic
- School of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (A.S.-M.); (A.P.M.); (M.K.)
- Clinic for Gastroenterology and Hepatology, University Clinical Center of Serbia, 11000 Belgrade, Serbia
| | - Aleksandra Pavlovic Markovic
- School of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (A.S.-M.); (A.P.M.); (M.K.)
- Clinic for Gastroenterology and Hepatology, University Clinical Center of Serbia, 11000 Belgrade, Serbia
| | - Miodrag Krstic
- School of Medicine, University of Belgrade, 11000 Belgrade, Serbia; (A.S.-M.); (A.P.M.); (M.K.)
- Clinic for Gastroenterology and Hepatology, University Clinical Center of Serbia, 11000 Belgrade, Serbia
| |
Collapse
|
|
3
|
Sanchez-Mete L, Mosciatti L, Casadio M, Vittori L, Martayan A, Stigliano V. MUTYH-associated polyposis: Is it time to change upper gastrointestinal surveillance? A single-center case series and a literature overview. World J Gastrointest Oncol 2023; 15:1891-1899. [DOI: 10.4251/wjgo.v15.i11.1891] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 02/13/2023] [Revised: 05/28/2023] [Accepted: 06/13/2023] [Indexed: 11/15/2023] Open
Abstract
BACKGROUND The presence of Spigelman stage (SS) IV duodenal polyposis is considered the most significant risk factor for duodenal cancer in patients with MUTYH-associated polyposis (MAP). However, advanced SS disease is rarely reported in MAP patients, and no clear recommendations on small bowel (SB) surveillance have been proposed in this patient setting.
AIM To research more because that case reports of duodenal cancers in MAP suggest that they may develop in the absence of advanced benign SS disease and often involve the distal portion of the duodenum.
METHODS We describe a series of MAP patients followed up at the Regina Elena National Cancer Institute of Rome (Italy). A literature overview on previously reported SB cancers in MAP is also provided.
RESULTS We identified two (6%) SB adenocarcinomas with no previous history of duodenal polyposis. Our observations, supported by literature evidence, suggest that the formula for staging duodenal polyposis and predicting risk factors for distal duodenum and jejunal cancer may need to be adjusted to take this into account rather than focusing solely on the presence or absence of SS IV disease.
CONCLUSION Our study emphasizes the need for further studies to define appropriate upper gastrointestinal surveillance programs in MAP patients.
Collapse
Affiliation(s)
- Lupe Sanchez-Mete
- Gastroenterology and Digestive Endoscopy, Regina Elena National Cancer Institute, IRCCS, Rome 00144, Italy
| | - Lorenzo Mosciatti
- Gastroenterology and Digestive Endoscopy, Regina Elena National Cancer Institute, IRCCS, Rome 00144, Italy
| | - Marco Casadio
- Gastroenterology and Digestive Endoscopy, Regina Elena National Cancer Institute, IRCCS, Rome 00144, Italy
| | - Luigi Vittori
- Department of Radiological, Oncological and Pathological Sciences, Regina Elena National Cancer Institute, IRCCS, Rome 00144, Italy
| | - Aline Martayan
- Gastroenterology and Digestive Endoscopy, Regina Elena National Cancer Institute, IRCCS, Rome 00144, Italy
| | - Vittoria Stigliano
- Gastroenterology and Digestive Endoscopy, Regina Elena National Cancer Institute, IRCCS, Rome 00144, Italy
| |
Collapse
|
|
4
|
Stone JK, Mehta NA, Singh H, El-Matary W, Bernstein CN. Endoscopic and chemopreventive management of familial adenomatous polyposis syndrome. Fam Cancer 2023; 22:413-422. [PMID: 37119510 DOI: 10.1007/s10689-023-00334-3] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/23/2023] [Accepted: 04/18/2023] [Indexed: 05/01/2023]
Abstract
Familial adenomatous polyposis (FAP) is an autosomal dominant syndrome predisposing affected individuals to gastrointestinal (GI) cancers through a high burden of polyposis. Colorectal cancer rates reach 100% by the age of 45, making early colectomy a mainstay of treatment. While most patients undergo colectomy at an early age, ongoing screening and surveillance of the upper gastrointestinal tract and rectal pouch must continue throughout adulthood. Endoscopic therapy of gastric, duodenal, ampullary and rectal pouch polyps is critical to reduce morbidity and cancer related mortality. Management of these lesions is not uniform, and is dependent on their location, size, histology, and risk of malignant potential. Medical therapies targeting pathways that reduce the malignant progression of pre-cancerous lesions have been studied for many years. While studies on the use of aspirin and non-steroidal anti-inflammatories (NSAIDs) in chemoprevention have shown encouraging results in Lynch syndrome and primary colorectal cancer, the potential benefits of these medications have not been duplicated in FAP cohorts. While data remains limited on chemoprevention in FAP, a number of randomized trials are currently underway examining targeted therapies with the potential to slow the progression of the disease. This review aims to provide an in-depth review of the literature on current endoscopic options and chemopreventive therapies targeting FAP. While the endoscopic management has robust data for its use, chemoprevention in FAP is still in its infancy. The complementary use of chemopreventive agents and endoscopic therapy for FAP patients is quickly becoming a growing and exciting area of research.
Collapse
Affiliation(s)
- J K Stone
- Section of Gastroenterology, Department of Medicine, Max Rady College of Medicine, University of Manitoba, Winnipeg, MB, Canada.
| | - N A Mehta
- Center for Interventional and Therapeutic Endoscopy, Digestive Diseases and Nutrition, Rush University Medical Center, Chicago, IL, USA
| | - H Singh
- Section of Gastroenterology, Department of Medicine, Max Rady College of Medicine, University of Manitoba, Winnipeg, MB, Canada
- Research Institute, CancerCare Manitoba, Winnipeg, MB, Canada
| | - W El-Matary
- Section of Pediatric Gastroenterology, Department of Pediatrics, Max Rady College of Medicine, Winnipeg, MB, Canada
| | - C N Bernstein
- Section of Gastroenterology, Department of Medicine, Max Rady College of Medicine, University of Manitoba, Winnipeg, MB, Canada
| |
Collapse
|
|
5
|
Krasaelap A, Lerner DG, Oliva S. The Role of Endoscopy in the Diagnosis and Management of Small Bowel Pathology in Children. Gastrointest Endosc Clin N Am 2023; 33:423-445. [PMID: 36948754 DOI: 10.1016/j.giec.2022.11.007] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 03/24/2023]
Abstract
Small bowel evaluation has been transformed by capsule endoscopy and advances in small bowel imaging, which provide reliable and noninvasive means for assessing the mucosal surface. Device-assisted enteroscopy has been critical for histopathological confirmation and endoscopic therapy for a wide range of small bowel pathology that conventional endoscopy cannot reach. The purpose of this review is to provide a comprehensive overview of the indications, techniques, and clinical applications of capsule endoscopy; device-assisted enteroscopy; and imaging studies for small bowel evaluation in children.
Collapse
Affiliation(s)
- Amornluck Krasaelap
- Division of Pediatric Gastroenterology, Hepatology and Nutrition, Children's Mercy Hospital, 2401 Gillham Road, Kansas City, MO 64108, USA.
| | - Diana G Lerner
- Division of Pediatric Gastroenterology, Department of Pediatrics, Hepatology and Nutrition, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226, USA
| | - Salvatore Oliva
- Maternal and Child Health Department, Pediatric Gastroenterology and Liver Unit, Sapienza - University of Rome, Piazzale Aldo Moro, 5 00185, Roma, RM, Italy
| |
Collapse
|
|
6
|
Lu B. Image Aided Recognition of Wireless Capsule Endoscope Based on the Neural Network. JOURNAL OF HEALTHCARE ENGINEERING 2022; 2022:3880356. [PMID: 35432820 PMCID: PMC9010152 DOI: 10.1155/2022/3880356] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 01/19/2022] [Accepted: 03/22/2022] [Indexed: 11/18/2022]
Abstract
Wireless capsule endoscopy is an important method for diagnosing small bowel diseases, but it will collect thousands of endoscopy images that need to be diagnosed. The analysis of these images requires a huge workload and may cause manual reading errors. This article attempts to use neural networks instead of artificial endoscopic image analysis to assist doctors in diagnosing and treating endoscopic images. First, in image preprocessing, the image is converted from RGB color mode to lab color mode, texture features are extracted for network training, and finally, the accuracy of the algorithm is verified. After inputting the retained endoscopic image verification set into the neural network algorithm, the conclusion is that the accuracy of the neural network model constructed in this study is 97.69%, which can effectively distinguish normal, benign lesions, and malignant tumors. Experimental studies have proved that the neural network algorithm can effectively assist the endoscopist's diagnosis and improve the diagnosis efficiency. This research hopes to provide a reference for the application of neural network algorithms in the field of endoscopic images.
Collapse
Affiliation(s)
- Bin Lu
- Department of Gastrointestinal Surgery, Affiliated Hospital of Shaoxing University (The Shaoxing Municipal Hospital), Shaoxing 312000, China
| |
Collapse
|
|
7
|
Tanaka K, Sato Y, Ishikawa H, Muguruma N, Teramae S, Takeuchi Y, Mitsui Y, Okamoto K, Miyamoto H, Bando Y, Sonoda T, Ohmiya N, Mutoh M, Takayama T. Small Intestinal Involvement and Genotype-Phenotype Correlation in Familial Adenomatous Polyposis. TECHNIQUES AND INNOVATIONS IN GASTROINTESTINAL ENDOSCOPY 2022; 24:26-34. [DOI: 10.1016/j.tige.2021.10.001] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 04/15/2025]
|
|
8
|
Klimkowski S, Ibrahim M, Ibarra Rovira JJ, Elshikh M, Javadi S, Klekers AR, Abusaif AA, Moawad AW, Ali K, Elsayes KM. Peutz-Jeghers Syndrome and the Role of Imaging: Pathophysiology, Diagnosis, and Associated Cancers. Cancers (Basel) 2021; 13:cancers13205121. [PMID: 34680270 PMCID: PMC8533703 DOI: 10.3390/cancers13205121] [Citation(s) in RCA: 25] [Impact Index Per Article: 6.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/09/2021] [Revised: 10/07/2021] [Accepted: 10/08/2021] [Indexed: 02/03/2023] Open
Abstract
Simple Summary The Peutz-Jeghers Syndrome is a rare autosomal dominant syndrome characterized by mucocutaneous pigmentations, multiple gastrointestinal hamartomatous polyps, and an elevated risk of malignancy. Awareness of various Peutz-Jeghers Syndrome imaging patterns, associated malignancies, and their complications is crucial for accurate imaging interpretation and patient management. In this manuscript, we provide an overview of this condition, associated malignancies, and imaging surveillance protocols. Abstract The Peutz-Jeghers Syndrome (PJS) is an autosomal dominant neoplastic syndrome defined by hamartomatous polyps through the gastrointestinal tract, development of characteristic mucocutaneous pigmentations, and an elevated lifetime cancer risk. The majority of cases are due to a mutation in the STK11 gene located at 19p13.3. The estimated incidence of PJS ranges from 1:50,000 to 1:200,000. PJS carries an elevated risk of malignancies including gastrointestinal, breast, lung, and genitourinary (GU) neoplasms. Patients with PJS are at a 15- to 18-fold increased malignancy risk relative to the general population. Radiologists have an integral role in the diagnosis of these patients. Various imaging modalities are used to screen for malignancies and complications associated with PJS. Awareness of various PJS imaging patterns, associated malignancies, and their complications is crucial for accurate imaging interpretation and patient management. In this manuscript, we provide a comprehensive overview of PJS, associated malignancies, and surveillance protocols.
Collapse
Affiliation(s)
- Sergio Klimkowski
- Department of Abdominal Imaging, The University of Texas MD Anderson Cancer Center, Houston, TX 77555, USA; (J.J.I.R.); (S.J.); (A.R.K.); (A.A.A.)
- Correspondence: (S.K.); (K.M.E.)
| | - Mohamed Ibrahim
- Department of Diagnostic and Interventional Radiology, University of Kansas-Wichita, Wichita, KS 67214, USA; (M.I.); (K.A.)
| | - Juan J. Ibarra Rovira
- Department of Abdominal Imaging, The University of Texas MD Anderson Cancer Center, Houston, TX 77555, USA; (J.J.I.R.); (S.J.); (A.R.K.); (A.A.A.)
| | - Mohamed Elshikh
- Department of Diagnostic and Interventional Radiology, The University of Texas Medica Branch, Galveston, TX 77555, USA;
| | - Sanaz Javadi
- Department of Abdominal Imaging, The University of Texas MD Anderson Cancer Center, Houston, TX 77555, USA; (J.J.I.R.); (S.J.); (A.R.K.); (A.A.A.)
| | - Albert R. Klekers
- Department of Abdominal Imaging, The University of Texas MD Anderson Cancer Center, Houston, TX 77555, USA; (J.J.I.R.); (S.J.); (A.R.K.); (A.A.A.)
| | - Abdelraham A. Abusaif
- Department of Abdominal Imaging, The University of Texas MD Anderson Cancer Center, Houston, TX 77555, USA; (J.J.I.R.); (S.J.); (A.R.K.); (A.A.A.)
| | - Ahmed W. Moawad
- Department of Diagnostic and Interventional Radiology, Mercy Catholic Health System, Darby, PA 19023, USA;
| | - Kamran Ali
- Department of Diagnostic and Interventional Radiology, University of Kansas-Wichita, Wichita, KS 67214, USA; (M.I.); (K.A.)
| | - Khaled M. Elsayes
- Department of Abdominal Imaging, The University of Texas MD Anderson Cancer Center, Houston, TX 77555, USA; (J.J.I.R.); (S.J.); (A.R.K.); (A.A.A.)
- Correspondence: (S.K.); (K.M.E.)
| |
Collapse
|
|
9
|
Hong SM, Jung SH, Baek DH. Diagnostic Yields and Clinical Impacts of Capsule Endoscopy. Diagnostics (Basel) 2021; 11:diagnostics11101842. [PMID: 34679540 PMCID: PMC8534535 DOI: 10.3390/diagnostics11101842] [Citation(s) in RCA: 8] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/24/2021] [Revised: 09/28/2021] [Accepted: 09/29/2021] [Indexed: 12/12/2022] Open
Abstract
Observing the entire small bowel is difficult due to the presence of complex loops and a long length. Capsule endoscopy (CE) provides a noninvasive and patient-friendly method for visualizing the small bowel and colon. Small bowel capsule endoscopy (SBCE) has a critical role in the diagnosis of small bowel disorders through the direct observation of the entire small bowel mucosa and is becoming the primary diagnostic tool for small bowel diseases. Recently, colon capsule endoscopy (CCE) was also considered safe and feasible for obtaining sufficient colonic images in patients with incomplete colonoscopy, in the absence of bowel obstruction. This review article assesses the current status of CE in terms of the diagnostic yield and the clinical impact of SBCE in patients with obscure gastrointestinal bleeding, who have known or suspected Crohn's disease, small bowel tumor and inherited polyposis syndrome, celiac disease, and those who have undergone CCE.
Collapse
Affiliation(s)
- Seung Min Hong
- Department of Internal Medicine, Pusan National University School of Medicine, Busan 49421, Korea;
- Biomedical Research Institute, Pusan National University Hospital, Busan 49421, Korea
| | - Sung Hoon Jung
- Department of Internal Medicine, Eunpyeong St. Mary’s Hospital, College of Medicine, The Catholic University of Korea, Seoul 03312, Korea;
| | - Dong Hoon Baek
- Department of Internal Medicine, Pusan National University School of Medicine, Busan 49421, Korea;
- Biomedical Research Institute, Pusan National University Hospital, Busan 49421, Korea
- Correspondence: ; Tel./Fax: +82-51-2448180
| |
Collapse
|
|
10
|
Japanese Society for Cancer of the Colon and Rectum (JSCCR) guidelines 2020 for the Clinical Practice of Hereditary Colorectal Cancer. Int J Clin Oncol 2021; 26:1353-1419. [PMID: 34185173 PMCID: PMC8286959 DOI: 10.1007/s10147-021-01881-4] [Citation(s) in RCA: 93] [Impact Index Per Article: 23.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/23/2020] [Accepted: 01/10/2021] [Indexed: 12/14/2022]
Abstract
Hereditary colorectal cancer (HCRC) accounts for < 5% of all colorectal cancer cases. Some of the unique characteristics commonly encountered in HCRC cases include early age of onset, synchronous/metachronous cancer occurrence, and multiple cancers in other organs. These characteristics necessitate different management approaches, including diagnosis, treatment or surveillance, from sporadic colorectal cancer management. There are two representative HCRC, named familial adenomatous polyposis and Lynch syndrome. Other than these two HCRC syndromes, related disorders have also been reported. Several guidelines for hereditary disorders have already been published worldwide. In Japan, the first guideline for HCRC was prepared by the Japanese Society for Cancer of the Colon and Rectum (JSCCR), published in 2012 and revised in 2016. This revised version of the guideline was immediately translated into English and published in 2017. Since then, several new findings and novel disease concepts related to HCRC have been discovered. The currently diagnosed HCRC rate in daily clinical practice is relatively low; however, this is predicted to increase in the era of cancer genomic medicine, with the advancement of cancer multi-gene panel testing or whole genome testing, among others. Under these circumstances, the JSCCR guidelines 2020 for HCRC were prepared by consensus among members of the JSCCR HCRC Guideline Committee, based on a careful review of the evidence retrieved from literature searches, and considering the medical health insurance system and actual clinical practice settings in Japan. Herein, we present the English version of the JSCCR guidelines 2020 for HCRC.
Collapse
|
|
11
|
Delayed diagnosis of Peutz-Jeghers syndrome due to pathological information loss or mistake in family/personal history. Orphanet J Rare Dis 2021; 16:261. [PMID: 34103092 PMCID: PMC8186215 DOI: 10.1186/s13023-021-01900-7] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/25/2020] [Accepted: 05/29/2021] [Indexed: 11/10/2022] Open
Abstract
OBJECTIVE To report Peutz-Jeghers syndrome (PJS) cases with non-definitive clues in the family or personal history and finally diagnosed through pathological examination and STK11 gene mutation test. CLINICAL PRESENTATION AND INTERVENTION PJS was suspected in 3 families with tortuous medical courses. Two of them had relatives departed due to polyposis or colon cancer without pathological results, and the other one had been diagnosed as hyperplastic polyposis before. Diagnosis of PJS was confirmed by endoscopy and repeated pathological examinations, and the STK11 mutation test finally confirmed the diagnosis at genetic level, during which 3 novel mutation were detected (536C > A, 373_374insA, 454_455insGGAGAAGCGTTTCCCAGTGTGCC). CONCLUSION Early diagnosis of PJS is important and may be based on a family history with selective features among family members, and the pathological information is the key. The novel mutations also expand the STK11 variant spectrum.
Collapse
|
|
12
|
Melson J, Trikudanathan G, Abu Dayyeh BK, Bhutani MS, Chandrasekhara V, Jirapinyo P, Krishnan K, Kumta NA, Pannala R, Parsi MA, Sethi A, Trindade AJ, Watson RR, Maple JT, Lichtenstein DR. Video capsule endoscopy. Gastrointest Endosc 2021; 93:784-796. [PMID: 33642034 DOI: 10.1016/j.gie.2020.12.001] [Citation(s) in RCA: 13] [Impact Index Per Article: 3.3] [Reference Citation Analysis] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 11/30/2020] [Accepted: 12/01/2020] [Indexed: 02/08/2023]
Affiliation(s)
- Joshua Melson
- Division of Digestive Diseases, Department of Internal Medicine, Rush University Medical Center, Chicago, Illinois, USA
| | - Guru Trikudanathan
- Division of Gastroenterology, Hepatology and Nutrition, University of Minnesota, Minneapolis, Minnesota, USA
| | - Barham K Abu Dayyeh
- Department of Gastroenterology and Hepatology, Mayo Clinic, Rochester, Minnesota, USA
| | - Manoop S Bhutani
- Department of Gastroenterology Hepatology and Nutrition, Division of Internal Medicine, The University of Texas MD Anderson Cancer Center, Houston, Texas, USA
| | - Vinay Chandrasekhara
- Department of Gastroenterology and Hepatology, Mayo Clinic, Rochester, Minnesota, USA
| | - Pichamol Jirapinyo
- Department of Gastroenterology, Hepatology and Endoscopy, Brigham and Women's Hospital, Boston, Massachusetts, USA
| | - Kumar Krishnan
- Division of Gastroenterology, Department of Internal Medicine, Harvard Medical School and Massachusetts General Hospital, Boston, Massachusetts, USA
| | - Nikhil A Kumta
- Division of Gastroenterology, Mount Sinai Hospital, New York, New York, USA
| | - Rahul Pannala
- Department of Gastroenterology and Hepatology, Mayo Clinic, Scottsdale, Arizona, USA
| | - Mansour A Parsi
- Section for Gastroenterology and Hepatology, Tulane University Health Sciences Center, New Orleans, Louisiana, USA
| | - Amrita Sethi
- Department of Digestive and Liver Diseases, Columbia University Medical Center/New York-Presbyterian, New York, New York, USA
| | - Arvind J Trindade
- Department of Gastroenterology, Zucker School of Medicine at Hofstra/Northwell, Long Island Jewish Medical Center, New Hyde Park, New York, USA
| | - Rabindra R Watson
- Department of Gastroenterology, Interventional Endoscopy Services, California Pacific Medical Center, San Francisco, California, USA
| | - John T Maple
- Division of Digestive Diseases and Nutrition, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USA
| | - David R Lichtenstein
- Division of Gastroenterology, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts, USA
| |
Collapse
|
|
13
|
Naz J, Sharif M, Yasmin M, Raza M, Khan MA. Detection and Classification of Gastrointestinal Diseases using Machine Learning. Curr Med Imaging 2021; 17:479-490. [PMID: 32988355 DOI: 10.2174/1573405616666200928144626] [Citation(s) in RCA: 12] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/12/2020] [Revised: 07/07/2020] [Accepted: 07/23/2020] [Indexed: 12/22/2022]
Abstract
BACKGROUND Traditional endoscopy is an invasive and painful method of examining the gastrointestinal tract (GIT) not supported by physicians and patients. To handle this issue, video endoscopy (VE) or wireless capsule endoscopy (WCE) is recommended and utilized for GIT examination. Furthermore, manual assessment of captured images is not possible for an expert physician because it's a time taking task to analyze thousands of images thoroughly. Hence, there comes the need for a Computer-Aided-Diagnosis (CAD) method to help doctors analyze images. Many researchers have proposed techniques for automated recognition and classification of abnormality in captured images. METHODS In this article, existing methods for automated classification, segmentation and detection of several GI diseases are discussed. Paper gives a comprehensive detail about these state-of-theart methods. Furthermore, literature is divided into several subsections based on preprocessing techniques, segmentation techniques, handcrafted features based techniques and deep learning based techniques. Finally, issues, challenges and limitations are also undertaken. RESULTS A comparative analysis of different approaches for the detection and classification of GI infections. CONCLUSION This comprehensive review article combines information related to a number of GI diseases diagnosis methods at one place. This article will facilitate the researchers to develop new algorithms and approaches for early detection of GI diseases detection with more promising results as compared to the existing ones of literature.
Collapse
Affiliation(s)
- Javeria Naz
- Department of Computer Science, COMSATS University Islamabad, Wah Campus, Pakistan
| | - Muhammad Sharif
- Department of Computer Science, COMSATS University Islamabad, Wah Campus, Pakistan
| | - Mussarat Yasmin
- Department of Computer Science, COMSATS University Islamabad, Wah Campus, Pakistan
| | - Mudassar Raza
- Department of Computer Science, COMSATS University Islamabad, Wah Campus, Pakistan
| | | |
Collapse
|
|
14
|
Meher D, Gogoi M, Bharali P, Anirvan P, Singh SP. Artificial Intelligence in Small Bowel Endoscopy: Current Perspectives and Future Directions. JOURNAL OF DIGESTIVE ENDOSCOPY 2020. [DOI: 10.1055/s-0040-1717824] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.4] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 02/07/2023] Open
Abstract
AbstractArtificial intelligence (AI) is a computer system that is able to perform tasks which normally require human intelligence. The role of AI in the field of gastroenterology has been gradually evolving since its inception in the 1950s. Discovery of wireless capsule endoscopy (WCE) and balloon enteroscopy (BE) has revolutionized small gut imaging. While WCE is a relatively patient-friendly and noninvasive mode to examine the nonobstructed small gut, it is limited by a lengthy examination time and the need for expertise in reading images acquired by the capsule. Similarly, BE, despite having the advantage of therapeutic intervention, is costly, invasive, and requires general sedation. Incorporation of concepts like machine learning and deep learning has been used to handle large amounts of data and images in gastroenterology. Interestingly, in small gut imaging, the application of AI has been limited to WCE only. This review was planned to examine and summarize available published data on various AI-based approaches applied to small bowel disease.
We conducted an extensive literature search using Google search engine, Google Scholar, and PubMed database for published literature in English on the application of different AI techniques in small bowel endoscopy, and have summarized the outcome and benefits of these applications of AI in small bowel endoscopy. Incorporation of AI in WCE has resulted in significant advancements in the detection of various lesions starting from dysplastic mucosa, inflammatory and nonmalignant lesions to the detection of bleeding with increasing accuracy and has shortened the lengthy review time in image analysis. As most of the studies to evaluate AI are retrospective, the presence of inherent selection bias cannot be excluded. Besides, the interpretability (black-box nature) of AI models remains a cause for concern. Finally, issues related to medical ethics and AI need to be judiciously addressed to enable its seamless use in future.
Collapse
Affiliation(s)
- Dinesh Meher
- Department of Gastroenterology, S.C.B. Medical College, Cuttack, Odisha, India
| | - Mrinal Gogoi
- Department of Gastroenterology, S.C.B. Medical College, Cuttack, Odisha, India
| | - Pankaj Bharali
- Department of Gastroenterology, S.C.B. Medical College, Cuttack, Odisha, India
| | - Prajna Anirvan
- Department of Gastroenterology, S.C.B. Medical College, Cuttack, Odisha, India
| | | |
Collapse
|
|
15
|
Kim ER. Roles of Capsule Endoscopy and Device-Assisted Enteroscopy in the Diagnosis and Treatment of Small-Bowel Tumors. Clin Endosc 2020; 53:410-416. [PMID: 32746538 PMCID: PMC7403020 DOI: 10.5946/ce.2020.161] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 06/15/2020] [Accepted: 07/12/2020] [Indexed: 12/18/2022] Open
Abstract
With the development of capsule endoscopy (CE) and device-assisted enteroscopy (DAE), the incidence of small-bowel tumors has increased and the characteristics of these tumors have changed. In addition, the diagnostic and therapeutic approaches for small-bowel tumors have diversified. CE is a simple, noninvasive method that aid in the visualization the entire small bowel. CE is considered the initial approach for small-bowel tumors. DAE can be used to perform endoscopic procedures such as bleeding control, polypectomy, stent insertion, and tattooing, as well as for diagnosis through visualization or tissue sampling. Therapeutic intervention with DAE is particularly useful in polyposis syndromes such as familial adenomatous polyposis and Peutz-Jeghers syndrome. This review will discuss the roles of CE and DAE in the diagnosis and treatment of small-bowel tumors.
Collapse
Affiliation(s)
- Eun Ran Kim
- Division of Gastroenterology, Department of Internal Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea
| |
Collapse
|
|
16
|
Yang J, Gurudu SR, Koptiuch C, Agrawal D, Buxbaum JL, Abbas Fehmi SM, Fishman DS, Khashab MA, Jamil LH, Jue TL, Law JK, Lee JK, Naveed M, Qumseya BJ, Sawhney MS, Thosani N, Wani SB, Samadder NJ. American Society for Gastrointestinal Endoscopy guideline on the role of endoscopy in familial adenomatous polyposis syndromes. Gastrointest Endosc 2020; 91:963-982.e2. [PMID: 32169282 DOI: 10.1016/j.gie.2020.01.028] [Citation(s) in RCA: 90] [Impact Index Per Article: 18.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 01/17/2020] [Accepted: 01/18/2020] [Indexed: 02/08/2023]
Abstract
Familial adenomatous polyposis (FAP) syndrome is a complex entity, which includes FAP, attenuated FAP, and MUTYH-associated polyposis. These patients are at significant risk for colorectal cancer and carry additional risks for extracolonic malignancies. In this guideline, we reviewed the most recent literature to formulate recommendations on the role of endoscopy in this patient population. Relevant clinical questions were how to identify high-risk individuals warranting genetic testing, when to start screening examinations, what are appropriate surveillance intervals, how to identify endoscopically high-risk features, and what is the role of chemoprevention. A systematic literature search from 2005 to 2018 was performed, in addition to the inclusion of seminal historical studies. Most studies were from worldwide registries, which have compiled years of data regarding the natural history and cancer risks in this cohort. Given that most studies were retrospective, recommendations were based on epidemiologic data and expert opinion. Management of colorectal polyps in FAP has not changed much in recent years, as colectomy in FAP is the standard of care. What is new, however, is the developing body of literature on the role of endoscopy in managing upper GI and small-bowel polyposis, as patients are living longer and improved endoscopic technologies have emerged.
Collapse
Affiliation(s)
- Julie Yang
- Division of Gastroenterology, Montefiore Medical Center, Albert Einstein College of Medicine, Bronx, New York, USA
| | - Suryakanth R Gurudu
- Division of Gastroenterology and Hepatology, Mayo Clinic, Scottsdale, Arizona, USA
| | - Cathryn Koptiuch
- Department of Population Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, Utah, USA
| | - Deepak Agrawal
- Department of Internal Medicine, Dell Medical School, University of Texas at Austin, Austin, Texas, USA
| | - James L Buxbaum
- Division of Gastrointestinal and Liver Diseases, Keck School of Medicine of University of Southern California, Los Angeles, California, USA
| | - Syed M Abbas Fehmi
- Department of Gastroenterology, University of California, San Diego, California, USA
| | - Douglas S Fishman
- Section of Pediatric Gastroenterology, Hepatology and Nutrition, Baylor College of Medicine, Texas Children's Hospital, Houston, Texas, USA
| | - Mouen A Khashab
- Division of Gastroenterology and Hepatology, Johns Hopkins University, Baltimore, Maryland, USA
| | - Laith H Jamil
- Section of Gastroenterology and Hepatology, Beaumont Hospital-Royal Oak, Royal Oak, Michigan, USA
| | - Terry L Jue
- Department of Gastroenterology, The Permanente Medical Group, San Francisco, California, USA
| | - Joanna K Law
- Department of Gastroenterology and Hepatology, Digestive Disease Institute, Virginia Mason Medical Center, Seattle, Washington, USA
| | - Jeffrey K Lee
- Department of Gastroenterology, Kaiser Permanente San Francisco Medical Center, San Francisco, California, USA
| | - Mariam Naveed
- Advent Health Medical Group, Gastroenterology/Hepatology, Advent Health Hospital Altamonte Springs, Altamonte Springs, Florida, USA
| | - Bashar J Qumseya
- Department of Gastroenterology, University of Florida, Gainsville, Florida, USA
| | - Mandeep S Sawhney
- Division of Gastroenterology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA
| | - Nirav Thosani
- Division of Gastroenterology, Hepatology and Nutrition, McGovern Medical School, UTHealth, Houston, Texas, USA
| | - Sachin B Wani
- Division of Gastroenterology and Hepatology, University of Colorado Anschutz Medical Campus, Aurora, Colorado, USA
| | - N Jewel Samadder
- Division of Gastroenterology and Hepatology, Mayo Clinic, Scottsdale, Arizona, USA
| |
Collapse
|
|
17
|
Spada C, Piccirelli S. Capsule Endoscopy. ENCYCLOPEDIA OF GASTROENTEROLOGY 2020:428-437. [DOI: 10.1016/b978-0-12-801238-3.65977-9] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 01/05/2025]
|
|
18
|
The Prevalence and Significance of Jejunal and Duodenal Bulb Polyposis After Duodenectomy in Familial Adenomatous Polyposis: Retrospective Cohort Study. Ann Surg 2019; 274:e1071-e1077. [PMID: 31850977 DOI: 10.1097/sla.0000000000003740] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/25/2022]
Abstract
OBJECTIVE To evaluate the prevalence, natural history, and severity of polyposis of the duodenal bulb and jejunum after duodenectomy in patients with FAP. SUMMARY OF BACKGROUND DATA Advanced duodenal polyposis stage in FAP requires consideration of duodenal resection to prevent cancer; pylorus-preserving approach of pancreas-sparing duodenectomy (PSD) is preferred. Post-duodenectomy data indicate polyps occur in the duodenal bulb and the post-anastomotic jejunum, but limited data exists regarding their significance. METHODS We identified consecutive FAP patients After duodenal resection, including pancreaticoduodenectomy, PSD, or segmental duodenectomy, at Cleveland Clinic. Medical records were used to determine time to diagnosis of duodenal bulb or jejunal polyps, length of follow up, and severity of polyposis including maximal Spigelman stage (SS) of jejunal polyposis (neo-SS). RESULTS 64 patients with FAP underwent duodenectomy and endoscopic follow up. 28% underwent pancreaticoduodenectomy, 61% PSD, and 11% segmental duodenectomy. Postoperatively, 38/64 (59%) were diagnosed with jejunal polyposis, with median time to diagnosis of 55 months and follow up time of 127 months. Jejunal polyposis was advanced in 21% (neo- SS III or IV). Fifty percent were treated endoscopically, 1 patient required surgery. Jejunal polyp-free survival after duodenectomy differed by surgery type (P = 0.008). A total of 55/64 patients underwent a pylorus-preserving procedure, and 6/55 (11%) developed duodenal bulb polyps. All bulb polyps were large (>20 mm) and found after PSD. Endoscopic resection was unsuccessful in 5 patients, but no surgical intervention was required. CONCLUSIONS Polyposis occurs in the remaining duodenal and jejunal mucosa in the majority of patients after surgical duodenectomy. Jejunal polyposis is advanced in 1 in 5 patients, but rarely requires surgery. Endoscopic management of jejunal polyposis seems feasible but has proven difficult for duodenal bulb polyps.
Collapse
|
|
19
|
Cummins G, Cox BF, Ciuti G, Anbarasan T, Desmulliez MPY, Cochran S, Steele R, Plevris JN, Koulaouzidis A. Gastrointestinal diagnosis using non-white light imaging capsule endoscopy. Nat Rev Gastroenterol Hepatol 2019; 16:429-447. [PMID: 30988520 DOI: 10.1038/s41575-019-0140-z] [Citation(s) in RCA: 30] [Impact Index Per Article: 5.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 02/08/2023]
Abstract
Capsule endoscopy (CE) has proved to be a powerful tool in the diagnosis and management of small bowel disorders since its introduction in 2001. However, white light imaging (WLI) is the principal technology used in clinical CE at present, and therefore, CE is limited to mucosal inspection, with diagnosis remaining reliant on visible manifestations of disease. The introduction of WLI CE has motivated a wide range of research to improve its diagnostic capabilities through integration with other sensing modalities. These developments have the potential to overcome the limitations of WLI through enhanced detection of subtle mucosal microlesions and submucosal and/or transmural pathology, providing novel diagnostic avenues. Other research aims to utilize a range of sensors to measure physiological parameters or to discover new biomarkers to improve the sensitivity, specificity and thus the clinical utility of CE. This multidisciplinary Review summarizes research into non-WLI CE devices by organizing them into a taxonomic structure on the basis of their sensing modality. The potential of these capsules to realize clinically useful virtual biopsy and computer-aided diagnosis (CADx) is also reported.
Collapse
Affiliation(s)
- Gerard Cummins
- School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh, UK.
| | | | - Gastone Ciuti
- The BioRobotics Institute, Scuola Superiore Sant'Anna, Pisa, Italy
| | | | - Marc P Y Desmulliez
- School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh, UK
| | - Sandy Cochran
- School of Engineering, University of Glasgow, Glasgow, UK
| | - Robert Steele
- School of Medicine, University of Dundee, Dundee, UK
| | - John N Plevris
- Centre for Liver and Digestive Disorders, The Royal Infirmary of Edinburgh, Edinburgh, UK
| | | |
Collapse
|
|
20
|
Jiang YL, Zhao ZY, Li BR, Li J, Jin XW, Yu ED, Xu XD, Ning SB. Early screening the small bowel is key to protect Peutz-Jeghers syndrome patients from surgery: a novel mutation c.243delG in STK11 gene. BMC Gastroenterol 2019; 19:70. [PMID: 31072341 PMCID: PMC6507206 DOI: 10.1186/s12876-019-0987-z] [Citation(s) in RCA: 8] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 12/08/2017] [Accepted: 04/11/2019] [Indexed: 12/18/2022] Open
Abstract
Background Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. Case presentation A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. Conclusions We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.
Collapse
Affiliation(s)
- Yu-Liang Jiang
- Department of Gastroenterology, Beijing Shijitan Hospital, 10 Tieyi Rd., Beijing, 100038, China.,Department of Gastroenterology, Airforce Medical Center of PLA, 30 Fucheng Rd., Beijing, 100142, China
| | - Zi-Ye Zhao
- Department of Colorectal Surgery, Shanghai Changhai Hospital, 168 Changhai Rd., Shanghai, 200433, China
| | - Bai-Rong Li
- Department of Gastroenterology, Airforce Medical Center of PLA, 30 Fucheng Rd., Beijing, 100142, China
| | - Jing Li
- Department of Gastroenterology, Airforce Medical Center of PLA, 30 Fucheng Rd., Beijing, 100142, China
| | - Xiao-Wei Jin
- Department of Gastroenterology, Airforce Medical Center of PLA, 30 Fucheng Rd., Beijing, 100142, China
| | - En-Da Yu
- Department of Colorectal Surgery, Shanghai Changhai Hospital, 168 Changhai Rd., Shanghai, 200433, China
| | - Xiao-Dong Xu
- Department of Colorectal Surgery, Shanghai Changhai Hospital, 168 Changhai Rd., Shanghai, 200433, China.
| | - Shou-Bin Ning
- Department of Gastroenterology, Airforce Medical Center of PLA, 30 Fucheng Rd., Beijing, 100142, China.
| |
Collapse
|
|
21
|
Negative video capsule enteroscopy – what's the next step? GASTROENTEROLOGIA Y HEPATOLOGIA 2018; 41:663-669. [DOI: 10.1016/j.gastrohep.2018.06.003] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.1] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Received: 04/04/2018] [Revised: 05/31/2018] [Accepted: 06/04/2018] [Indexed: 02/08/2023]
|
|
22
|
Sanchez-Mete L, Stigliano V. Update on small bowel surveillance in hereditary colorectal cancer syndromes. TUMORI JOURNAL 2018; 105:12-21. [PMID: 30117372 DOI: 10.1177/0300891618792461] [Citation(s) in RCA: 9] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/19/2022]
Abstract
Despite its rarity in the general population, small bowel adenocarcinoma risk is increased in individuals with hereditary colorectal cancer syndromes (HCCS). In the last decade, the advent of capsule endoscopy and device-assisted balloon enteroscopy procedures in patients with HCCS have allowed to investigate the whole small bowel, increasing the diagnostic yield of small bowel tumor. Nonetheless, there is a significant variability in the international guideline recommendations. The aim of this review is to provide an update on surveillance of small bowel in HCCS and to identify the key points for the clinical management of these patients.
Collapse
Affiliation(s)
- Lupe Sanchez-Mete
- Division of Gastroenterology and Digestive Endoscopy, Regina Elena National Cancer Institute, Rome, Italy
| | - Vittoria Stigliano
- Division of Gastroenterology and Digestive Endoscopy, Regina Elena National Cancer Institute, Rome, Italy
| |
Collapse
|
|
23
|
Zhao ZY, Jiang YL, Li BR, Yu ED, Ning SB. A novel STK11 missense mutation (c.346G > T) causing Peutz-Jeghers syndrome in a Chinese male with a negative family history. Dig Liver Dis 2018; 50:864-866. [PMID: 29921539 DOI: 10.1016/j.dld.2018.05.020] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 04/15/2018] [Revised: 05/25/2018] [Accepted: 05/29/2018] [Indexed: 12/11/2022]
Affiliation(s)
- Zi-Ye Zhao
- Department of Colorectal Surgery, Shanghai Changhai Hospital, Shanghai, China
| | - Yu-Liang Jiang
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| | - Bai-Rong Li
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| | - En-Da Yu
- Department of Colorectal Surgery, Shanghai Changhai Hospital, Shanghai, China.
| | - Shou-Bin Ning
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China.
| |
Collapse
|
|
24
|
Ishida H, Yamaguchi T, Tanakaya K, Akagi K, Inoue Y, Kumamoto K, Shimodaira H, Sekine S, Tanaka T, Chino A, Tomita N, Nakajima T, Hasegawa H, Hinoi T, Hirasawa A, Miyakura Y, Murakami Y, Muro K, Ajioka Y, Hashiguchi Y, Ito Y, Saito Y, Hamaguchi T, Ishiguro M, Ishihara S, Kanemitsu Y, Kawano H, Kinugasa Y, Kokudo N, Murofushi K, Nakajima T, Oka S, Sakai Y, Tsuji A, Uehara K, Ueno H, Yamazaki K, Yoshida M, Yoshino T, Boku N, Fujimori T, Itabashi M, Koinuma N, Morita T, Nishimura G, Sakata Y, Shimada Y, Takahashi K, Tanaka S, Tsuruta O, Yamaguchi T, Sugihara K, Watanabe T. Japanese Society for Cancer of the Colon and Rectum (JSCCR) Guidelines 2016 for the Clinical Practice of Hereditary Colorectal Cancer (Translated Version). J Anus Rectum Colon 2018; 2:S1-S51. [PMID: 31773066 PMCID: PMC6849642 DOI: 10.23922/jarc.2017-028] [Citation(s) in RCA: 30] [Impact Index Per Article: 4.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 06/26/2017] [Accepted: 09/15/2017] [Indexed: 02/07/2023] Open
Abstract
Hereditary colorectal cancer accounts for less than 5% of all colorectal cancer cases. Some of the unique characteristics that are commonly encountered in cases of hereditary colorectal cancer include early age at onset, synchronous/metachronous occurrence of the cancer, and association with multiple cancers in other organs, necessitating different management from sporadic colorectal cancer. While the diagnosis of familial adenomatous polyposis might be easy because usually 100 or more adenomas that develop in the colonic mucosa are in this condition, Lynch syndrome, which is the most commonly associated disease with hereditary colorectal cancer, is often missed in daily medical practice because of its relatively poorly defined clinical characteristics. In addition, the disease concept and diagnostic criteria for Lynch syndrome, which was once called hereditary non-polyposis colorectal cancer, have changed over time with continual research, thereby possibly creating confusion in clinical practice. Under these circumstances, the JSCCR Guideline Committee has developed the "JSCCR Guidelines 2016 for the Clinical Practice of Hereditary Colorectal Cancer (HCRC)," to allow delivery of appropriate medical care in daily practice to patients with familial adenomatous polyposis, Lynch syndrome, or other related diseases. The JSCCR Guidelines 2016 for HCRC were prepared by consensus reached among members of the JSCCR Guideline Committee, based on a careful review of the evidence retrieved from literature searches, and considering the medical health insurance system and actual clinical practice settings in Japan. Herein, we present the English version of the JSCCR Guidelines 2016 for HCRC.
Collapse
Affiliation(s)
- Hideyuki Ishida
- Department of Digestive Tract and General Surgery, Saitama Medical Center, Saitma Medical University, Kawagoe, Japan
| | - Tatsuro Yamaguchi
- Department of Surgery, Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, Tokyo, Japan
| | - Kohji Tanakaya
- Department of Surgery, Iwakuni Clinical Center, Iwakuni, Japan
| | - Kiwamu Akagi
- Department of Cancer Prevention and Molecular Genetics, Saitama Prefectural Cancer Center, Saitama, Japan
| | - Yasuhiro Inoue
- Department of Gastrointestinal and Pediatric Surgery, Division of Reparative Medicine, Institute of Life Sciences, Mie University Graduate School of Medicine, Tsu, Japan
| | - Kensuke Kumamoto
- Department of Coloproctology, Aizu Medical Center, Fukushima Medical University, Aizuwakamatsu, Japan
| | - Hideki Shimodaira
- Department of Clinical Oncology, Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan
| | - Shigeki Sekine
- Division of Pathology and Clinical Laboratories, National Cancer Center, Hospital, Tokyo, Japan
| | - Toshiaki Tanaka
- Department of Surgical Oncology, The Graduate School of Medicine, The University of Tokyo, Tokyo, Japan
| | - Akiko Chino
- Division of Gastroenterology, The Cancer Institute Hospital, Japanese Foundation for Cancer Research, Tokyo, Japan
| | - Naohiro Tomita
- Department of Surgery, Hyogo College of Medicine, Nishinomiya, Japan
| | - Takeshi Nakajima
- Endoscopy Division/Department of Genetic Medicine and Service, National Cancer Center Hospital, Tokyo, Japan
| | | | - Takao Hinoi
- Department of Surgery, Institute for Clinical Research, National Hospital Organization Kure Medical Center and Chugoku Cancer Center, Kure, Japan
| | - Akira Hirasawa
- Department of Obstetrics and Gynecology, Keio University School of Medicine, Tokyo, Japan
| | - Yasuyuki Miyakura
- Department of Surgery Saitama Medical Center, Jichi Medical University, Saitama, Japan
| | - Yoshie Murakami
- Department of Oncology Nursing, Faculty of Nursing, Toho University, Tokyo, Japan
| | - Kei Muro
- Department of Clinical Oncology, Aichi Cancer Center Hospital, Nagoya, Japan
| | - Yoichi Ajioka
- Division of Molecular and Diagnostic Pathology, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan
| | | | - Yoshinori Ito
- Department of Radiation Oncology, National Cancer Center Hospital, Tokyo, Japan
| | - Yutaka Saito
- Endoscopy Division, National Cancer Center Hospital, Tokyo, Japan
| | - Tetsuya Hamaguchi
- Division of Gastrointestinal Medical Oncology, National Cancer Center Hospital, Tokyo, Japan
| | - Megumi Ishiguro
- Department of Translational Oncology, Tokyo Medical and Dental University Graduate School, Tokyo, Japan
| | - Soichiro Ishihara
- Department of Surgical Oncology, The Graduate School of Medicine, The University of Tokyo, Tokyo, Japan
| | - Yukihide Kanemitsu
- Colorectal Surgery Division, National Cancer Center Hospital, Tokyo, Japan
| | - Hiroshi Kawano
- Department of Gastroenterology, St. Mary's Hospital, Fukuoka, Japan
| | - Yusuke Kinugasa
- Department of Colon and Rectal Surgery, Shizuoka Cancer Center, Shizuoka, Japan
| | - Norihiro Kokudo
- Hepato-Pancreato-Biliary Surgery Division, Artificial Organ and Transplantation Division, Department of Surgery, Graduate School of Medicine, University of Tokyo, Tokyo, Japan
| | - Keiko Murofushi
- Radiation Oncology Department, The Cancer Institute Hospital, Japanese Foundation for Cancer Research, Tokyo, Japan
| | - Takako Nakajima
- Department of Clinical Oncology, St. Marianna University School of Medicine, Kawasaki, Japan
| | - Shiro Oka
- Gastroenterology and Metabolism, Hiroshima University Hospital, Hiroshima, Japan
| | | | - Akihiko Tsuji
- Department of Clinical Oncology, Faculty of Medicine, Kagawa University, Takamatsu, Japan
| | - Keisuke Uehara
- Division of Surgical Oncology, Department of Surgery, Nagoya University Graduate School of Medicine, Nagoya, Japan
| | - Hideki Ueno
- Department of Surgery, National Defense Medical College, Saitama, Japan
| | - Kentaro Yamazaki
- Division of Gastrointestinal Oncology, Shizuoka Cancer Center, Shizuoka, Japan
| | - Masahiro Yoshida
- Department of Hemodialysis and Surgery, Chemotherapy Research Institute, International University of Health and Welfare, Ichikawa, Japan
| | - Takayuki Yoshino
- Department of Gastroenterology and Gastrointestinal Oncology, National Cancer Center Hospital East, Chiba, Japan
| | - Narikazu Boku
- Division of Gastrointestinal Medical Oncology, National Cancer Center Hospital, Tokyo, Japan
| | | | - Michio Itabashi
- Department of Surgery, Institute of Gastroenterology, Tokyo Women's Medical University, Tokyo, Japan
| | - Nobuo Koinuma
- Department of Health Administration and Policy, Tohoku Medical and Pharmaceutical University, Sendai, Japan
| | - Takayuki Morita
- Department of Surgery, Cancer Center, Aomori Prefectural Central Hospital, Aomori, Japan
| | - Genichi Nishimura
- Department of Surgery, Japanese Red Cross Kanazawa Hospital, Ishikawa, Japan
| | - Yuh Sakata
- CEO, Misawa City Hospital, Misawa, Japan
| | - Yasuhiro Shimada
- Division of Clinical Oncology, Kochi Health Sciences Center, Kochi, Japan
| | - Keiichi Takahashi
- Department of Surgery, Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, Tokyo, Japan
| | - Shinji Tanaka
- Department of Endoscopy, Hiroshima University Hospital, Hiroshima, Japan
| | - Osamu Tsuruta
- Division of GI Endoscopy, Kurume University School of Medicine, Fukuoka, Japan
| | - Toshiharu Yamaguchi
- Department of Gastroenterological Surgery, The Cancer Institute Hospital, Japanese Foundation for Cancer Research, Tokyo, Japan
| | | | - Toshiaki Watanabe
- Department of Surgical Oncology, The Graduate School of Medicine, The University of Tokyo, Tokyo, Japan
| |
Collapse
|
|
25
|
Close and regular surveillance is key to prevent severe complications for Peutz-Jeghers syndrome patients without gastrointestinal polyps: case report of a novel STK11 mutation (c.471_472delCT) in a Chinese girl. BMC Surg 2018; 18:24. [PMID: 29685139 PMCID: PMC5914036 DOI: 10.1186/s12893-018-0357-8] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.1] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/04/2018] [Accepted: 04/13/2018] [Indexed: 11/10/2022] Open
Abstract
Background Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. Case presentation We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. Conclusion The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.
Collapse
|
|
26
|
Purchiaroni F, Nakajima T, Sakamoto T, Abe S, Saito Y. Over-The-Scope-Clip pre-mounted onto a double balloon enteroscope for fast and successful closure of post-EMR jejunal perforation: case report. BMC Gastroenterol 2017; 17:152. [PMID: 29216840 PMCID: PMC5721481 DOI: 10.1186/s12876-017-0718-2] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 06/06/2017] [Accepted: 11/29/2017] [Indexed: 01/10/2023] Open
Abstract
BACKGROUND Familial adenomatous polyposis (FAP) is a rare, autosomal dominant disease clinically characterized by the early onset of many adenomatous polyps throughout the colon, which turn into colon cancer, if left untreated. In FAP patients, polyps can also occur in the upper gastrointestinal (GI) tract, especially in the duodenum. Adenomas beyond duodenum are rare and mostly located in the proximal jejunum and distal ileum. The management of such polyps can be either surgical or endoscopic, depending on the features of the polyp, Spigelman stage and patient's clinical conditions. Endoscopic mucosal resection (EMR) of jejunal polyps can be challenging, because of the thinner wall of jejunum, compared to the rest of the GI tract, and of the difficulty of maintaining control and stability of the scope. For these reasons, jejunal perforation is a likely occurrence. CASE PRESENTATION A 65-year-old woman with a stage IV FAP, who had previously undergone abdominal surgery because of her disease, came to our attention because of numerous adenomatous-looking duodenal polyps and a 25 mm lesion in proximal jejunum. According to Spigelman staging system, patient was candidate for surgical resection, in light of the risk of developing small bowel cancer. Despite the benefits of surgery were clearly explained to her, she refused to undergo small bowel resection. Therefore, EMR of the largest duodenal polyp and of the jejunal lesion was planned. After the removal of the jejunal polyp, a small perforation was noted. We were able to rapidly close such perforation by using the Over-The-Scope-Clip system (OTSC, 12/6 t; Ovesco, Tübingen, Germany) pre-mounted onto a double balloon (DB) enteroscope. CONCLUSIONS The endoscopic management of jejunal perforation can be tricky and the placement of traditional through-the-scope clips in a narrow space like jejunum may be difficult and time consuming. This case describes the use of the OTSC system pre-mounted onto a DB enteroscope for the closure of post-EMR jejunal perforation.
Collapse
Affiliation(s)
| | - Takeshi Nakajima
- Endoscopy Division, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo, 104-0045, Japan.,Department of Genetic Medicine and Services, National Cancer Center Hospital, Tokyo, Japan
| | - Taku Sakamoto
- Endoscopy Division, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo, 104-0045, Japan.
| | - Seiichiro Abe
- Endoscopy Division, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo, 104-0045, Japan
| | - Yutaka Saito
- Endoscopy Division, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo, 104-0045, Japan
| |
Collapse
|
|
27
|
Zhao ZY, Jiang YL, Li BR, Yang F, Li J, Jin XW, Sun SH, Ning SB. A novel germline mutation (c.A527G) in STK11 gene causes Peutz-Jeghers syndrome in a Chinese girl: A case report. Medicine (Baltimore) 2017; 96:e8591. [PMID: 29245219 PMCID: PMC5728834 DOI: 10.1097/md.0000000000008591] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.1] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 11/26/2022] Open
Abstract
RATIONALE Peutz-Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. PATIENT CONCERNS A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. DIAGNOSES She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. INTERVENTIONS Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. OUTCOMES A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. LESSONS PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS.
Collapse
Affiliation(s)
- Zi-Ye Zhao
- Department of Medical Genetics, Naval Medical University, Shanghai 200433, China
| | - Yu-Liang Jiang
- Hebei North University, Zhangjiakou, Hebei Province, China
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| | - Bai-Rong Li
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| | - Fu Yang
- Department of Medical Genetics, Naval Medical University, Shanghai 200433, China
| | - Jing Li
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| | - Xiao-Wei Jin
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| | - Shu-Han Sun
- Department of Medical Genetics, Naval Medical University, Shanghai 200433, China
| | - Shou-Bin Ning
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| |
Collapse
|
|
28
|
Zhao ZY, Jiang YL, Li BR, Yang F, Li J, Jin XW, Ning SB, Sun SH. Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient. BMC MEDICAL GENETICS 2017; 18:130. [PMID: 29141581 PMCID: PMC5688745 DOI: 10.1186/s12881-017-0471-y] [Citation(s) in RCA: 9] [Impact Index Per Article: 1.1] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 08/17/2017] [Accepted: 09/27/2017] [Indexed: 01/24/2023]
Abstract
Background Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Case presentation We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members’. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. Conclusions The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence. Electronic supplementary material The online version of this article (10.1186/s12881-017-0471-y) contains supplementary material, which is available to authorized users.
Collapse
Affiliation(s)
- Zi-Ye Zhao
- Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd, Shanghai, 200433, China
| | - Yu-Liang Jiang
- Hebei North University, 11 South Zuanshi Rd., Zhangjiakou, Hebei Province, 075061, China.,Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China
| | - Bai-Rong Li
- Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China
| | - Fu Yang
- Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd, Shanghai, 200433, China
| | - Jing Li
- Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China
| | - Xiao-Wei Jin
- Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China
| | - Shou-Bin Ning
- Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China.
| | - Shu-Han Sun
- Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd, Shanghai, 200433, China.
| |
Collapse
|
|
29
|
A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History. Dig Dis Sci 2017; 62:3014-3020. [PMID: 28986664 DOI: 10.1007/s10620-017-4741-5] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 04/19/2017] [Accepted: 08/28/2017] [Indexed: 12/31/2022]
Abstract
BACKGROUND AND AIMS Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.
Collapse
|
|
30
|
Wang R, Chen LL, Wang DZ, Chen BX. Association Between Helicobacter Pylori Infection and Long-term Outcome in Patients with Drug-eluting Stent Implantation. Sci Rep 2017; 7:44954. [PMID: 28703181 PMCID: PMC5508198 DOI: 10.1038/srep44954] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/31/2016] [Accepted: 02/09/2017] [Indexed: 01/28/2023] Open
Abstract
To investigate the relationship between Helicobacter pylori (Hp) infection and the long-term outcome in acute coronary syndrome (ACS) patients with drug-eluting stent (DES) implantation and so as to explore the significance of Hp eradication therapy in preventing major adverse cardiac events (MACE) and upper gastrointestinal bleeding (UGIB). 539 ACS patients with DES implantation from January 1, 2010 to December 31, 2012 were analyzed. All the patients were divided into two groups according to the result of 13C urea breath test. 253 patients with Hp infection were put into group A (Hp+), and 286 cases without Hp infection were put into group B (Hp-). Demographic data was collected and all patients went through biochemical indicators and other routine blood examinations. We explored the correlations of Hp infection with MACE and UGIB after 3 to 5 years of follow-up using survival analysis. Survival analysis showed that Hp infection was a predictor of MACE and UGI. Sub-group analysis showed that patients with Hp eradication therapy had no relationship with MACE but had a lower rate of UGIB than those without Hp eradication therapy.
Collapse
Affiliation(s)
- Rui Wang
- Department of Cardiology, Beijing Tiantan Hospital, Capital Medical University, Beijing 100050, China
| | - Lei-lei Chen
- Department of Cardiology, Beijing Tiantan Hospital, Capital Medical University, Beijing 100050, China
| | - De-zhao Wang
- Department of Cardiology, Beijing Tiantan Hospital, Capital Medical University, Beijing 100050, China
| | - Bu-xing Chen
- Department of Cardiology, Beijing Tiantan Hospital, Capital Medical University, Beijing 100050, China
| |
Collapse
|
|
31
|
Yamamoto H, Ogata H, Matsumoto T, Ohmiya N, Ohtsuka K, Watanabe K, Yano T, Matsui T, Higuchi K, Nakamura T, Fujimoto K. Clinical Practice Guideline for Enteroscopy. Dig Endosc 2017; 29:519-546. [PMID: 28370422 DOI: 10.1111/den.12883] [Citation(s) in RCA: 115] [Impact Index Per Article: 14.4] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 12/11/2022]
Abstract
Management of small bowel diseases has evolved since the advent of capsule endoscopy (CE) and balloon-assisted enteroscopy (BAE). One of the most common indications for enteroscopy is obscure gastrointestinal bleeding (OGIB), followed by small bowel stenosis, tumors, and inflammatory bowel disease. Although enteroscopes have been regarded as useful tools, correct guidelines are required to ensure that we manipulate these enteroscopes safely and efficiently in clinical practice. Herein, the Japanese Gastroenterological Endoscopy Society has developed 'Clinical Practice Guidelines for Enteroscopy' in collaboration with the Japanese Society of Gastroenterology, the Japanese Gastroenterological Association, and the Japanese Association for Capsule Endoscopy. These guidelines are based on the evidence available until now, but small bowel endoscopy is a relatively new technology, so the guidelines include recommendations based on a consensus reached among experts when the evidence has not been considered sufficient. These guidelines were not designed to be disease-based, but focus on how we should use small bowel CE and BAE in everyday clinical practice.
Collapse
Affiliation(s)
| | - Haruhiko Ogata
- Japan Gastroenterological Endoscopy Society
- Japanese Society of Gastroenterology
| | - Takayuki Matsumoto
- Japan Gastroenterological Endoscopy Society
- Japanese Gastroenterological Association
| | - Naoki Ohmiya
- Japan Gastroenterological Endoscopy Society
- Japanese Association for Capsule Endoscopy
| | - Kazuo Ohtsuka
- Japan Gastroenterological Endoscopy Society
- Japanese Gastroenterological Association
| | - Kenji Watanabe
- Japanese Society of Gastroenterology
- Japanese Association for Capsule Endoscopy
| | - Tomonori Yano
- Japan Gastroenterological Endoscopy Society
- Japanese Association for Capsule Endoscopy
| | - Toshiyuki Matsui
- Japan Gastroenterological Endoscopy Society
- Japanese Gastroenterological Association
| | - Kazuhide Higuchi
- Japan Gastroenterological Endoscopy Society
- Japanese Society of Gastroenterology
| | - Tetsuya Nakamura
- Japan Gastroenterological Endoscopy Society
- Japanese Society of Gastroenterology
| | | |
Collapse
|
|
32
|
Enns RA, Hookey L, Armstrong D, Bernstein CN, Heitman SJ, Teshima C, Leontiadis GI, Tse F, Sadowski D. Clinical Practice Guidelines for the Use of Video Capsule Endoscopy. Gastroenterology 2017; 152:497-514. [PMID: 28063287 DOI: 10.1053/j.gastro.2016.12.032] [Citation(s) in RCA: 277] [Impact Index Per Article: 34.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 02/07/2023]
Abstract
BACKGROUND & AIMS Video capsule endoscopy (CE) provides a noninvasive option to assess the small intestine, but its use with respect to endoscopic procedures and cross-sectional imaging varies widely. The aim of this consensus was to provide guidance on the appropriate use of CE in clinical practice. METHODS A systematic literature search identified studies on the use of CE in patients with Crohn's disease, celiac disease, gastrointestinal bleeding, and anemia. The quality of evidence and strength of recommendations were rated using the Grading of Recommendation Assessment, Development, and Evaluation (GRADE) approach. RESULTS The consensus includes 21 statements focused on the use of small-bowel CE and colon capsule endoscopy. CE was recommended for patients with suspected, known, or relapsed Crohn's disease when ileocolonoscopy and imaging studies were negative if it was imperative to know whether active Crohn's disease was present in the small bowel. It was not recommended in patients with chronic abdominal pain or diarrhea, in whom there was no evidence of abnormal biomarkers typically associated with Crohn's disease. CE was recommended to assess patients with celiac disease who have unexplained symptoms despite appropriate treatment, but not to make the diagnosis. In patients with overt gastrointestinal bleeding, and negative findings on esophagogastroduodenoscopy and colonoscopy, CE should be performed as soon as possible. CE was recommended only in selected patients with unexplained, mild, chronic iron-deficiency anemia. CE was suggested for surveillance in patients with polyposis syndromes or other small-bowel cancers, who required small-bowel studies. Colon capsule endoscopy should not be substituted routinely for colonoscopy. Patients should be made aware of the potential risks of CE including a failed procedure, capsule retention, or a missed lesion. Finally, standardized criteria for training and reporting in CE should be defined. CONCLUSIONS CE generally should be considered a complementary test in patients with gastrointestinal bleeding, Crohn's disease, or celiac disease, who have had negative or inconclusive endoscopic or imaging studies.
Collapse
Affiliation(s)
- Robert A Enns
- Division of Gastroenterology, Department of Medicine, University of British Columbia, Vancouver, British Columbia, Canada.
| | - Lawrence Hookey
- Division of Gastroenterology, Department of Medicine, Queen's University, Kingston, Ontario, Canada
| | - David Armstrong
- Division of Gastroenterology, Department of Medicine, McMaster University, Hamilton, Ontario, Canada
| | - Charles N Bernstein
- Section of Gastroenterology, Department of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada
| | - Steven J Heitman
- Division of Gastroenterology and Hepatology, Department of Medicine, University of Calgary, Calgary, Alberta, Canada
| | - Christopher Teshima
- Division of Gastroenterology, Department of Medicine, University of Toronto, Toronto, Ontario, Canada
| | - Grigorios I Leontiadis
- Division of Gastroenterology, Department of Medicine, McMaster University, Hamilton, Ontario, Canada
| | - Frances Tse
- Division of Gastroenterology, Department of Medicine, McMaster University, Hamilton, Ontario, Canada
| | - Daniel Sadowski
- Division of Gastroenterology, Royal Alexandria Hospital, Edmonton, Alberta, Canada
| |
Collapse
|
|
33
|
Análisis histórico de la experiencia en cápsula endoscópica de intestino delgado en un hospital terciario español. GASTROENTEROLOGIA Y HEPATOLOGIA 2017; 40:70-79. [PMID: 27242156 DOI: 10.1016/j.gastrohep.2016.04.005] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Received: 01/09/2016] [Revised: 03/05/2016] [Accepted: 04/05/2016] [Indexed: 12/21/2022]
|
|
34
|
Argüelles-Arias F, Donat E, Fernández-Urien I, Alberca F, Argüelles-Martín F, Martínez MJ, Molina M, Varea V, Herrerías-Gutiérrez JM, Ribes-Koninckx C. Guideline for wireless capsule endoscopy in children and adolescents: A consensus document by the SEGHNP (Spanish Society for Pediatric Gastroenterology, Hepatology, and Nutrition) and the SEPD (Spanish Society for Digestive Diseases). REVISTA ESPANOLA DE ENFERMEDADES DIGESTIVAS 2017; 107:714-31. [PMID: 26671584 DOI: 10.17235/reed.2015.3921/2015] [Citation(s) in RCA: 21] [Impact Index Per Article: 2.6] [Reference Citation Analysis] [Abstract] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 11/20/2022]
Abstract
INTRODUCTION Capsule Endoscopy (CE) in children has limitations based mainly on age. The objective of this consensus was reviewing the scientific evidence. MATERIAL AND METHODS Some experts from the Spanish Society of Gastroenterology (SEPD) and Spanish Society for Pediatric Gastroenterology, Hepatology, and Nutrition (SEGHNP) were invited to answer different issues about CE in children. These sections were: a) Indications, contraindications and limitations; b) efficacy of CE in different clinical scenarios; c) CE performance; d) CE-related complications; e) Patency Capsule; and f) colon capsule endoscopy. They reviewed relevant questions on each topic. RESULTS The main indication is Crohn's disease (CD). There is no contraindication for the age and in the event that the patient not to swallow it, it should be administered under deep sedation with endoscopy and specific device. The CE is useful in CD, for the management of OGIB in children and in Peutz-Jeghers syndrome (in this indication has the most effectiveness). The main complication is retention, which should be specially taken into account in cases of CD already diagnosed with malnutrition. A preparation regimen based on a low volume of polyethylene glycol (PEG) the day before plus simethicone on the same day is the best one in terms of cleanliness although does not improve the results of the CE procedure. CONCLUSIONS CE is safe and useful in children. Indications are similar to those of adults, the main one is CD to establish both a diagnosis and disease extension. Moreover, only few limitations are detected in children.
Collapse
Affiliation(s)
| | | | | | - Fernando Alberca
- DIGESTIVO/ENDOSCOPIAS, Hospital Universitario Virgen de la Arrixaca. Murcia, España
| | | | | | | | | | | | | |
Collapse
|
|
35
|
Liu L, Towfighian S, Hila A. A Review of Locomotion Systems for Capsule Endoscopy. IEEE Rev Biomed Eng 2016; 8:138-51. [PMID: 26292162 DOI: 10.1109/rbme.2015.2451031] [Citation(s) in RCA: 57] [Impact Index Per Article: 6.3] [Reference Citation Analysis] [Abstract] [MESH Headings] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/06/2022]
Abstract
Wireless capsule endoscopy for gastrointestinal (GI) tract is a modern technology that has the potential to replace conventional endoscopy techniques. Capsule endoscopy is a pill-shaped device embedded with a camera, a coin battery, and a data transfer. Without a locomotion system, this capsule endoscopy can only passively travel inside the GI tract via natural peristalsis, thus causing several disadvantages such as inability to control and stop, and risk of capsule retention. Therefore, a locomotion system needs to be added to optimize the current capsule endoscopy. This review summarizes the state-of-the-art locomotion methods along with the desired locomotion features such as size, speed, power, and temperature and compares the properties of different methods. In addition, properties and motility mechanisms of the GI tract are described. The main purpose of this review is to understand the features of GI tract and diverse locomotion methods in order to create a future capsule endoscopy compatible with GI tract properties.
Collapse
|
|
36
|
Urgesi R, Cianci R, Pagliari D, Newton EE, Rizzo G, Costamagna G, Riccioni ME. Is capsule endoscopy appropriate for elderly patients? The influence of ageing on findings and diagnostic yield: An Italian retrospective study. Dig Liver Dis 2015; 47:1086-1088. [PMID: 26514739 DOI: 10.1016/j.dld.2015.09.004] [Citation(s) in RCA: 14] [Impact Index Per Article: 1.4] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 03/20/2015] [Revised: 08/31/2015] [Accepted: 09/16/2015] [Indexed: 12/11/2022]
Abstract
BACKGROUND Few data are available on the use of capsule endoscopy in the elderly. METHODS We performed a retrospective study on 1008 consecutive patients referred to our centre between December 1, 2002 and January 30, 2014 who underwent capsule endoscopy for various indications. Patients were enrolled and divided into 3 sub-groups according to their age (Group A: <50 years; Group B: 50-69 years; Group C: >70 years). The Pillcam diagnostic yield, clinically significant findings and post-treatment outcomes were compared between groups. RESULTS Diagnostic yield was significantly higher in Group C vs. Groups A and B (65.2% vs. 42.3% and 47.5%, respectively; p<0.05). The most common diagnosis in the elderly was angiodysplasia (42.5%). In 84.5% of elderly patients (Group C) capsule endoscopy results modified patient management. CONCLUSIONS Capsule endoscopy has a high diagnostic yield and positive impact on management in patients aged >70 years.
Collapse
Affiliation(s)
- Riccardo Urgesi
- Department of Internal Medicine and Gastroenterology, 'Columbus Hospital', Catholic University of the Sacred Heart, Rome Italy
| | - Rossella Cianci
- Department of Internal Medicine, 'A. Gemelli Hospital', Catholic University of the Sacred Heart, Rome Italy
| | - Danilo Pagliari
- Department of Internal Medicine, 'A. Gemelli Hospital', Catholic University of the Sacred Heart, Rome Italy
| | | | - Gianluca Rizzo
- Department of Surgery, 'Columbus Hospital', Catholic University of the Sacred Heart, Rome, Italy
| | - Guido Costamagna
- Department of Surgery, Surgical Endoscopy Unit, 'A. Gemelli Hospital', Catholic University of the Sacred Heart, Rome, Italy
| | - Maria Elena Riccioni
- Department of Surgery, Surgical Endoscopy Unit, 'A. Gemelli Hospital', Catholic University of the Sacred Heart, Rome, Italy.
| |
Collapse
|
|
37
|
Surveillance using capsule endoscopy is safe in post-colectomy patients with familial adenomatous polyposis: a prospective Japanese study. Fam Cancer 2015; 15:75-83. [PMID: 26450841 DOI: 10.1007/s10689-015-9844-6] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/29/2022]
Abstract
The utility of capsule endoscopy (CE) for the surveillance of small intestinal lesions in familial adenomatous polyposis (FAP) patients has been reported. However, few studies have investigated the safety of CE in FAP patients who have undergone colon surgery. We aimed to assess the safety of surveillance CE in post-colectomy FAP patients and the endoscopic findings associated with small intestinal lesions. We assessed the safety of CE surveillance of small intestinal lesions in 41 FAP patients who had undergone colectomies. Forty-two CEs were performed in 41 patients at our facility from April 2012 to July 2014. CE was conducted safely and none of the capsules were retained, despite the inclusion of patients who had undergone several abdominal surgeries previously. Thirty-nine out of 42 capsules (93 %) were retrieved within the examination timeframe; hence, the retrieval rate was favorable. The findings from this study indicate that surveillance CE can be safely conducted in post-colectomy FAP patients.
Collapse
|
|
38
|
Gan HY, Weng YJ, Qiao WG, Chen ZY, Xu ZM, Bai Y, Gong W, Wan TM, Pan DS, Shi YS, Qiu AJ, Zhi FC. Sedation With Propofol Has No Effect on Capsule Endoscopy Completion Rates: A Prospective Single-Center Study. Medicine (Baltimore) 2015; 94:e1140. [PMID: 26166122 PMCID: PMC4504626 DOI: 10.1097/md.0000000000001140] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 12/22/2022] Open
Abstract
Patients who need both capsule endoscopy (CE) and colonoscopy often undergo both examinations on the same day to avoid repeated bowel preparation and fasting. Sedation can relieve pain and is commonly used for colonoscopies but may influence the CE completion rate.To determine whether sedation with propofol influences the completion rate and small-bowel transit time (SBTT) of CE.From July 2014 to December 2014, patients (18-65 years old) who needed both CE and colonoscopy were assessed consecutively for enrollment in our study. Colonoscopies were performed with or without sedation based on patient preferences on the day of capsule ingestion. The completion rate, SBTT, and diagnostic yield of CEs were recorded. Patients' satisfaction and pain scores were also recorded.Sedation with propofol had no significant effect on CE completion rates (83.3% sedation group vs 81.8% nonsedation group, P = 0.86) but was associated with increased SBTT (403.6 ± 160.3 sedation group vs 334.5 ± 134.4 nonsedation group, P = 0.006). The diagnostic yields in the sedation and nonsedation groups were 69.4% and 65.9%, respectively (P = 0.74). The median satisfaction scores were 8.6 in the sedation group and 3.5 in the nonsedation group (P < 0.001). Median pain scores were 1.4 in the sedation group and 6.7 in the nonsedation group (P < 0.001).Sedation with propofol increased SBTT but had no effect on CE completion rates, suggesting that CE and colonoscopy with propofol can be performed on the same day (clinical trial registration number: ChiCTR-ONRC-14004866).
Collapse
Affiliation(s)
- Huo-Ye Gan
- From the Department of Gastroenterology, Nanfang Hospital, Southern Medical University, Guangzhou, China (H-YG, Y-JW, W-GQ, Z-YC, Z-MX, YB, WG, T-MW, D-SP, F-CZ); Department of Anesthesiology, Nanfang Hospital, Southern Medical University, Guangzhou, China (Y-SS, A-JQ); and Department of Gastroenterology, Qingyuan City People's Hospital of Jinan University, Guangdong, China (H-YG)
| | | | | | | | | | | | | | | | | | | | | | | |
Collapse
|
|
39
|
Yamada A, Watabe H, Iwama T, Obi S, Omata M, Koike K. The prevalence of small intestinal polyps in patients with familial adenomatous polyposis: a prospective capsule endoscopy study. Fam Cancer 2015; 13:23-8. [PMID: 23743563 DOI: 10.1007/s10689-013-9668-1] [Citation(s) in RCA: 20] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/12/2022]
Abstract
Familial adenomatous polyposis (FAP) is a genetic disorder in which multiple colorectal polyps and cancers develop. However, the prevalence of small intestinal tumors in patients with FAP remains unclear. We elucidated the prevalence of polyps in the small intestine and duodenum using capsule endoscopy (CE). Patients with FAP receiving a periodic screening colonoscopy at Kyoundo Hospital were encouraged to participate in the study. All study participants underwent esophagogastroduodenoscopy (EGD) within 2 weeks before CE. Outcome measurements were the prevalence of duodenal polyps (DP) and small intestinal polyp (SIP), detectability of the ampulla of Vater, and concordance of the duodenal findings between CE and EGD. Twenty-three patients (mean age, 47 years; 15 males) were enrolled in the study. CE showed DPs in 11 patients (52%) and SIPs in nine patients (43 %). The mean numbers of DPs and SIPs was 11.5 ± 6.2 and 11.9 ± 10.9, respectively. SIPs were more often detected in patients with DPs versus those without (62 vs. 13%, P = 0.07). The ampulla of Vater was observed by CE in four patients (21%). EGD showed DPs in 13 patients (62%). EGD missed DPs in two of 11 patients with DPs detected by CE. EGD found DPs in four of 10 patients without DPs using CE. The kappa index was 0.422. Patients with FAP have a high prevalence of polyps in the small intestine. Although the clinical significance of small intestinal polyps remains unclear, patients with FAP seem to be good candidates for CE.
Collapse
Affiliation(s)
- Atsuo Yamada
- Department of Gastroenterology, Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-8655, Japan,
| | | | | | | | | | | |
Collapse
|
|
40
|
Constantinescu AF, Ionescu M, Rogoveanu I, Ciurea ME, Streba CT, Iovanescu VF, Vere CC. Wireless Capsule Endoscopy in Correlation with Software Application in Gastrointestinal Diseases. CURRENT HEALTH SCIENCES JOURNAL 2015; 41:89-94. [PMID: 30364860 PMCID: PMC6201197 DOI: 10.12865/chsj.41.02.01] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Download PDF] [Subscribe] [Scholar Register] [Received: 01/10/2015] [Accepted: 03/01/2015] [Indexed: 11/25/2022]
Abstract
Wireless capsule endoscopy is one of the most recent investigation techniques of gastrointestinal pathology. Unlike conventional upper and lower endoscopy, it has the advantages of being a noninvasive and painless procedure. One of the capsule endoscopy disadvantages is represented by the necessary time to analyze the video frames obtained. Software applications proposed in this purpose could offer support in the images evaluation. Different algorithms have been described in the literature, but further research is needed to establish the practical value of computer vision tools in gastroenterology.
Collapse
Affiliation(s)
| | - M Ionescu
- Medical Informatics Department, University of Medicine and Pharmacy of Craiova, Romania
| | - I Rogoveanu
- Gastroenterology Department, University of Medicine and Pharmacy of Craiova, Romania
| | - M E Ciurea
- Plastic Surgery Department, University of Medicine and Pharmacy of Craiova, Romania
| | - C T Streba
- Gastroenterology Department, University of Medicine and Pharmacy of Craiova, Romania
| | - V F Iovanescu
- Gastroenterology Department, University of Medicine and Pharmacy of Craiova, Romania
| | - C C Vere
- Gastroenterology Department, University of Medicine and Pharmacy of Craiova, Romania
| |
Collapse
|
|
41
|
Abstract
PURPOSE OF REVIEW This review summarizes the recent developments in the evaluation of small bowel disorders using videocapsule endoscopy (VCE) and serological and breath-test biomarkers. RECENT FINDINGS The ability to visualize the small bowel was revolutionized with the introduction of VCE technology. VCE allows for accurate, noninvasive visualization of the small bowel mucosa. This device is invaluable in the investigation of obscure gastrointestinal bleeding (OGIB), occult bleeding with iron deficiency anaemia, small bowel Crohn's disease (CD), small bowel neoplasms and other mucosal disorders. Recent studies underscored the utility of VCE for documenting the extent and severity of small bowel CD as well as monitoring activity after therapy. The accuracy of the discrimination between small bowel tumours and benign bulges has been improved by a novel endoscopic algorithm. The accuracy of VCE was also evaluated as a potential noninvasive alternative to small bowel biopsies in suspected celiac disease. New findings have been made using breath tests and other biomarkers for the diagnosis of celiac disease, irritable bowel syndrome and bacterial overgrowth. SUMMARY VCE as well as breath-test biomarkers play a major and expanding role in the diagnosis and monitoring of various small bowel disorders.
Collapse
|
|
42
|
ACG clinical guideline: Genetic testing and management of hereditary gastrointestinal cancer syndromes. Am J Gastroenterol 2015; 110:223-62; quiz 263. [PMID: 25645574 PMCID: PMC4695986 DOI: 10.1038/ajg.2014.435] [Citation(s) in RCA: 1080] [Impact Index Per Article: 108.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 09/01/2014] [Accepted: 12/01/2014] [Indexed: 02/06/2023]
Abstract
This guideline presents recommendations for the management of patients with hereditary gastrointestinal cancer syndromes. The initial assessment is the collection of a family history of cancers and premalignant gastrointestinal conditions and should provide enough information to develop a preliminary determination of the risk of a familial predisposition to cancer. Age at diagnosis and lineage (maternal and/or paternal) should be documented for all diagnoses, especially in first- and second-degree relatives. When indicated, genetic testing for a germline mutation should be done on the most informative candidate(s) identified through the family history evaluation and/or tumor analysis to confirm a diagnosis and allow for predictive testing of at-risk relatives. Genetic testing should be conducted in the context of pre- and post-test genetic counseling to ensure the patient's informed decision making. Patients who meet clinical criteria for a syndrome as well as those with identified pathogenic germline mutations should receive appropriate surveillance measures in order to minimize their overall risk of developing syndrome-specific cancers. This guideline specifically discusses genetic testing and management of Lynch syndrome, familial adenomatous polyposis (FAP), attenuated familial adenomatous polyposis (AFAP), MUTYH-associated polyposis (MAP), Peutz-Jeghers syndrome, juvenile polyposis syndrome, Cowden syndrome, serrated (hyperplastic) polyposis syndrome, hereditary pancreatic cancer, and hereditary gastric cancer.
Collapse
|
|
43
|
Bizzotto A, Riccioni ME, Landi R, Marmo C, Barbaro B, Costamagna G. Small-Bowel Tumors, Polyps, and Polyposis Syndromes. ENDOSCOPY IN SMALL BOWEL DISORDERS 2015:175-198. [DOI: 10.1007/978-3-319-14415-3_13] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 01/05/2025]
|
|
44
|
Evaluation of the Small Bowel and Colon. Gastrointest Endosc 2015. [DOI: 10.1007/978-1-4939-2032-7_5] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 01/05/2025]
|
|
45
|
Baltes P, Kurniawan N, Keuchel M. Capsule endoscopy in the evaluation of small bowel tumors and polyps. TECHNIQUES IN GASTROINTESTINAL ENDOSCOPY 2015. [DOI: 10.1016/j.tgie.2015.02.002] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.1] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 02/07/2023]
|
|
46
|
Redondo-Cerezo E, Sánchez-Capilla AD, De La Torre-Rubio P, De Teresa J. Wireless capsule endoscopy: perspectives beyond gastrointestinal bleeding. World J Gastroenterol 2014; 20:15664-15673. [PMID: 25400450 PMCID: PMC4229531 DOI: 10.3748/wjg.v20.i42.15664] [Citation(s) in RCA: 13] [Impact Index Per Article: 1.2] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 02/26/2014] [Revised: 04/09/2014] [Accepted: 06/26/2014] [Indexed: 02/06/2023] Open
Abstract
Wireless capsule endoscopy (CE) is a technology developed for the endoscopic exploration of the small bowel. The first capsule model was approved by the Food and Drug Administration in 2001, and its first and essential indication was occult gastrointestinal (GI) bleeding. Over subsequent years, this technology has been refined to provide superior resolution, increased battery life, and capabilities to view different parts of the GI tract. Indeed, cases for which CE proved useful have increased significantly over the last few years, with new indications for the small bowel and technical improvements that have expanded its use to other parts of the GI tract, including the esophagus and colon. The main challenges in the development of CE are new devices with the ability to provide therapy, air inflation for a better vision of the small bowel, biopsy sampling systems attached to the capsule and the possibility to guide and move the capsule with an external motion control. In this article we review the current and new indications of CE, and the evolving technological changes shaping this technology, which has a promising potential in the coming future of gastroenterology.
Collapse
|
|
47
|
Macaron C, Leach BH, Burke CA. Hereditary colorectal cancer syndromes and genetic testing. J Surg Oncol 2014; 111:103-11. [PMID: 24975382 DOI: 10.1002/jso.23706] [Citation(s) in RCA: 12] [Impact Index Per Article: 1.1] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/08/2014] [Accepted: 05/24/2014] [Indexed: 12/15/2022]
Abstract
Colorectal cancer (CRC) is a leading cause of cancer and cancer deaths in the Western world. Approximately 5-10% of CRC are hereditary, due to a defined genetic cause. Individuals and families affected with a hereditary CRC syndrome exhibit benign and malignant extra-intestinal tumors, require aggressive cancer screening and benefit from management by a multi-disciplinary team of professionals. The clinical manifestations, genetic causes and current management of patients with hereditary colon cancer syndrome is provided.
Collapse
Affiliation(s)
- Carole Macaron
- Department of Gastroenterology and Hepatology, The Cleveland Clinic, Cleveland, Ohio
| | | | | |
Collapse
|
|
48
|
Sun L, Guzzetta AA, Fu T, Chen J, Jeschke J, Kwak R, Vatapalli R, Baylin SB, Iacobuzio-Donahue CA, Wolfgang CL, Ahuja N. CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas. Epigenetics 2014; 9:738-746. [PMID: 24518818 PMCID: PMC4063833 DOI: 10.4161/epi.28082] [Citation(s) in RCA: 7] [Impact Index Per Article: 0.6] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/23/2013] [Revised: 01/30/2014] [Accepted: 02/03/2014] [Indexed: 12/20/2022] Open
Abstract
CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance.
Collapse
Affiliation(s)
- Lifeng Sun
- Department of Surgical Oncology; Second Affiliated Hospital; Zhejiang University School of Medicine; Hangzhou, PR China
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Angela A Guzzetta
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Tao Fu
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
- Department of Urology; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
- Department of Gastrointestinal Surgery; Daping Hospital; Third Military Medical University; Chongqing, PR China
| | - Jinming Chen
- Department of Surgical Oncology; Second Affiliated Hospital; Zhejiang University School of Medicine; Hangzhou, PR China
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Jana Jeschke
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Ruby Kwak
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Rajita Vatapalli
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Stephen B Baylin
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Christine A Iacobuzio-Donahue
- Department of Pathology; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Christopher L Wolfgang
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
- Department of Oncology; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| | - Nita Ahuja
- Department of Surgery; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
- Department of Urology; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
- Department of Gastrointestinal Surgery; Daping Hospital; Third Military Medical University; Chongqing, PR China
- Department of Oncology; The Sidney Kimmel Comprehensive Cancer Center; The Johns Hopkins University School of Medicine; Baltimore, MD USA
| |
Collapse
|
|
49
|
Rahman I, Patel P, Rondonotti E, Koulaouzidis A, Pennazio M, Kalla R, Sidhu R, Mooney P, Sanders D, Despott EJ, Fraser C, Kurniawan N, Baltes P, Keuchel M, Davison C, Beejay N, Parker C, Panter S. Small Bowel Capsule Endoscopy. HANDBOOK OF CAPSULE ENDOSCOPY 2014:47-118. [DOI: 10.1007/978-94-017-9229-5_3] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.1] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 01/05/2025]
|
|
50
|
Wang A, Banerjee S, Barth BA, Bhat YM, Chauhan S, Gottlieb KT, Konda V, Maple JT, Murad F, Pfau PR, Pleskow DK, Siddiqui UD, Tokar JL, Rodriguez SA. Wireless capsule endoscopy. Gastrointest Endosc 2013; 78:805-815. [PMID: 24119509 DOI: 10.1016/j.gie.2013.06.026] [Citation(s) in RCA: 189] [Impact Index Per Article: 15.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 06/24/2013] [Accepted: 06/25/2013] [Indexed: 02/07/2023]
Abstract
Over the last decade, WCE has established itself as a valuable test for imaging the small intestine. It is a safe and relatively easy procedure to perform that can provide valuable information in the diagnosis of small-bowel conditions. Its applications still remain limited within the esophagus and colon. Future developments may include improving visualization within the esophagus and developing technologies that may allow manipulation of the capsule within the GI tract and biopsy capabilities.
Collapse
|