|
1
|
Chuang CC, Liu YC, Ou YY. DeepEpiIL13: Deep Learning for Rapid and Accurate Prediction of IL-13-Inducing Epitopes Using Pretrained Language Models and Multiwindow Convolutional Neural Networks. ACS OMEGA 2025; 10:9675-9683. [PMID: 40092768 PMCID: PMC11904640 DOI: 10.1021/acsomega.4c10960] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Grants] [Track Full Text] [Figures] [Subscribe] [Scholar Register] [Received: 12/03/2024] [Revised: 02/12/2025] [Accepted: 02/14/2025] [Indexed: 03/19/2025]
Abstract
Accurate prediction of interleukin-13 (IL-13)-inducing epitopes is crucial for advancing targeted therapies against allergic inflammation, the cytokine storm associated with severe COVID-19, and related disorders. Current epitope prediction methods, however, often exhibit limitations in efficiency and accuracy. To address this, we introduce DeepEpilL13, a novel deep learning framework that uniquely synergizes pretrained language models with multiwindow convolutional neural networks (CNNs) for the rapid and accurate identification of IL-13-inducing epitopes from protein sequences. DeepEpilL13 leverages high-dimensional embeddings generated by the pretrained language model, which capture rich contextual information from protein sequences. These embeddings are then processed by a multiwindow CNN architecture, enabling the effective exploration of both local and global sequence patterns pertinent to IL-13 induction. The proposed DeepEpilL13 approach underwent rigorous evaluation using both benchmark data sets and an independent SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) data set. Results demonstrate that DeepEpilL13 achieves superior performance compared with traditional methods. On the benchmark data set, DeepEpilL13 attained a Matthews correlation coefficient (MCC) of 0.52 and an area under the receiver operating characteristic curve (AUC) of 0.86. Notably, when assessed on the independent SARS-CoV-2 data set, DeepEpilL13 exhibited remarkable robustness, achieving an MCC of 0.63 and an AUC of 0.92. These metrics underscore the enhanced predictive capability and robust applicability of DeepEpilL13, particularly within the context of the COVID-19 research and related viral infections. This study presents DeepEpilL13 as a powerful and efficient deep learning framework for accurate epitope prediction. By offering significant improvement in performance and robustness, DeepEpilL13 provides new and promising avenues for the development of epitope-based vaccines and immunotherapies specifically targeting IL-13-mediated disorders. The successful and rapid identification of IL-13-inducing epitopes using DeepEpilL13 paves the way for novel therapeutic interventions against a range of conditions, including allergic diseases, inflammatory conditions, and severe viral infections such as COVID-19, with potential for a significant impact on public health outcomes.
Collapse
Affiliation(s)
- Cheng-Che Chuang
- Department
of Computer Science and Engineering, Yuan
Ze University, Chung-Li 32003, Taiwan
| | - Yu-Chen Liu
- Department
of Computer Science and Engineering, Yuan
Ze University, Chung-Li 32003, Taiwan
| | - Yu-Yen Ou
- Department
of Computer Science and Engineering, Yuan
Ze University, Chung-Li 32003, Taiwan
- Graduate
Program in Biomedical Informatics, Yuan
Ze University, Chung-Li 32003, Taiwan
| |
Collapse
|
|
2
|
Panda K, Alagarasu K, Tagore R, Paingankar M, Kumar S, Jeengar MK, Cherian S, Parashar D. RNAi-Induced Gene Silencing against Chikungunya and COVID-19: What Have We Learned So Far, and What Is the Way Forward? Viruses 2024; 16:1489. [PMID: 39339965 PMCID: PMC11437507 DOI: 10.3390/v16091489] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/19/2024] [Revised: 08/27/2024] [Accepted: 08/29/2024] [Indexed: 09/30/2024] Open
Abstract
RNA interference (RNAi) is a process in which small RNA molecules (such as small interfering RNAs or siRNAs) bind to specific messenger RNAs (mRNAs), leading to its degradation and inhibition of protein synthesis. Our studies have shown that RNAi can effectively silence genes involved in the replication of the Chikungunya virus (CHIKV) in cells. However, these investigations were performed only in laboratory settings and have yet to be tested in human clinical trials. Researchers need to conduct more research to determine the safety and efficacy of RNAi-based therapies as a therapeutic agent to treat viral infections. In this review, the history of evolution of siRNA as an inhibitor of protein synthesis, along with its current developments, is discussed based on our experience. Moreover, this review examines the hurdles and future implications associated with siRNA based therapeutic approaches.
Collapse
Affiliation(s)
- Kingshuk Panda
- Dengue & Chikungunya Group, ICMR-National Institute of Virology, 20-A, Dr. Ambedkar Road, Pune 411001, India; (K.P.); (K.A.); (R.T.); (M.P.); (S.K.); (M.K.J.)
| | - Kalichamy Alagarasu
- Dengue & Chikungunya Group, ICMR-National Institute of Virology, 20-A, Dr. Ambedkar Road, Pune 411001, India; (K.P.); (K.A.); (R.T.); (M.P.); (S.K.); (M.K.J.)
- Academy of Scientific and Innovative Research (AcSIR), Ghaziabad 201002, India;
| | - Rajarshee Tagore
- Dengue & Chikungunya Group, ICMR-National Institute of Virology, 20-A, Dr. Ambedkar Road, Pune 411001, India; (K.P.); (K.A.); (R.T.); (M.P.); (S.K.); (M.K.J.)
| | - Mandar Paingankar
- Dengue & Chikungunya Group, ICMR-National Institute of Virology, 20-A, Dr. Ambedkar Road, Pune 411001, India; (K.P.); (K.A.); (R.T.); (M.P.); (S.K.); (M.K.J.)
| | - Satyendra Kumar
- Dengue & Chikungunya Group, ICMR-National Institute of Virology, 20-A, Dr. Ambedkar Road, Pune 411001, India; (K.P.); (K.A.); (R.T.); (M.P.); (S.K.); (M.K.J.)
| | - Manish Kumar Jeengar
- Dengue & Chikungunya Group, ICMR-National Institute of Virology, 20-A, Dr. Ambedkar Road, Pune 411001, India; (K.P.); (K.A.); (R.T.); (M.P.); (S.K.); (M.K.J.)
| | - Sarah Cherian
- Academy of Scientific and Innovative Research (AcSIR), Ghaziabad 201002, India;
- Bioinformatics Group, ICMR-National Institute of Virology, 20-A, Dr. Ambedkar Road, Pune 411001, India
| | - Deepti Parashar
- Dengue & Chikungunya Group, ICMR-National Institute of Virology, 20-A, Dr. Ambedkar Road, Pune 411001, India; (K.P.); (K.A.); (R.T.); (M.P.); (S.K.); (M.K.J.)
- Academy of Scientific and Innovative Research (AcSIR), Ghaziabad 201002, India;
| |
Collapse
|
|
3
|
Fopase R, Panda C, Rajendran AP, Uludag H, Pandey LM. Potential of siRNA in COVID-19 therapy: Emphasis on in silico design and nanoparticles based delivery. Front Bioeng Biotechnol 2023; 11:1112755. [PMID: 36814718 PMCID: PMC9939533 DOI: 10.3389/fbioe.2023.1112755] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/30/2022] [Accepted: 01/13/2023] [Indexed: 02/09/2023] Open
Abstract
Small interfering RNA (siRNA)-mediated mRNA degradation approach have imparted its eminence against several difficult-to-treat genetic disorders and other allied diseases. Viral outbreaks and resulting pandemics have repeatedly threatened public health and questioned human preparedness at the forefront of drug design and biomedical readiness. During the recent pandemic caused by the SARS-CoV-2, mRNA-based vaccination strategies have paved the way for a new era of RNA therapeutics. RNA Interference (RNAi) based approach using small interfering RNA may complement clinical management of the COVID-19. RNA Interference approach will primarily work by restricting the synthesis of the proteins required for viral replication, thereby hampering viral cellular entry and trafficking by targeting host as well as protein factors. Despite promising benefits, the stability of small interfering RNA in the physiological environment is of grave concern as well as site-directed targeted delivery and evasion of the immune system require immediate attention. In this regard, nanotechnology offers viable solutions for these challenges. The review highlights the potential of small interfering RNAs targeted toward specific regions of the viral genome and the features of nanoformulations necessary for the entrapment and delivery of small interfering RNAs. In silico design of small interfering RNA for different variants of SARS-CoV-2 has been discussed. Various nanoparticles as promising carriers of small interfering RNAs along with their salient properties, including surface functionalization, are summarized. This review will help tackle the real-world challenges encountered by the in vivo delivery of small interfering RNAs, ensuring a safe, stable, and readily available drug candidate for efficient management of SARS-CoV-2 in the future.
Collapse
Affiliation(s)
- Rushikesh Fopase
- Bio-Interface & Environmental Engineering Lab, Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Assam, India
| | - Chinmaya Panda
- Bio-Interface & Environmental Engineering Lab, Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Assam, India
| | - Amarnath P. Rajendran
- Department of Chemical & Materials Engineering, Faculty of Engineering, University of Alberta, Edmonton, AB, Canada
| | - Hasan Uludag
- Department of Chemical & Materials Engineering, Faculty of Engineering, University of Alberta, Edmonton, AB, Canada
- Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, AB, Canada
- Department of Biomedical Engineering, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB, Canada
| | - Lalit M. Pandey
- Bio-Interface & Environmental Engineering Lab, Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Assam, India
| |
Collapse
|
|
4
|
siRNA Functionalized Lipid Nanoparticles (LNPs) in Management of Diseases. Pharmaceutics 2022; 14:pharmaceutics14112520. [PMID: 36432711 PMCID: PMC9694336 DOI: 10.3390/pharmaceutics14112520] [Citation(s) in RCA: 31] [Impact Index Per Article: 10.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/01/2022] [Revised: 11/13/2022] [Accepted: 11/16/2022] [Indexed: 11/22/2022] Open
Abstract
RNAi (RNA interference)-based technology is emerging as a versatile tool which has been widely utilized in the treatment of various diseases. siRNA can alter gene expression by binding to the target mRNA and thereby inhibiting its translation. This remarkable potential of siRNA makes it a useful candidate, and it has been successively used in the treatment of diseases, including cancer. However, certain properties of siRNA such as its large size and susceptibility to degradation by RNases are major drawbacks of using this technology at the broader scale. To overcome these challenges, there is a requirement for versatile tools for safe and efficient delivery of siRNA to its target site. Lipid nanoparticles (LNPs) have been extensively explored to this end, and this paper reviews different types of LNPs, namely liposomes, solid lipid NPs, nanostructured lipid carriers, and nanoemulsions, to highlight this delivery mode. The materials and methods of preparation of the LNPs have been described here, and pertinent physicochemical properties such as particle size, surface charge, surface modifications, and PEGylation in enhancing the delivery performance (stability and specificity) have been summarized. We have discussed in detail various challenges facing LNPs and various strategies to overcome biological barriers to undertake the safe delivery of siRNA to a target site. We additionally highlighted representative therapeutic applications of LNP formulations with siRNA that may offer unique therapeutic benefits in such wide areas as acute myeloid leukaemia, breast cancer, liver disease, hepatitis B and COVID-19 as recent examples.
Collapse
|
|
5
|
Sartaj Sohrab S, Aly El-Kafrawy S, Ibraheem Azhar E. In silico prediction and experimental evaluation of potential siRNAs against SARS-CoV-2 inhibition in Vero E6 cells. JOURNAL OF KING SAUD UNIVERSITY - SCIENCE 2022; 34:102049. [PMID: 35493709 PMCID: PMC9040457 DOI: 10.1016/j.jksus.2022.102049] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.7] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 11/23/2021] [Revised: 12/13/2021] [Accepted: 04/18/2022] [Indexed: 11/21/2022]
Abstract
Objective The acute cases of pneumonia (COVID-19) were first reported from China in December 2019, and the pathogen was identified as SARS-CoV-2. Currently, many vaccines have been developed against this virus by using multiple genes, applying different platforms, and used for the vaccinations of the human population. Spike protein genes play an important role in host cell attachment and viral entry and have been extensively used for the development of vaccine and antiviral therapeutics. Short interfering RNA is also known as silencing RNA and contribute a significant role to regulate the expression of a specific gene. By using this technology, virus inhibition has been demonstrated against many viral diseases. Methods In this work, we have reported the Insilico prediction, designing, and experimental validation of siRNAs antiviral potency against SARS-CoV-2-S-RBD. The siDirect 2.0 was selected for siRNAs prediction, and secondary structure was predicted by RNAfold while the HNADOCK was used for molecular docking analysis and specific binding of siRNAs to the selected target. We have used and evaluated four siRNAs for cellular toxicity and determination of antiviral efficiency based on the Ct value of q-real-time PCR in Vero E6 cells. Results Based on the experimental evaluation and analysis of results from generated data, we observed that there is no cytotoxicity for any tested siRNAs in Vero E6 cells. Total four siRNA were filtered out from twenty-one siRNAs following the strict selection and scoring criteria. The better antiviral efficiency was observed in 3rd siRNAs based on the Ct value of q-real-time PCR. The results that emerged from this study encouraged us to validate the efficiency of these siRNAs in multiple cells by using alone and in a combination of two or more siRNAs to inhibit the SARS-CoV-2 proliferation. Conclusion The Insilico prediction, molecular docking analysis provided the selection of better siRNAs. Based on the experimental evaluation only 3rd siRNA was found to be more effective than others and showed better antiviral efficiency. These siRNAs should also be evaluated in other cell lines either separately or in combination against SARS-CoV-2 to determine their antiviral efficiency.
Collapse
|
|
6
|
Sohrab SS, El-Kafrawy SA, Azhar EI. Effect of insilico predicted and designed potential siRNAs on inhibition of SARS-CoV-2 in HEK-293 cells. JOURNAL OF KING SAUD UNIVERSITY - SCIENCE 2022; 34:101965. [PMID: 35313445 PMCID: PMC8925144 DOI: 10.1016/j.jksus.2022.101965] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 12/27/2021] [Revised: 02/01/2022] [Accepted: 03/08/2022] [Indexed: 11/26/2022]
Abstract
Objectives The COVID-19 was identified for the first time from the sea food market, Wuhan city, China in 2019 and the pathogenic organism was identified as SARS-CoV-2. Currently, this virus has spread to 223 countries and territories and known as a serious issue for the global human community. Many vaccines have been developed and used for immunization. Methods We have reported the insilico prediction, designing, secondary structure prediction, molecular docking analysis, and in vitro assessment of siRNAs against SARS-CoV-2. The online bioinformatic approach was used for siRNAs selection and designing. The selected siRNAs were evaluated for antiviral efficacy by using Lipofectamine 2000 as delivery agent to HEK-293 cells. The MTT assay was used for cytotoxicity determination. The antiviral efficacy of potential siRNAs was determined based on the Ct value of q-RT-PCR and the data analysis was done by Prism-GraphPad software. Results The analyzed data resulted in the selection of only three siRNAs out of twenty-six siRNAs generated by online software. The secondary structure prediction and molecular docking analysis of siRNAs revealed the efficient binding to the target. There was no cellular toxicity observed in the HEK-293 cells at any tested concentrations of siRNAs. The purification of RNA was completed from inoculated cells and subjected to q-RT-PCR. The highest Ct value was observed in siRNA 3 than the others. The results offered valuable evidence and invigorated us to assess the potency of siRNAs by using alone or in combination in other human cells. Conclusion The data generated from this study indicates the significance of in silico prediction and narrow down the potential siRNA' against SARS-CoV-2, and molecular docking investigation offered the effective siRNAs binding with the target. Finally, it is concluded that the online bioinformatics approach provided the prediction and selection of siRNAs with better antiviral efficacy. The siRNA-3 was observed to be the best for reduction of viral RNA in cells.
Collapse
|
|
7
|
Saravanan KA, Panigrahi M, Kumar H, Rajawat D, Nayak SS, Bhushan B, Dutt T. Role of genomics in combating COVID-19 pandemic. Gene 2022; 823:146387. [PMID: 35248659 PMCID: PMC8894692 DOI: 10.1016/j.gene.2022.146387] [Citation(s) in RCA: 26] [Impact Index Per Article: 8.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/03/2022] [Revised: 02/17/2022] [Accepted: 02/28/2022] [Indexed: 12/20/2022]
Abstract
The coronavirus disease 2019 (COVID-19) quickly swept over the world, becoming one of the most devastating outbreaks in human history. Being the first pandemic in the post-genomic era, advancements in genomics contributed significantly to scientific understanding and public health response to COVID-19. Genomic technologies have been employed by researchers all over the world to better understand the biology of SARS-CoV-2 and its origin, genomic diversity, and evolution. Worldwide genomic resources have greatly aided in the investigation of the COVID-19 pandemic. The pandemic has ushered in a new era of genomic surveillance, wherein scientists are tracking the changes of the SARS-CoV-2 genome in real-time at the international and national levels. Availability of genomic and proteomic information enables the rapid development of molecular diagnostics and therapeutics. The advent of high-throughput sequencing and genome editing technologies led to the development of modern vaccines. We briefly discuss the impact of genomics in the ongoing COVID-19 pandemic in this review.
Collapse
Affiliation(s)
- K A Saravanan
- Division of Animal Genetics, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP, India
| | - Manjit Panigrahi
- Division of Animal Genetics, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP, India.
| | - Harshit Kumar
- Division of Animal Genetics, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP, India
| | - Divya Rajawat
- Division of Animal Genetics, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP, India
| | - Sonali Sonejita Nayak
- Division of Animal Genetics, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP, India
| | - Bharat Bhushan
- Division of Animal Genetics, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP, India
| | - Triveni Dutt
- Livestock Production and Management Section, Indian Veterinary Research Institute, Izatnagar, Bareilly 243122, UP, India
| |
Collapse
|
|
8
|
Design of siRNA molecules for silencing of membrane glycoprotein, nucleocapsid phosphoprotein, and surface glycoprotein genes of SARS-CoV2. J Genet Eng Biotechnol 2022; 20:65. [PMID: 35482116 PMCID: PMC9047631 DOI: 10.1186/s43141-022-00346-z] [Citation(s) in RCA: 6] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/13/2021] [Accepted: 04/18/2022] [Indexed: 12/24/2022]
Abstract
The global COVID-19 pandemic caused by SARS-CoV2 infected millions of people and resulted in more than 4 million deaths worldwide. Apart from vaccines and drugs, RNA silencing is a novel approach for treating COVID-19. In the present study, siRNAs were designed for the conserved regions targeting three structural genes, M, N, and S, from forty whole-genome sequences of SARS-CoV2 using four different software, RNAxs, siDirect, i-Score Designer, and OligoWalk. Only siRNAs which were predicted in common by all the four servers were considered for further shortlisting. A multistep filtering approach has been adopted in the present study for the final selection of siRNAs by the usage of different online tools, viz., siRNA scales, MaxExpect, DuplexFold, and SMEpred. All these web-based tools consider several important parameters for designing functional siRNAs, e.g., target-site accessibility, duplex stability, position-specific nucleotide preference, inhibitory score, thermodynamic parameters, GC content, and efficacy in cleaving the target. In addition, a few parameters like GC content and dG value of the entire siRNA were also considered for shortlisting of the siRNAs. Antisense strands were subjected to check for any off-target similarities using BLAST. Molecular docking was carried out to study the interactions of guide strands with AGO2 protein. A total of six functional siRNAs (two for each gene) have been finally selected for targeting M, N, and S genes of SARS-CoV2. The siRNAs have not shown any off-target effects, interacted with the domain(s) of AGO2 protein, and were efficacious in cleaving the target mRNA. However, the siRNAs designed in the present study need to be tested in vitro and in vivo in the future.
Collapse
|
|
9
|
Saba AA, Adiba M, Chakraborty S, Nabi AHMN. Prediction of putative potential siRNAs for inhibiting SARS-CoV-2 strains, including variants of concern and interest. Future Microbiol 2022; 17:449-463. [PMID: 35285248 PMCID: PMC8958991 DOI: 10.2217/fmb-2021-0130] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/15/2021] [Accepted: 02/10/2022] [Indexed: 12/22/2022] Open
Abstract
Aim: To predict siRNAs as a therapeutic intervention for highly infectious new variants of SARS-CoV-2. Methods: Conserved coding sequence regions of 11 SARS-CoV-2 proteins were used to construct siRNAs through sampling of metadata comprising 214,256 sequences. Results: Predicted siRNAs S1: 5'-UCAUUGAGAAAUGUUUACGCA-3' and S2: 5'-AAAGACAUCAGCAUACUCCUG-3' against RdRp of SARS-CoV-2 satisfied all the stringent filtering processes and showed good binding characteristics. The designed siRNAs are expected to inhibit viral replication and transcription of various coronavirus strains encompassing variants of concern and interest. Conclusion: The predicted siRNAs are expected to be potent against SARS-CoV-2, and following in vitro and in vivo validations may be considered as potential therapeutic measures.
Collapse
Affiliation(s)
- Abdullah Al Saba
- Department of Biochemistry and Molecular Biology, Laboratory of Population Genetics, University of Dhaka, Dhaka, 1000, Bangladesh
| | - Maisha Adiba
- Department of Biochemistry and Molecular Biology, Laboratory of Population Genetics, University of Dhaka, Dhaka, 1000, Bangladesh
| | - Sajib Chakraborty
- Department of Biochemistry and Molecular Biology, Systems Cell-Signalling Laboratory, University of Dhaka, Dhaka, 1000, Bangladesh
| | - AHM Nurun Nabi
- Department of Biochemistry and Molecular Biology, Laboratory of Population Genetics, University of Dhaka, Dhaka, 1000, Bangladesh
| |
Collapse
|
|
10
|
Abusalah MAH, Khalifa M, Al-Hatamleh MAI, Jarrar M, Mohamud R, Chan YY. Nucleic Acid-Based COVID-19 Therapy Targeting Cytokine Storms: Strategies to Quell the Storm. J Pers Med 2022; 12:386. [PMID: 35330388 PMCID: PMC8948998 DOI: 10.3390/jpm12030386] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/27/2022] [Revised: 02/21/2022] [Accepted: 02/28/2022] [Indexed: 02/07/2023] Open
Abstract
Coronavirus disease 2019 (COVID-19) has shaken the world and triggered drastic changes in our lifestyle to control it. Despite the non-typical efforts, COVID-19 still thrives and plagues humanity worldwide. The unparalleled degree of infection has been met with an exceptional degree of research to counteract it. Many drugs and therapeutic technologies have been repurposed and discovered, but no groundbreaking antiviral agent has been introduced yet to eradicate COVID-19 and restore normalcy. As lethality is directly correlated with the severity of disease, hospitalized severe cases are of the greatest importance to reduce, especially the cytokine storm phenomenon. This severe inflammatory phenomenon characterized by elevated levels of inflammatory mediators can be targeted to relieve symptoms and save the infected patients. One of the promising therapeutic strategies to combat COVID-19 is nucleic acid-based therapeutic approaches, including microRNAs (miRNAs). This work is an up-to-date review aimed to comprehensively discuss the current nucleic acid-based therapeutics against COVID-19 and their mechanisms of action, taking into consideration the emerging SARS-CoV-2 variants of concern, as well as providing potential future directions. miRNAs can be used to run interference with the expression of viral proteins, while endogenous miRNAs can be targeted as well, offering a versatile platform to control SARS-CoV-2 infection. By targeting these miRNAs, the COVID-19-induced cytokine storm can be suppressed. Therefore, nucleic acid-based therapeutics (miRNAs included) have a latent ability to break the COVID-19 infection in general and quell the cytokine storm in particular.
Collapse
Affiliation(s)
- Mai Abdel Haleem Abusalah
- Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, Kota Bharu 16150, Kelantan, Malaysia;
| | - Moad Khalifa
- School of Health Sciences, Health Campus, Universiti Sains Malaysia, Kubang Kerian, Kota Bharu 16150, Kelantan, Malaysia;
| | - Mohammad A. I. Al-Hatamleh
- Department of Immunology, School of Medical Sciences, Universiti Sains Malaysia, Kota Bharu 16150, Kelantan, Malaysia; (M.A.I.A.-H.); (R.M.)
| | - Mu’taman Jarrar
- College of Medicine, Imam Abdulrahman Bin Faisal University, Dammam 34212, Saudi Arabia;
- Medical Education Department, King Fahd Hospital of the University, Al-Khobar 34445, Saudi Arabia
| | - Rohimah Mohamud
- Department of Immunology, School of Medical Sciences, Universiti Sains Malaysia, Kota Bharu 16150, Kelantan, Malaysia; (M.A.I.A.-H.); (R.M.)
| | - Yean Yean Chan
- Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, Kota Bharu 16150, Kelantan, Malaysia;
| |
Collapse
|
|
11
|
Friedrich M, Pfeifer G, Binder S, Aigner A, Vollmer Barbosa P, Makert GR, Fertey J, Ulbert S, Bodem J, König EM, Geiger N, Schambach A, Schilling E, Buschmann T, Hauschildt S, Koehl U, Sewald K. Selection and Validation of siRNAs Preventing Uptake and Replication of SARS-CoV-2. Front Bioeng Biotechnol 2022; 10:801870. [PMID: 35309990 PMCID: PMC8925020 DOI: 10.3389/fbioe.2022.801870] [Citation(s) in RCA: 16] [Impact Index Per Article: 5.3] [Reference Citation Analysis] [Abstract] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/25/2021] [Accepted: 02/07/2022] [Indexed: 12/16/2022] Open
Abstract
In 2019, the novel highly infectious severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) outbreak rapidly led to a global pandemic with more than 346 million confirmed cases worldwide, resulting in 5.5 million associated deaths (January 2022). Entry of all SARS-CoV-2 variants is mediated by the cellular angisin-converting enzyme 2 (ACE2). The virus abundantly replicates in the epithelia of the upper respiratory tract. Beyond vaccines for immunization, there is an imminent need for novel treatment options in COVID-19 patients. So far, only a few drugs have found their way into the clinics, often with modest success. Specific gene silencing based on small interfering RNA (siRNA) has emerged as a promising strategy for therapeutic intervention, preventing/limiting SARS-CoV-2 entry into host cells or interfering with viral replication. Here, we pursued both strategies. We designed and screened nine siRNAs (siA1-9) targeting the viral entry receptor ACE2. SiA1, (siRNA against exon1 of ACE2 mRNA) was most efficient, with up to 90% knockdown of the ACE2 mRNA and protein for at least six days. In vitro, siA1 application was found to protect Vero E6 and Huh-7 cells from infection with SARS-CoV-2 with an up to ∼92% reduction of the viral burden indicating that the treatment targets both the endosomal and the viral entry at the cytoplasmic membrane. Since the RNA-encoded genome makes SARS-CoV-2 vulnerable to RNA interference (RNAi), we designed and analysed eight siRNAs (siV1-8) directly targeting the Orf1a/b region of the SARS-CoV-2 RNA genome, encoding for non-structural proteins (nsp). As a significant hallmark of this study, we identified siV1 (siRNA against leader protein of SARS-CoV-2), which targets the nsp1-encoding sequence (a.k.a. ‘host shutoff factor’) as particularly efficient. SiV1 inhibited SARS-CoV-2 replication in Vero E6 or Huh-7 cells by more than 99% or 97%, respectively. It neither led to toxic effects nor induced type I or III interferon production. Of note, sequence analyses revealed the target sequence of siV1 to be highly conserved in SARS-CoV-2 variants. Thus, our results identify the direct targeting of the viral RNA genome (ORF1a/b) by siRNAs as highly efficient and introduce siV1 as a particularly promising drug candidate for therapeutic intervention.
Collapse
Affiliation(s)
- Maik Friedrich
- Institute of Clinical Immunology, Faculty of Leipzig University of Leipzig, Max-Bürger-Forschungszentrum (MBFZ), Leipzig, Germany
- Department of Vaccines and Infection Models, Fraunhofer Institute for Cell Therapy and Immunology IZI, Leipzig, Germany
- *Correspondence: Maik Friedrich,
| | - Gabriele Pfeifer
- Institute of Clinical Immunology, Faculty of Leipzig University of Leipzig, Max-Bürger-Forschungszentrum (MBFZ), Leipzig, Germany
| | - Stefanie Binder
- Institute of Clinical Immunology, Faculty of Leipzig University of Leipzig, Max-Bürger-Forschungszentrum (MBFZ), Leipzig, Germany
| | - Achim Aigner
- Rudolf Boehm Institute for Pharmacology and Toxicology, Clinical Pharmacology, Leipzig University, Faculty of Medicine, Leipzig, Germany
| | | | - Gustavo R. Makert
- Department of Vaccines and Infection Models, Fraunhofer Institute for Cell Therapy and Immunology IZI, Leipzig, Germany
| | - Jasmin Fertey
- Department of Vaccines and Infection Models, Fraunhofer Institute for Cell Therapy and Immunology IZI, Leipzig, Germany
| | - Sebastian Ulbert
- Department of Vaccines and Infection Models, Fraunhofer Institute for Cell Therapy and Immunology IZI, Leipzig, Germany
| | - Jochen Bodem
- Institute of Virology, Julius-Maximilians-Universität Würzburg, Würzburg, Germany
| | - Eva-Maria König
- Institute of Virology, Julius-Maximilians-Universität Würzburg, Würzburg, Germany
| | - Nina Geiger
- Institute of Virology, Julius-Maximilians-Universität Würzburg, Würzburg, Germany
| | - Axel Schambach
- Institute of Experimental Hematology, Hannover Medical School, Hannover, Germany
- REBIRTH Research Center for Translational Regenerative Medicine, Hannover Medical School, Hannover, Germany
- Boston Children’s Hospital, Harvard Medical School, Boston, MA, United States
| | - Erik Schilling
- Institute of Clinical Immunology, Faculty of Leipzig University of Leipzig, Max-Bürger-Forschungszentrum (MBFZ), Leipzig, Germany
| | - Tilo Buschmann
- Institute of Clinical Immunology, Faculty of Leipzig University of Leipzig, Max-Bürger-Forschungszentrum (MBFZ), Leipzig, Germany
| | | | - Ulrike Koehl
- Institute of Clinical Immunology, Faculty of Leipzig University of Leipzig, Max-Bürger-Forschungszentrum (MBFZ), Leipzig, Germany
- Department of Vaccines and Infection Models, Fraunhofer Institute for Cell Therapy and Immunology IZI, Leipzig, Germany
- REBIRTH Research Center for Translational Regenerative Medicine, Hannover Medical School, Hannover, Germany
- Institute for Cellular Therapeutics, Hannover Medical School, Hannover, Germany
| | - Katherina Sewald
- Fraunhofer Institute of Toxicology and Experimental Medicine, Biomedical Research in Endstage and Obstructive Lung Disease Hannover (BREATH) of the German Center for Lung Research (DZL), Hannover, Germany
| |
Collapse
|
|
12
|
Zhang Y, Almazi JG, Ong HX, Johansen MD, Ledger S, Traini D, Hansbro PM, Kelleher AD, Ahlenstiel CL. Nanoparticle Delivery Platforms for RNAi Therapeutics Targeting COVID-19 Disease in the Respiratory Tract. Int J Mol Sci 2022; 23:2408. [PMID: 35269550 PMCID: PMC8909959 DOI: 10.3390/ijms23052408] [Citation(s) in RCA: 16] [Impact Index Per Article: 5.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/03/2022] [Revised: 02/14/2022] [Accepted: 02/18/2022] [Indexed: 02/06/2023] Open
Abstract
Since December 2019, a pandemic of COVID-19 disease, caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has rapidly spread across the globe. At present, the Food and Drug Administration (FDA) has issued emergency approval for the use of some antiviral drugs. However, these drugs still have limitations in the specific treatment of COVID-19, and as such, new treatment strategies urgently need to be developed. RNA-interference-based gene therapy provides a tractable target for antiviral treatment. Ensuring cell-specific targeted delivery is important to the success of gene therapy. The use of nanoparticles (NPs) as carriers for the delivery of small interfering RNA (siRNAs) to specific tissues or organs of the human body could play a crucial role in the specific therapy of severe respiratory infections, such as COVID-19. In this review, we describe a variety of novel nanocarriers, such as lipid NPs, star polymer NPs, and glycogen NPs, and summarize the pre-clinical/clinical progress of these nanoparticle platforms in siRNA delivery. We also discuss the application of various NP-capsulated siRNA as therapeutics for SARS-CoV-2 infection, the challenges with targeting these therapeutics to local delivery in the lung, and various inhalation devices used for therapeutic administration. We also discuss currently available animal models that are used for preclinical assessment of RNA-interference-based gene therapy. Advances in this field have the potential for antiviral treatments of COVID-19 disease and could be adapted to treat a range of respiratory diseases.
Collapse
Affiliation(s)
- Yuan Zhang
- Kirby Institute, UNSW, Sydney, NSW 2052, Australia; (Y.Z.); (S.L.); (A.D.K.)
| | - Juhura G. Almazi
- Respiratory Technology, Woolcock Institute of Medical Research, Sydney, NSW 2037, Australia; (J.G.A.); (H.X.O.); (D.T.)
- Macquarie Medical School, Faculty of Medicine, Health and Human Sciences, Macquarie University, Ryde, NSW 2109, Australia
| | - Hui Xin Ong
- Respiratory Technology, Woolcock Institute of Medical Research, Sydney, NSW 2037, Australia; (J.G.A.); (H.X.O.); (D.T.)
- Macquarie Medical School, Faculty of Medicine, Health and Human Sciences, Macquarie University, Ryde, NSW 2109, Australia
| | - Matt D. Johansen
- Centre for Inflammation, Faculty of Science, Centenary Institute and University of Technology Sydney, Sydney, NSW 2050, Australia; (M.D.J.); (P.M.H.)
| | - Scott Ledger
- Kirby Institute, UNSW, Sydney, NSW 2052, Australia; (Y.Z.); (S.L.); (A.D.K.)
| | - Daniela Traini
- Respiratory Technology, Woolcock Institute of Medical Research, Sydney, NSW 2037, Australia; (J.G.A.); (H.X.O.); (D.T.)
- Macquarie Medical School, Faculty of Medicine, Health and Human Sciences, Macquarie University, Ryde, NSW 2109, Australia
| | - Philip M. Hansbro
- Centre for Inflammation, Faculty of Science, Centenary Institute and University of Technology Sydney, Sydney, NSW 2050, Australia; (M.D.J.); (P.M.H.)
| | - Anthony D. Kelleher
- Kirby Institute, UNSW, Sydney, NSW 2052, Australia; (Y.Z.); (S.L.); (A.D.K.)
| | | |
Collapse
|
|
13
|
Conserved MicroRNAs in Human Nasopharynx Tissue Samples from Swabs Are Differentially Expressed in Response to SARS-CoV-2. Genes (Basel) 2022; 13:genes13020348. [PMID: 35205390 PMCID: PMC8871708 DOI: 10.3390/genes13020348] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.7] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/17/2022] [Revised: 02/09/2022] [Accepted: 02/11/2022] [Indexed: 12/12/2022] Open
Abstract
The use of high-throughput small RNA sequencing is well established as a technique to unveil the miRNAs in various tissues. The miRNA profiles are different between infected and non-infected tissues. We compare the SARS-CoV-2 positive and SARS-CoV-2 negative RNA samples extracted from human nasopharynx tissue samples to show different miRNA profiles. We explored differentially expressed miRNAs in response to SARS-CoV-2 in the RNA extracted from nasopharynx tissues of 10 SARS-CoV-2-positive and 10 SARS-CoV-2-negative patients. miRNAs were identified by small RNA sequencing, and the expression levels of selected miRNAs were validated by real-time RT-PCR. We identified 943 conserved miRNAs, likely generated through posttranscriptional modifications. The identified miRNAs were expressed in both RNA groups, NegS and PosS: miR-148a, miR-21, miR-34c, miR-34b, and miR-342. The most differentially expressed miRNA was miR-21, which is likely closely linked to the presence of SARS-CoV-2 in nasopharynx tissues. Our results contribute to further understanding the role of miRNAs in SARS-CoV-2 pathogenesis, which may be crucial for understanding disease symptom development in humans.
Collapse
|
|
14
|
Serebrennikova KV, Byzova NA, Zherdev AV, Khlebtsov NG, Khlebtsov BN, Biketov SF, Dzantiev BB. Lateral Flow Immunoassay of SARS-CoV-2 Antigen with SERS-Based Registration: Development and Comparison with Traditional Immunoassays. BIOSENSORS 2021; 11:510. [PMID: 34940267 PMCID: PMC8699720 DOI: 10.3390/bios11120510] [Citation(s) in RCA: 25] [Impact Index Per Article: 6.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Subscribe] [Scholar Register] [Received: 10/30/2021] [Revised: 11/28/2021] [Accepted: 12/07/2021] [Indexed: 05/04/2023]
Abstract
The current COVID-19 pandemic has increased the demand for pathogen detection methods that combine low detection limits with rapid results. Despite the significant progress in methods and devices for nucleic acid amplification, immunochemical methods are still preferred for mass testing without specialized laboratories and highly qualified personnel. The most widely used immunoassays are microplate enzyme-linked immunosorbent assay (ELISA) with photometric detection and lateral flow immunoassay (LFIA) with visual results assessment. However, the disadvantage of ELISA is its considerable duration, and that of LFIA is its low sensitivity. In this study, the modified LFIA of a specific antigen of the causative agent of COVID-19, spike receptor-binding domain, was developed and characterized. This modified LFIA includes the use of gold nanoparticles with immobilized antibodies and 4-mercaptobenzoic acid as surface-enhanced Raman scattering (SERS) nanotag and registration of the nanotag binding by SERS spectrometry. To enhance the sensitivity of LFIA-SERS analysis, we determined the optimal compositions of SERS nanotags and membranes used in LFIA. For benchmark comparison, ELISA and conventional colorimetric LFIA were used with the same immune reagents. The proposed method combines a low detection limit of 0.1 ng/mL (at 0.4 ng/mL for ELISA and 1 ng/mL for qualitative LFIA) with a short assay time equal to 20 min (at 3.5 h for ELISA and 15 min for LFIA). The results obtained demonstrate the promise of using the SERS effects in membrane immuno-analytical systems.
Collapse
Affiliation(s)
- Kseniya V. Serebrennikova
- A.N. Bach Institute of Biochemistry, Research Center of Biotechnology, Russian Academy of Sciences, 119071 Moscow, Russia; (K.V.S.); (N.A.B.); (A.V.Z.)
| | - Nadezhda A. Byzova
- A.N. Bach Institute of Biochemistry, Research Center of Biotechnology, Russian Academy of Sciences, 119071 Moscow, Russia; (K.V.S.); (N.A.B.); (A.V.Z.)
| | - Anatoly V. Zherdev
- A.N. Bach Institute of Biochemistry, Research Center of Biotechnology, Russian Academy of Sciences, 119071 Moscow, Russia; (K.V.S.); (N.A.B.); (A.V.Z.)
| | - Nikolai G. Khlebtsov
- Institute of Biochemistry and Physiology of Plants and Microorganisms, Russian Academy of Sciences, 410049 Saratov, Russia; (N.G.K.); (B.N.K.)
- Faculty of Nano- and Biomedical Technologies, Saratov State University, 410012 Saratov, Russia
| | - Boris N. Khlebtsov
- Institute of Biochemistry and Physiology of Plants and Microorganisms, Russian Academy of Sciences, 410049 Saratov, Russia; (N.G.K.); (B.N.K.)
| | - Sergey F. Biketov
- State Research Center for Applied Microbiology and Biotechnology, 142279 Obolensk, Moscow Region, Russia;
| | - Boris B. Dzantiev
- A.N. Bach Institute of Biochemistry, Research Center of Biotechnology, Russian Academy of Sciences, 119071 Moscow, Russia; (K.V.S.); (N.A.B.); (A.V.Z.)
| |
Collapse
|
|
15
|
Tolksdorf B, Nie C, Niemeyer D, Röhrs V, Berg J, Lauster D, Adler JM, Haag R, Trimpert J, Kaufer B, Drosten C, Kurreck J. Inhibition of SARS-CoV-2 Replication by a Small Interfering RNA Targeting the Leader Sequence. Viruses 2021; 13:v13102030. [PMID: 34696460 PMCID: PMC8539227 DOI: 10.3390/v13102030] [Citation(s) in RCA: 25] [Impact Index Per Article: 6.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/20/2021] [Revised: 10/04/2021] [Accepted: 10/06/2021] [Indexed: 12/16/2022] Open
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected almost 200 million people worldwide and led to approximately 4 million deaths as of August 2021. Despite successful vaccine development, treatment options are limited. A promising strategy to specifically target viral infections is to suppress viral replication through RNA interference (RNAi). Hence, we designed eight small interfering RNAs (siRNAs) targeting the highly conserved 5′-untranslated region (5′-UTR) of SARS-CoV-2. The most promising candidate identified in initial reporter assays, termed siCoV6, targets the leader sequence of the virus, which is present in the genomic as well as in all subgenomic RNAs. In assays with infectious SARS-CoV-2, it reduced replication by two orders of magnitude and prevented the development of a cytopathic effect. Moreover, it retained its activity against the SARS-CoV-2 alpha variant and has perfect homology against all sequences of the delta variant that were analyzed by bioinformatic means. Interestingly, the siRNA was even highly active in virus replication assays with the SARS-CoV-1 family member. This work thus identified a very potent siRNA with a broad activity against various SARS-CoV viruses that represents a promising candidate for the development of new treatment options.
Collapse
Affiliation(s)
- Beatrice Tolksdorf
- Applied Biochemistry, Institute of Biotechnology, Technische Universität Berlin, 10623 Berlin, Germany; (B.T.); (V.R.); (J.B.)
| | - Chuanxiong Nie
- Institute of Chemistry and Biochemistry, Freie Universität Berlin, 14195 Berlin, Germany; (C.N.); (D.L.); (R.H.)
| | - Daniela Niemeyer
- German Centre for Infection Research (DZIF), Charitéplatz 1, 10117 Berlin, Germany; (D.N.); (C.D.)
- Institute of Virology, Charité-Universitätsmedizin Berlin, 10117 Berlin, Germany
| | - Viola Röhrs
- Applied Biochemistry, Institute of Biotechnology, Technische Universität Berlin, 10623 Berlin, Germany; (B.T.); (V.R.); (J.B.)
| | - Johanna Berg
- Applied Biochemistry, Institute of Biotechnology, Technische Universität Berlin, 10623 Berlin, Germany; (B.T.); (V.R.); (J.B.)
| | - Daniel Lauster
- Institute of Chemistry and Biochemistry, Freie Universität Berlin, 14195 Berlin, Germany; (C.N.); (D.L.); (R.H.)
| | - Julia M. Adler
- Department of Veterinary Medicine, Institute of Virology, Freie Universität Berlin, 14163 Berlin, Germany; (J.M.A.); (J.T.); (B.K.)
- Department of Infectious Diseases and Respiratory Medicine, Charité-Universitätsmedizin Berlin, 10117 Berlin, Germany
| | - Rainer Haag
- Institute of Chemistry and Biochemistry, Freie Universität Berlin, 14195 Berlin, Germany; (C.N.); (D.L.); (R.H.)
| | - Jakob Trimpert
- Department of Veterinary Medicine, Institute of Virology, Freie Universität Berlin, 14163 Berlin, Germany; (J.M.A.); (J.T.); (B.K.)
| | - Benedikt Kaufer
- Department of Veterinary Medicine, Institute of Virology, Freie Universität Berlin, 14163 Berlin, Germany; (J.M.A.); (J.T.); (B.K.)
| | - Christian Drosten
- German Centre for Infection Research (DZIF), Charitéplatz 1, 10117 Berlin, Germany; (D.N.); (C.D.)
- Institute of Virology, Charité-Universitätsmedizin Berlin, 10117 Berlin, Germany
| | - Jens Kurreck
- Applied Biochemistry, Institute of Biotechnology, Technische Universität Berlin, 10623 Berlin, Germany; (B.T.); (V.R.); (J.B.)
- Correspondence: ; Tel.:+ 49-30-314-27581
| |
Collapse
|
|
16
|
Zhang C, Forsdyke DR. Potential Achilles heels of SARS-CoV-2 are best displayed by the base order-dependent component of RNA folding energy. Comput Biol Chem 2021; 94:107570. [PMID: 34500325 PMCID: PMC8410225 DOI: 10.1016/j.compbiolchem.2021.107570] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/02/2021] [Revised: 08/29/2021] [Accepted: 08/30/2021] [Indexed: 11/29/2022]
Abstract
The base order-dependent component of folding energy has revealed a highly conserved region in HIV-1 genomes that associates with RNA structure. This corresponds to a packaging signal that is recognized by the nucleocapsid domain of the Gag polyprotein. Long viewed as a potential HIV-1 "Achilles heel," the signal can be targeted by a new antiviral compound. Although SARS-CoV-2 differs in many respects from HIV-1, the same technology displays regions with a high base order-dependent folding energy component, which are also highly conserved. This indicates structural invariance (SI) sustained by natural selection. While the regions are often also protein-encoding (e. g. NSP3, ORF3a), we suggest that their nucleic acid level functions can be considered potential "Achilles heels" for SARS-CoV-2, perhaps susceptible to therapies like those envisaged for AIDS. The ribosomal frameshifting element scored well, but higher SI scores were obtained in other regions, including those encoding NSP13 and the nucleocapsid (N) protein.
Collapse
Affiliation(s)
- Chiyu Zhang
- Shanghai Public Health Clinical Center, Fudan University, Shanghai, China
| | - Donald R Forsdyke
- Department of Biomedical and Molecular Sciences, Queen's University, Kingston, Ontario K7L3N6, Canada.
| |
Collapse
|
|
17
|
Khaitov M, Nikonova A, Shilovskiy I, Kozhikhova K, Kofiadi I, Vishnyakova L, Nikolskii A, Gattinger P, Kovchina V, Barvinskaia E, Yumashev K, Smirnov V, Maerle A, Kozlov I, Shatilov A, Timofeeva A, Andreev S, Koloskova O, Kuznetsova N, Vasina D, Nikiforova M, Rybalkin S, Sergeev I, Trofimov D, Martynov A, Berzin I, Gushchin V, Kovalchuk A, Borisevich S, Valenta R, Khaitov R, Skvortsova V. Silencing of SARS-CoV-2 with modified siRNA-peptide dendrimer formulation. Allergy 2021; 76:2840-2854. [PMID: 33837568 PMCID: PMC8251148 DOI: 10.1111/all.14850] [Citation(s) in RCA: 64] [Impact Index Per Article: 16.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/16/2021] [Revised: 03/09/2021] [Accepted: 03/15/2021] [Indexed: 12/12/2022]
Abstract
Background First vaccines for prevention of Coronavirus disease 2019 (COVID‐19) are becoming available but there is a huge and unmet need for specific forms of treatment. In this study we aimed to evaluate the anti‐SARS‐CoV‐2 effect of siRNA both in vitro and in vivo. Methods To identify the most effective molecule out of a panel of 15 in silico designed siRNAs, an in vitro screening system based on vectors expressing SARS‐CoV‐2 genes fused with the firefly luciferase reporter gene and SARS‐CoV‐2‐infected cells was used. The most potent siRNA, siR‐7, was modified by Locked nucleic acids (LNAs) to obtain siR‐7‐EM with increased stability and was formulated with the peptide dendrimer KK‐46 for enhancing cellular uptake to allow topical application by inhalation of the final formulation – siR‐7‐EM/KK‐46. Using the Syrian Hamster model for SARS‐CoV‐2 infection the antiviral capacity of siR‐7‐EM/KK‐46 complex was evaluated. Results We identified the siRNA, siR‐7, targeting SARS‐CoV‐2 RNA‐dependent RNA polymerase (RdRp) as the most efficient siRNA inhibiting viral replication in vitro. Moreover, we showed that LNA‐modification and complexation with the designed peptide dendrimer enhanced the antiviral capacity of siR‐7 in vitro. We demonstrated significant reduction of virus titer and lung inflammation in animals exposed to inhalation of siR‐7‐EM/KK‐46 in vivo. Conclusions Thus, we developed a therapeutic strategy for COVID‐19 based on inhalation of a modified siRNA‐peptide dendrimer formulation. The developed medication is intended for inhalation treatment of COVID‐19 patients.
Collapse
Affiliation(s)
| | - Alexandra Nikonova
- NRC Institute of Immunology FMBA Moscow Russia
- Mechnikov Research Institute for Vaccines and Sera Moscow Russia
| | | | | | | | | | | | | | | | | | | | | | | | - Ivan Kozlov
- NRC Institute of Immunology FMBA Moscow Russia
| | | | | | | | | | - Nadezhda Kuznetsova
- Federal State Budget Institution “National Research Centre for Epidemiology and Microbiology named after Honorary Academician N. F.Gamaleya” of the Ministry of Health of the Russian Federation Moscow Russia
| | - Daria Vasina
- Federal State Budget Institution “National Research Centre for Epidemiology and Microbiology named after Honorary Academician N. F.Gamaleya” of the Ministry of Health of the Russian Federation Moscow Russia
| | - Maria Nikiforova
- Federal State Budget Institution “National Research Centre for Epidemiology and Microbiology named after Honorary Academician N. F.Gamaleya” of the Ministry of Health of the Russian Federation Moscow Russia
| | | | | | | | | | - Igor Berzin
- Federal Medico‐biological Agency of Russia (FMBA Russia) Moscow Russia
| | - Vladimir Gushchin
- Federal State Budget Institution “National Research Centre for Epidemiology and Microbiology named after Honorary Academician N. F.Gamaleya” of the Ministry of Health of the Russian Federation Moscow Russia
| | - Aleksey Kovalchuk
- 48 Central Research Institute of the Ministry of Defense of the Russian Federation Moscow Russia
| | - Sergei Borisevich
- 48 Central Research Institute of the Ministry of Defense of the Russian Federation Moscow Russia
| | - Rudolf Valenta
- NRC Institute of Immunology FMBA Moscow Russia
- Medical University of Vienna Vienna Austria
| | | | | |
Collapse
|
|
18
|
Zong Y, Li X. Identification of Causal Genes of COVID-19 Using the SMR Method. Front Genet 2021; 12:690349. [PMID: 34290742 PMCID: PMC8287881 DOI: 10.3389/fgene.2021.690349] [Citation(s) in RCA: 3] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/02/2021] [Accepted: 05/07/2021] [Indexed: 01/03/2023] Open
Abstract
Since the first report of COVID-19 in December 2019, more than 100 million people have been infected with SARS-CoV-2. Despite ongoing research, there is still limited knowledge about the genetic causes of COVID-19. To resolve this problem, we applied the SMR method to analyze the genes involved in COVID-19 pathogenesis by the integration of multiple omics data. Here, we assessed the SNPs associated with COVID-19 risk from the GWAS data of Spanish and Italian patients and lung eQTL data from the GTEx project. Then, GWAS and eQTL data were integrated by summary-data-based (SMR) methods using SNPs as instrumental variables (IVs). As a result, six protein-coding and five non-protein-coding genes regulated by nine SNPs were identified as significant risk factors for COVID-19. Functional analysis of these genes showed that UQCRH participates in cardiac muscle contraction, PPA2 is closely related to sudden cardiac failure (SCD), and OGT, as the interacting gene partner of PANO1, is associated with neurological disease. Observational studies show that myocardial damage, SCD, and neurological disease often occur in COVID-19 patients. Thus, our findings provide a potential molecular mechanism for understanding the complications of COVID-19.
Collapse
Affiliation(s)
- Yan Zong
- Department of Infectious Diseases, Yiwu Central Hospital, Jinhua, China
| | - Xiaofei Li
- Department of Infectious Diseases, Yiwu Central Hospital, Jinhua, China
| |
Collapse
|
|
19
|
Sajid M, Moazzam M, Cho Y, Kato S, Xu A, Way JJ, Lohan S, Tiwari RK. siRNA Therapeutics for the Therapy of COVID-19 and Other Coronaviruses. Mol Pharm 2021; 18:2105-2121. [PMID: 33945284 PMCID: PMC9896947 DOI: 10.1021/acs.molpharmaceut.0c01239] [Citation(s) in RCA: 27] [Impact Index Per Article: 6.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 02/08/2023]
Abstract
The ongoing pandemic of global concern has killed about three million humans and affected around 151 million people worldwide, as of April 30, 2021. Although recently approved vaccines for COVID-19 are engendering hope, finding new ways to cure the viral pandemic is still a quest for researchers worldwide. Major pandemics in history have been of viral origin, such as SARS, MERS, H1NI, Spanish flu, and so on. A larger emphasis has been on discovering potential vaccines, novel antiviral drugs, and agents that can mitigate the viral infection symptoms; however, a relatively new area, RNA interference (RNAi), has proven effective as an antiviral agent. The RNAi phenomenon has been largely exploited to cure cancer, neurodegenerative diseases, and some rare diseases. The U.S. Food and Drug Administration has recently approved three siRNA products for human use that garner significant hope in siRNA therapeutics for coronaviruses. There have been some commentaries and communications addressing this area. We have summarized and illustrated the significance and the potential of the siRNA therapeutics available as of April 30, 2021 to combat the ongoing viral pandemic and the emerging new variants such as B.1.1.7 and B.1.351. Numerous successful in vitro studies and several investigations to address the clinical application of siRNA therapeutics provide great hope in this field. This seminal Review describes the significance of siRNA-based therapy to treat diverse viral infections in addition to the current coronavirus challenge. In addition, we have thoroughly reviewed the patents approved for coronaviruses, the major challenges in siRNA therapy, and the potential approaches to address them, followed by innovation and prospects.
Collapse
Affiliation(s)
- Muhammad
Imran Sajid
- Center
for Targeted Drug Delivery, Department of Biomedical and Pharmaceutical
Sciences, Chapman University School of Pharmacy, Harry and Diane Rinker Health Science Campus, Irvine, California 92618, United States
- Faculty
of Pharmacy, University of Central Punjab, Lahore 54700, Pakistan
| | - Muhammad Moazzam
- Faculty
of Pharmacy, University of Central Punjab, Lahore 54700, Pakistan
| | - Yeseom Cho
- Center
for Targeted Drug Delivery, Department of Biomedical and Pharmaceutical
Sciences, Chapman University School of Pharmacy, Harry and Diane Rinker Health Science Campus, Irvine, California 92618, United States
- Department
of Biochemistry and Molecular Biology, Schmid College of Science and
Technology, Chapman University, Orange, California 92866, United States
| | - Shun Kato
- Center
for Targeted Drug Delivery, Department of Biomedical and Pharmaceutical
Sciences, Chapman University School of Pharmacy, Harry and Diane Rinker Health Science Campus, Irvine, California 92618, United States
- Department
of Biochemistry and Molecular Biology, Schmid College of Science and
Technology, Chapman University, Orange, California 92866, United States
| | - Ava Xu
- Center
for Targeted Drug Delivery, Department of Biomedical and Pharmaceutical
Sciences, Chapman University School of Pharmacy, Harry and Diane Rinker Health Science Campus, Irvine, California 92618, United States
| | - J. J. Way
- Center
for Targeted Drug Delivery, Department of Biomedical and Pharmaceutical
Sciences, Chapman University School of Pharmacy, Harry and Diane Rinker Health Science Campus, Irvine, California 92618, United States
| | - Sandeep Lohan
- Center
for Targeted Drug Delivery, Department of Biomedical and Pharmaceutical
Sciences, Chapman University School of Pharmacy, Harry and Diane Rinker Health Science Campus, Irvine, California 92618, United States
| | - Rakesh K. Tiwari
- Center
for Targeted Drug Delivery, Department of Biomedical and Pharmaceutical
Sciences, Chapman University School of Pharmacy, Harry and Diane Rinker Health Science Campus, Irvine, California 92618, United States
| |
Collapse
|
|
20
|
Berber B, Aydin C, Kocabas F, Guney-Esken G, Yilancioglu K, Karadag-Alpaslan M, Caliseki M, Yuce M, Demir S, Tastan C. Gene editing and RNAi approaches for COVID-19 diagnostics and therapeutics. Gene Ther 2021; 28:290-305. [PMID: 33318646 PMCID: PMC7734466 DOI: 10.1038/s41434-020-00209-7] [Citation(s) in RCA: 29] [Impact Index Per Article: 7.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/03/2020] [Revised: 10/20/2020] [Accepted: 10/27/2020] [Indexed: 01/29/2023]
Abstract
The novel coronavirus pneumonia (COVID-19) is a highly infectious acute respiratory disease caused by Severe Acute Respiratory Syndrome-Related Coronavirus (SARS-CoV-2) (Prec Clin Med 2020;3:9-13, Lancet 2020;395:497-506, N. Engl J Med 2020a;382:1199-207, Nature 2020;579:270-3). SARS-CoV-2 surveillance is essential to controlling widespread transmission. However, there are several challenges associated with the diagnostic of the COVID-19 during the current outbreak (Liu and Li (2019), Nature 2020;579:265-9, N. Engl J Med 2020;382:727-33). Firstly, the high number of cases overwhelms diagnostic test capacity and proposes the need for a rapid solution for sample processing (Science 2018;360:444-8). Secondly, SARS-CoV-2 is closely related to other important coronavirus species and subspecies, so detection assays can give false-positive results if they are not efficiently specific to SARS-CoV-2. Thirdly, patients with suspected SARS-CoV-2 infection sometimes have a different respiratory viral infection or co-infections with SARS-CoV-2 and other respiratory viruses (MedRxiv 2020a;1-18). Confirmation of the COVID-19 is performed mainly by virus isolation followed by RT-PCR and sequencing (N. Engl J Med 2020;382:727-33, MedRxiv 2020a, Turkish J Biol 2020;44:192-202). The emergence and outbreak of the novel coronavirus highlighted the urgent need for new therapeutic technologies that are fast, precise, stable, easy to manufacture, and target-specific for surveillance and treatment. Molecular biology tools that include gene-editing approaches such as CRISPR-Cas12/13-based SHERLOCK, DETECTR, CARVER and PAC-MAN, antisense oligonucleotides, antisense peptide nucleic acids, ribozymes, aptamers, and RNAi silencing approaches produced with cutting-edge scientific advances compared to conventional diagnostic or treatment methods could be vital in COVID-19 and other future outbreaks. Thus, in this review, we will discuss potent the molecular biology approaches that can revolutionize diagnostic of viral infections and therapies to fight COVID-19 in a highly specific, stable, and efficient way.
Collapse
Affiliation(s)
- Burak Berber
- Department of Biology, Faculty of Science, Eskisehir Technical University, Eskisehir, Turkey
| | - Cihan Aydin
- Department of Molecular Biology and Genetics, Faculty of Engineering and Natural Sciences, Istanbul Medeniyet University, Istanbul, Turkey
| | - Fatih Kocabas
- Department of Genetics and Bioengineering, Faculty of Engineering, Yeditepe University, Istanbul, Turkey
| | - Gulen Guney-Esken
- Department of Genetics and Bioengineering, Faculty of Engineering, Yeditepe University, Istanbul, Turkey
| | - Kaan Yilancioglu
- Institute of Addiction and Forensic Sciences, Uskudar University, Istanbul, Turkey
- Transgenic Cell Technologies and Epigenetics Application and Research Center (TRGENMER), Uskudar University, Istanbul, Turkey
| | - Medine Karadag-Alpaslan
- Department of Medical Genetics, Faculty of Medicine, Ondokuz Mayis University, Samsun, Turkey
| | - Mehmet Caliseki
- Department of Molecular Biology, Genetics and Bioengineering, Graduate School of Engineering and Natural Sciences, Sabanci University, Istanbul, Turkey
| | - Melek Yuce
- Center for Stem Cell Research, Ondokuz Mayis University, Samsun, Turkey
| | - Sevda Demir
- Department of Genetics and Bioengineering, Faculty of Engineering, Yeditepe University, Istanbul, Turkey
| | - Cihan Tastan
- Transgenic Cell Technologies and Epigenetics Application and Research Center (TRGENMER), Uskudar University, Istanbul, Turkey.
- Acibadem Labcell Cellular Therapy Laboratory, Istanbul, Turkey.
- Faculty of Science and Letters, Department of Molecular Biology and Genetics, Istanbul Kultur University, Istanbul, Turkey.
| |
Collapse
|
|
21
|
A small interfering RNA (siRNA) database for SARS-CoV-2. Sci Rep 2021; 11:8849. [PMID: 33893357 PMCID: PMC8065152 DOI: 10.1038/s41598-021-88310-8] [Citation(s) in RCA: 15] [Impact Index Per Article: 3.8] [Reference Citation Analysis] [Abstract] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/13/2020] [Accepted: 04/09/2021] [Indexed: 12/13/2022] Open
Abstract
Coronavirus disease 2019 (COVID-19) rapidly transformed into a global pandemic, for which a demand for developing antivirals capable of targeting the SARS-CoV-2 RNA genome and blocking the activity of its genes has emerged. In this work, we presented a database of SARS-CoV-2 targets for small interference RNA (siRNA) based approaches, aiming to speed the design process by providing a broad set of possible targets and siRNA sequences. The siRNAs sequences are characterized and evaluated by more than 170 features, including thermodynamic information, base context, target genes and alignment information of sequences against the human genome, and diverse SARS-CoV-2 strains, to assess possible bindings to off-target sequences. This dataset is available as a set of four tables, available in a spreadsheet and CSV (Comma-Separated Values) formats, each one corresponding to sequences of 18, 19, 20, and 21 nucleotides length, aiming to meet the diversity of technology and expertise among laboratories around the world. A metadata table (Supplementary Table S1), which describes each feature, is also provided in the aforementioned formats. We hope that this database helps to speed up the development of new target antivirals for SARS-CoV-2, contributing to a possible strategy for a faster and effective response to the COVID-19 pandemic.
Collapse
|
|
22
|
Jamalkhah M, Asaadi Y, Azangou-Khyavy M, Khanali J, Soleimani M, Kiani J, Arefian E. MSC-derived exosomes carrying a cocktail of exogenous interfering RNAs an unprecedented therapy in era of COVID-19 outbreak. J Transl Med 2021; 19:164. [PMID: 33888147 PMCID: PMC8061879 DOI: 10.1186/s12967-021-02840-3] [Citation(s) in RCA: 21] [Impact Index Per Article: 5.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/11/2021] [Accepted: 04/16/2021] [Indexed: 01/08/2023] Open
Abstract
BACKGROUND The onset of the SARS-CoV-2 pandemic has resulted in ever-increasing casualties worldwide, and after 15 months, standard therapeutic regimens are yet to be discovered. MAIN BODY Due to the regenerative and immunomodulatory function of MSCs, they can serve as a suitable therapeutic option in alleviating major COVID-19 complications like acute respiratory distress syndrome. However, the superior properties of their cognate exosomes as a cell-free product make them preferable in the clinic. Herein, we discuss the current clinical status of these novel therapeutic strategies in COVID-19 treatment. We then delve into the potential of interfering RNAs incorporation as COVID-19 gene therapy and introduce targets involved in SARS-CoV-2 pathogenesis. Further, we present miRNAs and siRNAs candidates with promising results in targeting the mentioned targets. CONCLUSION Finally, we present a therapeutic platform of mesenchymal stem cell-derived exosomes equipped with exogenous iRNAs, that can be employed as a novel therapeutic modality in COVID-19 management aiming to prevent further viral spread within the lung, hinder the virus life cycle and pathogenesis such as immune suppression, and ultimately, enhance the antiviral immune response.
Collapse
Affiliation(s)
- Monire Jamalkhah
- Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran
| | - Yasaman Asaadi
- Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran
| | | | - Javad Khanali
- School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
| | - Masoud Soleimani
- Department of Tissue Engineering and Applied Cell Sciences, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
| | - Jafar Kiani
- Department of Molecular Medicine, School of Advanced Technologies in Medicine, Iran University of Medical Sciences, Tehran, Iran.
| | - Ehsan Arefian
- Department of Microbiology, School of Biology, College of Science, University of Tehran, Tehran, Iran.
| |
Collapse
|
|
23
|
Panda K, Alagarasu K, Cherian SS, Parashar D. Prediction of potential small interfering RNA molecules for silencing of the spike gene of SARS-CoV-2. Indian J Med Res 2021; 153:182-189. [PMID: 33818475 PMCID: PMC8184069 DOI: 10.4103/ijmr.ijmr_2855_20] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/24/2023] Open
Affiliation(s)
- Kingshuk Panda
- Chikungunya-Dengue Group, ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India
| | - Kalichamy Alagarasu
- Chikungunya-Dengue Group, ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India
| | - Sarah S Cherian
- Bioinformatics Group, ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India
| | - Deepti Parashar
- Chikungunya-Dengue Group, ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India
| |
Collapse
|
|
24
|
Dönmüş B, Ünal S, Kirmizitaş FC, Türkoğlu Laçin N. Virus-associated ribozymes and nano carriers against COVID-19. ARTIFICIAL CELLS NANOMEDICINE AND BIOTECHNOLOGY 2021; 49:204-218. [PMID: 33645342 DOI: 10.1080/21691401.2021.1890103] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 12/24/2022]
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a zoo tonic, highly pathogenic virus. The new type of coronavirus with contagious nature spread from Wuhan (China) to the whole world in a very short time and caused the new coronavirus disease (COVID-19). COVID-19 has turned into a global public health crisis due to spreading by close person-to-person contact with high transmission capacity. Thus, research about the treatment of the damages caused by the virus or prevention from infection increases everyday. Besides, there is still no approved and definitive, standardized treatment for COVID-19. However, this disaster experienced by human beings has made us realize the significance of having a system ready for use to prevent humanity from viral attacks without wasting time. As is known, nanocarriers can be targeted to the desired cells in vitro and in vivo. The nano-carrier system targeting a specific protein, containing the enzyme inhibiting the action of the virus can be developed. The system can be used by simple modifications when we encounter another virus epidemic in the future. In this review, we present a potential treatment method consisting of a nanoparticle-ribozyme conjugate, targeting ACE-2 receptors by reviewing the virus-associated ribozymes, their structures, types and working mechanisms.
Collapse
Affiliation(s)
- Beyza Dönmüş
- Molecular Biology and Genetics Department, Yıldız Technical University, Istanbul, Turkey
| | - Sinan Ünal
- Molecular Biology and Genetics Department, Yıldız Technical University, Istanbul, Turkey
| | - Fatma Ceren Kirmizitaş
- Molecular Biology and Genetics Department, Yıldız Technical University, Istanbul, Turkey
| | - Nelisa Türkoğlu Laçin
- Molecular Biology and Genetics Department, Yıldız Technical University, Istanbul, Turkey
| |
Collapse
|
|
25
|
Pandey AK, Verma S. An in silico analysis of effective siRNAs against COVID-19 by targeting the leader sequence of SARS-CoV-2. ACTA ACUST UNITED AC 2021; 4:e107. [PMID: 33786418 PMCID: PMC7995175 DOI: 10.1002/acg2.107] [Citation(s) in RCA: 9] [Impact Index Per Article: 2.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/27/2020] [Revised: 01/31/2021] [Accepted: 02/09/2021] [Indexed: 12/15/2022]
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5' end, which is added to all subgenomic mRNAs at their 5' terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in-silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed-duplex stability, exact complementarity with target, at least three mismatches with any off-target and least number of off-targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5'GUUUAGAGAACAGAUCUACAA3' met almost all specificity criteria with no off-targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of -327.45 for above-mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off-target sequences gave significantly low binding scores. Hence, 5'GUUUAGAGAACAGAUCUACAA3' siRNA possess great potential to silence the leader sequence of SARS-CoV-2 with least off-target effect. Present study provides great scope for development of gene therapy against the prevailing COVID-19 disease, thus further research in this concern is urgently demanded.
Collapse
Affiliation(s)
- Anand Kumar Pandey
- Department of Biotechnology Engineering Institute of Engineering and Technology Bundelkhand University Jhansi India
| | - Shalja Verma
- Department of Biotechnology Engineering Institute of Engineering and Technology Bundelkhand University Jhansi India.,Department of Biochemical Engineering and Biotechnology Indian Institute of Technology New Delhi India.,NIMR-ICMR New Delhi India
| |
Collapse
|
|
26
|
Chowdhury UF, Sharif Shohan MU, Hoque KI, Beg MA, Sharif Siam MK, Moni MA. A computational approach to design potential siRNA molecules as a prospective tool for silencing nucleocapsid phosphoprotein and surface glycoprotein gene of SARS-CoV-2. Genomics 2021; 113:331-343. [PMID: 33321203 PMCID: PMC7832576 DOI: 10.1016/j.ygeno.2020.12.021] [Citation(s) in RCA: 39] [Impact Index Per Article: 9.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/18/2020] [Revised: 11/18/2020] [Accepted: 12/10/2020] [Indexed: 11/25/2022]
Abstract
An outbreak, caused by an RNA virus, SARS-CoV-2 named COVID-19 has become pandemic with a magnitude which is daunting to all public health institutions in the absence of specific antiviral treatment. Surface glycoprotein and nucleocapsid phosphoprotein are two important proteins of this virus facilitating its entry into host cell and genome replication. Small interfering RNA (siRNA) is a prospective tool of the RNA interference (RNAi) pathway for the control of human viral infections by suppressing viral gene expression through hybridization and neutralization of target complementary mRNA. So, in this study, the power of RNA interference technology was harnessed to develop siRNA molecules against specific target genes namely, nucleocapsid phosphoprotein gene and surface glycoprotein gene. Conserved sequence from 139 SARS-CoV-2 strains from around the globe was collected to construct 78 siRNA that can inactivate nucleocapsid phosphoprotein and surface glycoprotein genes. Finally, based on GC content, free energy of folding, free energy of binding, melting temperature, efficacy prediction and molecular docking analysis, 8 siRNA molecules were selected which are proposed to exert the best action. These predicted siRNAs should effectively silence the genes of SARS-CoV-2 during siRNA mediated treatment assisting in the response against SARS-CoV-2.
Collapse
MESH Headings
- Argonaute Proteins/chemistry
- Argonaute Proteins/genetics
- Base Composition
- COVID-19/therapy
- COVID-19/virology
- Computational Chemistry
- Coronavirus Nucleocapsid Proteins/genetics
- Drug Design
- Evolution, Molecular
- Gene Expression Regulation, Viral/drug effects
- Genetic Therapy/methods
- Humans
- Molecular Docking Simulation
- Pandemics
- Phosphoproteins/genetics
- Phylogeny
- RNA Folding
- RNA Interference
- RNA, Messenger/antagonists & inhibitors
- RNA, Messenger/genetics
- RNA, Small Interfering/chemistry
- RNA, Small Interfering/pharmacology
- RNA, Small Interfering/therapeutic use
- RNA, Viral/antagonists & inhibitors
- RNA, Viral/genetics
- SARS-CoV-2/drug effects
- SARS-CoV-2/genetics
- Sequence Alignment
- Spike Glycoprotein, Coronavirus/genetics
- Thermodynamics
- COVID-19 Drug Treatment
Collapse
Affiliation(s)
- Umar Faruq Chowdhury
- Department of Biochemistry and Molecular Biology, University of Dhaka, Bangladesh
| | | | - Kazi Injamamul Hoque
- Department of Biochemistry and Molecular Biology, University of Dhaka, Bangladesh
| | - Mirza Ashikul Beg
- Department of Genetic Engineering and Biotechnology, University of Dhaka, Bangladesh
| | | | - Mohammad Ali Moni
- WHO Collaborating Centre for eHealth, School of Public Health and Community Medicine, Faculty of Medicine, University of New South Wales (UNSW), Sydney, Australia.
| |
Collapse
|
|
27
|
Carro B. SARS-CoV-2 mechanisms of action and impact on human organism, risk factors and potential treatments. An exhaustive survey. ALL LIFE 2021. [DOI: 10.1080/26895293.2021.1977186] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/15/2022] Open
Affiliation(s)
- Belén Carro
- Department of Signal Theory and Communications, Universidad de Valladolid, Valladolid, Spain
| |
Collapse
|
|
28
|
Henzinger H, Barth DA, Klec C, Pichler M. Non-Coding RNAs and SARS-Related Coronaviruses. Viruses 2020; 12:E1374. [PMID: 33271762 PMCID: PMC7761185 DOI: 10.3390/v12121374] [Citation(s) in RCA: 27] [Impact Index Per Article: 5.4] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/27/2020] [Revised: 11/25/2020] [Accepted: 11/28/2020] [Indexed: 02/07/2023] Open
Abstract
The emergence of SARS-CoV-2 in 2019 has caused a major health and economic crisis around the globe. Gaining knowledge about its attributes and interactions with human host cells is crucial. Non-coding RNAs (ncRNAs) are involved in the host cells' innate antiviral immune response. In RNA interference, microRNAs (miRNAs) may bind to complementary sequences of the viral RNA strand, forming an miRNA-induced silencing complex, which destroys the viral RNA, thereby inhibiting viral protein expression. There are several targets for human miRNAs on SARS-CoV-2's RNA, most of which are in the 5' and 3' untranslated regions. Mutations of the viral genome causing the creation or loss of miRNA binding sites may have crucial effects on SARS-CoV-2 pathogenicity. In addition to mediating immunity, the ncRNA landscape of host cells further influences their susceptibility to virus infection, as certain miRNAs are essential in the regulation of cellular receptors that are necessary for virus invasion. Conversely, virus infection also changes the host ncRNA expression patterns, possibly augmenting conditions for viral replication and dissemination. Hence, ncRNAs typically upregulated in SARS-CoV-2 infection could be useful biomarkers for disease progression and severity. Understanding these mechanisms could provide further insight into the pathogenesis and possible treatment options against COVID-19.
Collapse
Affiliation(s)
- Hanna Henzinger
- Comprehensive Cancer Center Graz, Research Unit of Non-Coding RNAs and Genome Editing, Department of Internal Medicine, Division of Clinical Oncology, Medical University of Graz, 8036 Graz, Austria; (H.H.); (D.A.B.); (C.K.)
| | - Dominik A. Barth
- Comprehensive Cancer Center Graz, Research Unit of Non-Coding RNAs and Genome Editing, Department of Internal Medicine, Division of Clinical Oncology, Medical University of Graz, 8036 Graz, Austria; (H.H.); (D.A.B.); (C.K.)
| | - Christiane Klec
- Comprehensive Cancer Center Graz, Research Unit of Non-Coding RNAs and Genome Editing, Department of Internal Medicine, Division of Clinical Oncology, Medical University of Graz, 8036 Graz, Austria; (H.H.); (D.A.B.); (C.K.)
| | - Martin Pichler
- Comprehensive Cancer Center Graz, Research Unit of Non-Coding RNAs and Genome Editing, Department of Internal Medicine, Division of Clinical Oncology, Medical University of Graz, 8036 Graz, Austria; (H.H.); (D.A.B.); (C.K.)
- Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA
| |
Collapse
|
|
29
|
Are Viral Vectors Any Good for RNAi Antiviral Therapy? Viruses 2020; 12:v12101189. [PMID: 33092124 PMCID: PMC7589807 DOI: 10.3390/v12101189] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/15/2020] [Accepted: 10/19/2020] [Indexed: 01/20/2023] Open
Abstract
RNA interference (RNAi) represents a novel approach for alternative antiviral therapy. However, issues related to RNA delivery and stability have presented serious obstacles for obtaining good therapeutic efficacy. Viral vectors are capable of efficient delivery of RNAi as short interfering RNA (siRNA), short hairpin RNA (shRNA) and micro-RNA (miRNA). Efficacy in gene silencing for therapeutic applications against viral diseases has been demonstrated in various animal models. Rotavirus (RV) miR-7 can inhibit rotavirus replication by targeting the RV nonstructural protein 5. Viral gene silencing by targeting the RNAi pathway showed efficient suppression of hepatitis B virus replication by adeno-associated virus (AAV)-based delivery of RNAi hepatitis B virus (HBV) cassettes. Hepatitis C virus replication has been targeted by short hairpin RNA molecules expressed from lentivirus vectors. Potentially, RNAi-based approaches could be suitable for antiviral drugs against COVID-19.
Collapse
|
|
30
|
Alouane T, Laamarti M, Essabbar A, Hakmi M, Bouricha EM, Chemao-Elfihri MW, Kartti S, Boumajdi N, Bendani H, Laamarti R, Ghrifi F, Allam L, Aanniz T, Ouadghiri M, El Hafidi N, El Jaoudi R, Benrahma H, Attar JE, Mentag R, Sbabou L, Nejjari C, Amzazi S, Belyamani L, Ibrahimi A. Genomic Diversity and Hotspot Mutations in 30,983 SARS-CoV-2 Genomes: Moving Toward a Universal Vaccine for the "Confined Virus"? Pathogens 2020; 9:E829. [PMID: 33050463 PMCID: PMC7600297 DOI: 10.3390/pathogens9100829] [Citation(s) in RCA: 45] [Impact Index Per Article: 9.0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/30/2020] [Revised: 09/30/2020] [Accepted: 10/01/2020] [Indexed: 12/12/2022] Open
Abstract
The COVID-19 pandemic has been ongoing since its onset in late November 2019 in Wuhan, China. Understanding and monitoring the genetic evolution of the virus, its geographical characteristics, and its stability are particularly important for controlling the spread of the disease and especially for the development of a universal vaccine covering all circulating strains. From this perspective, we analyzed 30,983 complete SARS-CoV-2 genomes from 79 countries located in the six continents and collected from 24 December 2019, to 13 May 2020, according to the GISAID database. Our analysis revealed the presence of 3206 variant sites, with a uniform distribution of mutation types in different geographic areas. Remarkably, a low frequency of recurrent mutations has been observed; only 169 mutations (5.27%) had a prevalence greater than 1% of genomes. Nevertheless, fourteen non-synonymous hotspot mutations (>10%) have been identified at different locations along the viral genome; eight in ORF1ab polyprotein (in nsp2, nsp3, transmembrane domain, RdRp, helicase, exonuclease, and endoribonuclease), three in nucleocapsid protein, and one in each of three proteins: Spike, ORF3a, and ORF8. Moreover, 36 non-synonymous mutations were identified in the receptor-binding domain (RBD) of the spike protein with a low prevalence (<1%) across all genomes, of which only four could potentially enhance the binding of the SARS-CoV-2 spike protein to the human ACE2 receptor. These results along with intra-genomic divergence of SARS-CoV-2 could indicate that unlike the influenza virus or HIV viruses, SARS-CoV-2 has a low mutation rate which makes the development of an effective global vaccine very likely.
Collapse
Affiliation(s)
- Tarek Alouane
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Meriem Laamarti
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Abdelomunim Essabbar
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Mohammed Hakmi
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - El Mehdi Bouricha
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - M. W. Chemao-Elfihri
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Souad Kartti
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Nasma Boumajdi
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Houda Bendani
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Rokia Laamarti
- Medical Biotechnology Center, Moroccan Foundation for Science, Innovation & Research (MAScIR), Rabat 10100, Morocco;
| | - Fatima Ghrifi
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Loubna Allam
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Tarik Aanniz
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Mouna Ouadghiri
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Naima El Hafidi
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Rachid El Jaoudi
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| | - Houda Benrahma
- Faculty of Medicine, Mohammed VI University of Health Sciences (UM6SS), Casablanca 82403, Morocco;
| | - Jalil El Attar
- Riad Laboratory, City Center Hay Riad, Rabat 10112, Morocco;
| | - Rachid Mentag
- Biotechnology Unit, Regional Center of Agricultural Research of Rabat, National Institute of Agricultural Research, Rabat 10101, Morocco;
| | - Laila Sbabou
- Microbiology and Molecular Biology Team, Center of Plant and Microbial Biotechnology, Biodiversity and Environment, Faculty of Sciences, Mohammed V University, Rabat 10000, Morocco;
| | - Chakib Nejjari
- International School of Public Health, Mohammed VI University of Health Sciences (UM6SS), Casablanca 82403, Morocco;
| | - Saaid Amzazi
- Laboratory of Human Pathologies Biology, Faculty of Sciences, Mohammed V University, Rabat 10000, Morocco;
| | - Lahcen Belyamani
- Emergency Department, Military Hospital Mohammed V, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10112, Morocco;
| | - Azeddine Ibrahimi
- Medical Biotechnology Laboratory (MedBiotech), Bioinova Research Center, Rabat Medical and Pharmacy School, Mohammed Vth University, Rabat 10100, Morocco; (M.L.); (A.E.); (M.H.); (E.M.B.); (M.W.C.-E.); (S.K.); (N.B.); (H.B.); (F.G.); (L.A.); (T.A.); (M.O.); (N.E.H.); (R.E.J.)
| |
Collapse
|
|
31
|
Lundstrom K. Coronavirus pandemic: treatment and future prevention. Future Microbiol 2020; 15:1507-1521. [PMID: 33140657 PMCID: PMC7675013 DOI: 10.2217/fmb-2020-0174] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.2] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/10/2020] [Accepted: 10/05/2020] [Indexed: 02/06/2023] Open
Abstract
The rapid spread of SARS-CoV-2 leading to the COVID-19 pandemic with more than 400,000 deaths worldwide and the global economy shut down has substantially accelerated the research and development of novel and efficient COVID-19 antiviral drugs and vaccines. In the short term, antiviral and other drugs have been subjected to repurposing against COVID-19 demonstrating some success, but some excessively hasty conclusions drawn from significantly suboptimal clinical evaluations have provided false hope. On the other hand, more than 300 potential therapies and at least 150 vaccine studies are in progress at various stages of preclinical or clinical research. The aim here is to provide a timely update of the development, which, due to the intense activities, moves forward with unprecedented speed.
Collapse
|
|
32
|
Konwarh R. Can CRISPR/Cas Technology Be a Felicitous Stratagem Against the COVID-19 Fiasco? Prospects and Hitches. Front Mol Biosci 2020; 7:557377. [PMID: 33134311 PMCID: PMC7511716 DOI: 10.3389/fmolb.2020.557377] [Citation(s) in RCA: 10] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/30/2020] [Accepted: 08/19/2020] [Indexed: 12/24/2022] Open
Abstract
The current global debacle of COVID-19, spelled by SARS-CoV-2 needs no elaboration. With incessant and constantly clambering number of deaths across various nations, the need of the hour is to develop readily deployable, fast, affordable detection assays and kits, yielding precise and consistent results as well as timely availability of efficacious anti-SARS-CoV-2 strategies to contain it. Conventionally employed real time PCR based technique for detection of the virus suffers from a couple of handicaps. Amongst other approaches, CRISPR based technology has ushered in new hopes. Recent efforts have been directed toward developing CRISPR/Cas based low-cost, rapid detection methods as well as development of one-pot assay platforms. The plausible application of CRISPR-Cas system to counteract the viral assault has also been assessed. The write up in this article mirrors the current status, the prospects and the practical snags of CRISPR/Cas technology for the detection and inactivation of the novel corona virus, SARS-CoV-2.
Collapse
Affiliation(s)
- Rocktotpal Konwarh
- Department of Biotechnology, Addis Ababa Science and Technology University, Addis Ababa, Ethiopia
- Centre of Excellence-Nanotechnology, Addis Ababa Science and Technology University, Addis Ababa, Ethiopia
| |
Collapse
|
|
33
|
Lundstrom K. Viral Vectors Applied for RNAi-Based Antiviral Therapy. Viruses 2020; 12:v12090924. [PMID: 32842491 PMCID: PMC7552024 DOI: 10.3390/v12090924] [Citation(s) in RCA: 16] [Impact Index Per Article: 3.2] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/30/2020] [Revised: 08/19/2020] [Accepted: 08/21/2020] [Indexed: 12/12/2022] Open
Abstract
RNA interference (RNAi) provides the means for alternative antiviral therapy. Delivery of RNAi in the form of short interfering RNA (siRNA), short hairpin RNA (shRNA) and micro-RNA (miRNA) have demonstrated efficacy in gene silencing for therapeutic applications against viral diseases. Bioinformatics has played an important role in the design of efficient RNAi sequences targeting various pathogenic viruses. However, stability and delivery of RNAi molecules have presented serious obstacles for reaching therapeutic efficacy. For this reason, RNA modifications and formulation of nanoparticles have proven useful for non-viral delivery of RNAi molecules. On the other hand, utilization of viral vectors and particularly self-replicating RNA virus vectors can be considered as an attractive alternative. In this review, examples of antiviral therapy applying RNAi-based approaches in various animal models will be described. Due to the current coronavirus pandemic, a special emphasis will be dedicated to targeting Coronavirus Disease-19 (COVID-19).
Collapse
|
|
34
|
Zhang D, Lu J. In Silico Design of siRNAs Targeting Existing and Future Respiratory Viruses with VirusSi. BIORXIV : THE PREPRINT SERVER FOR BIOLOGY 2020:2020.08.13.250076. [PMID: 32817944 PMCID: PMC7430574 DOI: 10.1101/2020.08.13.250076] [Citation(s) in RCA: 6] [Impact Index Per Article: 1.2] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Indexed: 04/16/2023]
Abstract
The COVID-19 pandemic has exposed global inadequacies in therapeutic options against both the COVID-19-causing SARS-CoV-2 virus and other newly emerged respiratory viruses. In this study, we present the VirusSi computational pipeline, which facilitates the rational design of siRNAs to target existing and future respiratory viruses. Mode A of VirusSi designs siRNAs against an existing virus, incorporating considerations on siRNA properties, off-target effects, viral RNA structure and viral mutations. It designs multiple siRNAs out of which the top candidate targets >99% of SARS-CoV-2 strains, and the combination of the top four siRNAs is predicted to target all SARS-CoV-2 strains. Additionally, we develop Greedy Algorithm with Redundancy (GAR) and Similarity-weighted Greedy Algorithm with Redundancy (SGAR) to support the Mode B of VirusSi, which pre-designs siRNAs against future emerging viruses based on existing viral sequences. Time-simulations using known coronavirus genomes as early as 10 years prior to the COVID-19 outbreak show that at least three SARS-CoV-2-targeting siRNAs are among the top 30 pre-designed siRNAs. Before-the-outbreak pre-design is also possible against the MERS-CoV virus and the 2009-H1N1 swine flu virus. Our data support the feasibility of pre-designing anti-viral siRNA therapeutics prior to viral outbreaks. We propose the development of a collection of pre-designed, safety-tested, and off-the-shelf siRNAs that could accelerate responses toward future viral diseases.
Collapse
Affiliation(s)
- Dingyao Zhang
- Yale Stem Cell Center, New Haven, CT 06520, USA
- Department of Genetics, Yale University School of Medicine, New Haven, CT 06510, USA
| | - Jun Lu
- Yale Stem Cell Center, New Haven, CT 06520, USA
- Department of Genetics, Yale University School of Medicine, New Haven, CT 06510, USA
- Yale Center for RNA Science and Medicine, Yale Cancer Center, New Haven, CT 06520, USA
- Yale Cooperative Center of Excellence in Hematology, New Haven, CT 06520, USA
| |
Collapse
|
|
35
|
Uludağ H, Parent K, Aliabadi HM, Haddadi A. Prospects for RNAi Therapy of COVID-19. Front Bioeng Biotechnol 2020; 8:916. [PMID: 32850752 PMCID: PMC7409875 DOI: 10.3389/fbioe.2020.00916] [Citation(s) in RCA: 58] [Impact Index Per Article: 11.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/05/2020] [Accepted: 07/15/2020] [Indexed: 12/12/2022] Open
Abstract
COVID-19 caused by the SARS-CoV-2 virus is a fast emerging disease with deadly consequences. The pulmonary system and lungs in particular are most prone to damage caused by the SARS-CoV-2 infection, which leaves a destructive footprint in the lung tissue, making it incapable of conducting its respiratory functions and resulting in severe acute respiratory disease and loss of life. There were no drug treatments or vaccines approved for SARS-CoV-2 at the onset of pandemic, necessitating an urgent need to develop effective therapeutics. To this end, the innate RNA interference (RNAi) mechanism can be employed to develop front line therapies against the virus. This approach allows specific binding and silencing of therapeutic targets by using short interfering RNA (siRNA) and short hairpin RNA (shRNA) molecules. In this review, we lay out the prospect of the RNAi technology for combatting the COVID-19. We first summarize current understanding of SARS-CoV-2 virology and the host response to viral entry and duplication, with the purpose of revealing effective RNAi targets. We then summarize the past experience with nucleic acid silencers for SARS-CoV, the predecessor for current SARS-CoV-2. Efforts targeting specific protein-coding regions within the viral genome and intragenomic targets are summarized. Emphasizing non-viral delivery approaches, molecular underpinnings of design of RNAi agents are summarized with comparative analysis of various systems used in the past. Promising viral targets as well as host factors are summarized, and the possibility of modulating the immune system are presented for more effective therapies. We place special emphasis on the limitations of past studies to propel the field faster by focusing on most relevant models to translate the promising agents to a clinical setting. Given the urgency to address lung failure in COVID-19, we summarize the feasibility of delivering promising therapies by the inhalational route, with the expectation that this route will provide the most effective intervention to halt viral spread. We conclude with the authors' perspectives on the future of RNAi therapeutics for combatting SARS-CoV-2. Since time is of the essence, a strong perspective for the path to most effective therapeutic approaches are clearly articulated by the authors.
Collapse
Affiliation(s)
- Hasan Uludağ
- Department of Chemical and Materials Engineering, University of Alberta, Edmonton, AB, Canada
- Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, AB, Canada
| | - Kylie Parent
- Department of Chemical and Materials Engineering, University of Alberta, Edmonton, AB, Canada
| | | | - Azita Haddadi
- College of Pharmacy and Nutrition, University of Saskatchewan, Saskatoon, SK, Canada
| |
Collapse
|
|
36
|
Llanes A, Restrepo CM, Caballero Z, Rajeev S, Kennedy MA, Lleonart R. Betacoronavirus Genomes: How Genomic Information has been Used to Deal with Past Outbreaks and the COVID-19 Pandemic. Int J Mol Sci 2020; 21:E4546. [PMID: 32604724 PMCID: PMC7352669 DOI: 10.3390/ijms21124546] [Citation(s) in RCA: 33] [Impact Index Per Article: 6.6] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/29/2020] [Revised: 06/22/2020] [Accepted: 06/23/2020] [Indexed: 12/22/2022] Open
Abstract
In the 21st century, three highly pathogenic betacoronaviruses have emerged, with an alarming rate of human morbidity and case fatality. Genomic information has been widely used to understand the pathogenesis, animal origin and mode of transmission of coronaviruses in the aftermath of the 2002-2003 severe acute respiratory syndrome (SARS) and 2012 Middle East respiratory syndrome (MERS) outbreaks. Furthermore, genome sequencing and bioinformatic analysis have had an unprecedented relevance in the battle against the 2019-2020 coronavirus disease 2019 (COVID-19) pandemic, the newest and most devastating outbreak caused by a coronavirus in the history of mankind. Here, we review how genomic information has been used to tackle outbreaks caused by emerging, highly pathogenic, betacoronavirus strains, emphasizing on SARS-CoV, MERS-CoV and SARS-CoV-2. We focus on shared genomic features of the betacoronaviruses and the application of genomic information to phylogenetic analysis, molecular epidemiology and the design of diagnostic systems, potential drugs and vaccine candidates.
Collapse
Affiliation(s)
- Alejandro Llanes
- Centro de Biología Celular y Molecular de Enfermedades, Instituto de Investigaciones Científicas y Servicios de Alta Tecnología (INDICASAT AIP), Panama City 0801, Panama; (A.L.); (C.M.R.); (Z.C.)
| | - Carlos M. Restrepo
- Centro de Biología Celular y Molecular de Enfermedades, Instituto de Investigaciones Científicas y Servicios de Alta Tecnología (INDICASAT AIP), Panama City 0801, Panama; (A.L.); (C.M.R.); (Z.C.)
| | - Zuleima Caballero
- Centro de Biología Celular y Molecular de Enfermedades, Instituto de Investigaciones Científicas y Servicios de Alta Tecnología (INDICASAT AIP), Panama City 0801, Panama; (A.L.); (C.M.R.); (Z.C.)
| | - Sreekumari Rajeev
- College of Veterinary Medicine, University of Florida, Gainesville, FL 32610, USA;
| | - Melissa A. Kennedy
- College of Veterinary Medicine, University of Tennessee, Knoxville, TN 37996, USA;
| | - Ricardo Lleonart
- Centro de Biología Celular y Molecular de Enfermedades, Instituto de Investigaciones Científicas y Servicios de Alta Tecnología (INDICASAT AIP), Panama City 0801, Panama; (A.L.); (C.M.R.); (Z.C.)
| |
Collapse
|