|
1
|
Gunasegaran B, Ashley CL, Marsh-Wakefield F, Guillemin GJ, Heng B. Viruses in glioblastoma: an update on evidence and clinical trials. BJC REPORTS 2024; 2:33. [PMID: 39516641 PMCID: PMC11524015 DOI: 10.1038/s44276-024-00051-z] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Subscribe] [Scholar Register] [Received: 11/21/2023] [Revised: 01/13/2024] [Accepted: 02/22/2024] [Indexed: 11/16/2024]
Abstract
BACKGROUND Glioblastoma (GB) is a lethal and aggressive brain tumour. While molecular characteristics of GB is studied extensively, the aetiology of GB remains uncertain. The interest in exploring viruses as a potential contributor to the development of GB stems from the notion that viruses are known to play a key role in pathogenesis of other human cancers such as cervical cancer. Nevertheless, the role of viruses in GB remains controversial. METHODS This review delves into the current body of knowledge surrounding the presence of viruses in GB as well as provide updates on clinical trials examining the potential inclusion of antiviral therapies as part of the standard of care protocol. CONCLUSIONS The review summarises current evidences and important gaps in our knowledge related to the presence of viruses in GB.
Collapse
Affiliation(s)
- Bavani Gunasegaran
- Macquarie Medical School, Faculty of Medicine, Health and Human Sciences, Macquarie University, North Ryde, Sydney, NSW, Australia
| | - Caroline L Ashley
- Charles Perkins Centre, The University of Sydney, Camperdown, NSW, Australia
- School of Medical Sciences Faculty of Medicine and Health, The University of Sydney, Camperdown, NSW, Australia
| | - Felix Marsh-Wakefield
- Charles Perkins Centre, The University of Sydney, Camperdown, NSW, Australia
- School of Medical Sciences Faculty of Medicine and Health, The University of Sydney, Camperdown, NSW, Australia
- Centenary Institute, Camperdown, NSW, Australia
| | | | - Benjamin Heng
- Macquarie Medical School, Faculty of Medicine, Health and Human Sciences, Macquarie University, North Ryde, Sydney, NSW, Australia.
| |
Collapse
|
|
2
|
Xiong Z, Raphael I, Olin M, Okada H, Li X, Kohanbash G. Glioblastoma vaccines: past, present, and opportunities. EBioMedicine 2024; 100:104963. [PMID: 38183840 PMCID: PMC10808938 DOI: 10.1016/j.ebiom.2023.104963] [Citation(s) in RCA: 27] [Impact Index Per Article: 27.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/12/2023] [Revised: 12/21/2023] [Accepted: 12/24/2023] [Indexed: 01/08/2024] Open
Abstract
Glioblastoma (GBM) is one of the most lethal central nervous systems (CNS) tumours in adults. As supplements to standard of care (SOC), various immunotherapies improve the therapeutic effect in other cancers. Among them, tumour vaccines can serve as complementary monotherapy or boost the clinical efficacy with other immunotherapies, such as immune checkpoint blockade (ICB) and chimeric antigen receptor T cells (CAR-T) therapy. Previous studies in GBM therapeutic vaccines have suggested that few neoantigens could be targeted in GBM due to low mutation burden, and single-peptide therapeutic vaccination had limited efficacy in tumour control as monotherapy. Combining diverse antigens, including neoantigens, tumour-associated antigens (TAAs), and pathogen-derived antigens, and optimizing vaccine design or vaccination strategy may help with clinical efficacy improvement. In this review, we discussed current GBM therapeutic vaccine platforms, evaluated and potential antigenic targets, current challenges, and perspective opportunities for efficacy improvement.
Collapse
Affiliation(s)
- Zujian Xiong
- Department of Neurological Surgery, University of Pittsburgh School of Medicine, Pittsburgh, PA 15201, USA; Xiangya School of Medicine, Central South University, Changsha, Hunan 410008, PR China
| | - Itay Raphael
- Department of Neurological Surgery, University of Pittsburgh School of Medicine, Pittsburgh, PA 15201, USA
| | - Michael Olin
- Department of Pediatrics, Masonic Cancer Center, University of Minnesota, Minneapolis, MN 55455, USA
| | - Hideho Okada
- Department of Neurological Surgery, University of California, San Francisco, CA 94143, USA
| | - Xuejun Li
- Department of Neurosurgery, Xiangya Hospital, Central South University, Changsha, Hunan 410008, PR China; Hunan International Scientific and Technological Cooperation Base of Brain Tumor Research, Xiangya Hospital, Central South University, Changsha, Hunan 410008 PR China.
| | - Gary Kohanbash
- Department of Neurological Surgery, University of Pittsburgh School of Medicine, Pittsburgh, PA 15201, USA; Department of Immunology, University of Pittsburgh, Pittsburgh, PA 15213, USA.
| |
Collapse
|
|
3
|
Guerra G, McCoy L, Hansen HM, Rice T, Molinaro AM, Wiemels JL, Wiencke JK, Wrensch M, Francis SS. Antibodies to varicella-zoster virus and three other herpesviruses and survival in adults with glioma. Neuro Oncol 2023; 25:1047-1057. [PMID: 36610073 PMCID: PMC10237424 DOI: 10.1093/neuonc/noac283] [Citation(s) in RCA: 6] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/07/2022] [Indexed: 01/09/2023] Open
Abstract
BACKGROUND Lifetime exposure to the varicella-zoster virus (VZV) has been consistently inversely associated with glioma risk, however, the relationship of VZV with survival in adults with glioma has not been investigated. In this study, we analyzed the survival of adults with glioma in relation to their antibody measurements to 4 common herpes viral infections, including VZV, measured post-diagnosis. METHODS We analyzed IgG antibody measurements to VZV, cytomegalovirus (CMV), herpes simplex virus 1/2 (HSV), and Epstein-Barr virus (EBV) collected from 1378 adults with glioma diagnosed between 1991 and 2010. Blood was obtained a median of 3 months after surgery. Associations of patient IgG levels with overall survival were estimated using Cox models adjusted for age, sex, self-reported race, surgery type, dexamethasone usage at blood draw, and tumor grade. Models were stratified by recruitment series and meta-analyzed to account for time-dependent treatment effects. RESULTS VZV antibody seropositivity was associated with improved survival outcomes in adults with glioma (Hazard ratio, HR = 0.70, 95% Confidence Interval 0.54-0.90, P = .006). Amongst cases who were seropositive for VZV antibodies, survival was significantly improved for those above the 25th percentile of continuous reactivity measurements versus those below (HR = 0.76, 0.66-0.88, P = .0003). Antibody seropositivity to EBV was separately associated with improved survival (HR = 0.71, 0.53-0.96, P = .028). Antibody positivity to 2 other common viruses (CMV, HSV) was not associated with altered survival. CONCLUSIONS Low levels of VZV or EBV antibodies are associated with poorer survival outcomes for adults with glioma. Differential immune response rather than viral exposure may explain these findings.
Collapse
Affiliation(s)
- Geno Guerra
- Department of Neurological Surgery, University of California San Francisco, San Francisco, California, USA
| | - Lucie McCoy
- Department of Neurological Surgery, University of California San Francisco, San Francisco, California, USA
| | - Helen M Hansen
- Department of Neurological Surgery, University of California San Francisco, San Francisco, California, USA
| | - Terri Rice
- Department of Neurological Surgery, University of California San Francisco, San Francisco, California, USA
| | - Annette M Molinaro
- Department of Neurological Surgery, University of California San Francisco, San Francisco, California, USA
- Department of Epidemiology and Biostatistics, University of California San Francisco, San Francisco, California, USA
- Weill Institute for Neurosciences, University of California San Francisco, San Francisco, California, USA
| | - Joseph L Wiemels
- Center for Genetic Epidemiology, Department of Population and Public Health Sciences, University of Southern California, Los Angeles, California, USA
| | - John K Wiencke
- Department of Neurological Surgery, University of California San Francisco, San Francisco, California, USA
- Department of Epidemiology and Biostatistics, University of California San Francisco, San Francisco, California, USA
- Institute of Human Genetics, University of California San Francisco, San Francisco, California, USA
- Weill Institute for Neurosciences, University of California San Francisco, San Francisco, California, USA
| | - Margaret Wrensch
- Department of Neurological Surgery, University of California San Francisco, San Francisco, California, USA
- Institute of Human Genetics, University of California San Francisco, San Francisco, California, USA
- Weill Institute for Neurosciences, University of California San Francisco, San Francisco, California, USA
| | - Stephen S Francis
- Department of Neurological Surgery, University of California San Francisco, San Francisco, California, USA
- Department of Epidemiology and Biostatistics, University of California San Francisco, San Francisco, California, USA
- Weill Institute for Neurosciences, University of California San Francisco, San Francisco, California, USA
| |
Collapse
|
|
4
|
Dong XD, Li Y, Li Y, Sun C, Liu SX, Duan H, Cui R, Zhong Q, Mou YG, Wen L, Yang B, Zeng MS, Luo MH, Zhang H. EphA2 is a functional entry receptor for HCMV infection of glioblastoma cells. PLoS Pathog 2023; 19:e1011304. [PMID: 37146061 DOI: 10.1371/journal.ppat.1011304] [Citation(s) in RCA: 12] [Impact Index Per Article: 6.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/23/2022] [Revised: 05/17/2023] [Accepted: 03/20/2023] [Indexed: 05/07/2023] Open
Abstract
Human cytomegalovirus (HCMV) infection is associated with human glioblastoma, the most common and aggressive primary brain tumor, but the underlying infection mechanism has not been fully demonstrated. Here, we show that EphA2 was upregulated in glioblastoma and correlated with the poor prognosis of the patients. EphA2 silencing inhibits, whereas overexpression promotes HCMV infection, establishing EphA2 as a crucial cell factor for HCMV infection of glioblastoma cells. Mechanistically, EphA2 binds to HCMV gH/gL complex to mediate membrane fusion. Importantly, the HCMV infection was inhibited by the treatment of inhibitor or antibody targeting EphA2 in glioblastoma cells. Furthermore, HCMV infection was also impaired in optimal glioblastoma organoids by EphA2 inhibitor. Taken together, we propose EphA2 as a crucial cell factor for HCMV infection in glioblastoma cells and a potential target for intervention.
Collapse
Affiliation(s)
- Xiao-Dong Dong
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Yan Li
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
- Department of Pathology, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Ying Li
- MOE Key Laboratory of Tropical Disease Control, Shenzhen Centre for Infection and Immunity Studies (CIIS), School of Medicine, Shenzhen Campus of Sun Yat-sen University, Shenzhen, Guangdong, China
| | - Cong Sun
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Shang-Xin Liu
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Hao Duan
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Run Cui
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Qian Zhong
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Yong-Gao Mou
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Le Wen
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
- The Joint Center of Translational Precision Medicine, Guangzhou Institute of Pediatrics, Guangzhou Women and Children Medical Center; Wuhan Institute of Virology, Chinese Academy of Sciences, China
| | - Bo Yang
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
| | - Mu-Sheng Zeng
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
| | - Min-Hua Luo
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
| | - Hua Zhang
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou, China
- MOE Key Laboratory of Tropical Disease Control, Shenzhen Centre for Infection and Immunity Studies (CIIS), School of Medicine, Shenzhen Campus of Sun Yat-sen University, Shenzhen, Guangdong, China
| |
Collapse
|
|
5
|
Berg C, Rosenkilde MM. Therapeutic targeting of HCMV-encoded chemokine receptor US28: Progress and challenges. Front Immunol 2023; 14:1135280. [PMID: 36860859 PMCID: PMC9968965 DOI: 10.3389/fimmu.2023.1135280] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/31/2022] [Accepted: 01/25/2023] [Indexed: 02/16/2023] Open
Abstract
The pervasive human cytomegalovirus (HCMV) causes significant morbidity in immunocompromised individuals. Treatment using the current standard-of-care (SOC) is limited by severe toxic adverse effects and anti-viral resistance development. Furthermore, they only affect HCMV in its lytic phase, meaning viral disease is not preventable as latent infection cannot be treated and the viral reservoirs persist. The viral chemokine receptor (vCKR) US28 encoded by HCMV has received much attention in recent years. This broad-spectrum receptor has proven to be a desirable target for development of novel therapeutics through exploitation of its ability to internalize and its role in maintaining latency. Importantly, it is expressed on the surface of infected cells during both lytic and latent infection. US28-targeting small molecules, single-domain antibodies, and fusion toxin proteins have been developed for different treatment strategies, e.g. forcing reactivation of latent virus or using internalization of US28 as a toxin shuttle to kill infected cells. These strategies show promise for providing ways to eliminate latent viral reservoirs and prevent HCMV disease in vulnerable patients. Here, we discuss the progress and challenges of targeting US28 to treat HCMV infection and its associated diseases.
Collapse
|
|
6
|
Ahn J, Shin C, Kim YS, Park JS, Jeun SS, Ahn S. Cytomegalovirus-Specific Immunotherapy for Glioblastoma Treatments. Brain Tumor Res Treat 2022; 10:135-143. [PMID: 35929110 PMCID: PMC9353163 DOI: 10.14791/btrt.2022.0010] [Citation(s) in RCA: 5] [Impact Index Per Article: 1.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/14/2022] [Revised: 05/25/2022] [Accepted: 06/15/2022] [Indexed: 11/20/2022] Open
Abstract
Over the last two decades, numerous studies have investigated the presence of human cytomegalovirus (CMV) within glioblastoma or gliomas; however, the results are severely conflicting. While a few researchers have suggested the potential benefits of cytotoxic T lymphocyte or dendritic cell-based vaccines for recurrent or newly diagnosed glioblastoma patients, several studies did not at all agree with the existence of CMV in glioblastoma cells. In this review, we summarized the conflicting results and issues about the detection of CMV in glioblastoma or glioma patients. We also provided the clinical data of published and unpublished clinical trials using CMV-specific immunotherapy for glioblastomas.
Collapse
Affiliation(s)
- Jaehyun Ahn
- College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Christopher Shin
- College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Yeo Song Kim
- Department of Neurosurgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Jae-Sung Park
- Department of Neurosurgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Sin-Soo Jeun
- Department of Neurosurgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
| | - Stephen Ahn
- Department of Neurosurgery, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea.
| |
Collapse
|
|
7
|
Adhikari AS, Macauley J, Johnson Y, Connolly M, Coleman T, Heiland T. Development and Characterization of an HCMV Multi-Antigen Therapeutic Vaccine for Glioblastoma Using the UNITE Platform. Front Oncol 2022; 12:850546. [PMID: 35651802 PMCID: PMC9149224 DOI: 10.3389/fonc.2022.850546] [Citation(s) in RCA: 7] [Impact Index Per Article: 2.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/07/2022] [Accepted: 03/18/2022] [Indexed: 01/10/2023] Open
Abstract
Glioblastoma multiforme (GBM) is an aggressive form of brain cancer with a median survival of 15 months that has remained unchanged despite advances in the standard of care. GBM cells express human cytomegalovirus (HCMV) proteins, providing a unique opportunity for targeted therapy. We utilized our UNITE (UNiversal Intracellular Targeted Expression) platform to develop a multi-antigen DNA vaccine (ITI-1001) that codes for the HCMV proteins pp65, gB, and IE-1. The UNITE platform involves lysosomal targeting technology, fusing lysosome-associated membrane protein 1 (LAMP1) with target ntigens. We demonstrate evidence of increased antigen presentation by both MHC-I and -II, delivering a robust antigen-specific CD4 and CD8 T-cell response in addition to a strong humoral response. Using a syngeneic orthotopic GBM mouse model, therapeutic treatment with the ITI-1001 vaccine resulted in ~56% survival of tumor-bearing mice. Investigation of the tumor microenvironment showed significant CD4 infiltration as well as enhanced Th1 and cytotoxic CD8 T activation. Regulatory T cells were also upregulated after ITI-1001 vaccination. In addition, tumor burden negatively correlated with activated interferon (IFN)γ+ CD4 T cells, reiterating the importance of CD4 activation in ITI-1001 efficacy and in identifying treatment responders and non-responders. Further characterization of these two groups showed high infiltration of CD3+, CD4+, and CD8+ T cells in responders compared to non-responders. Thus, we show that vaccination with HCMV antigens using the ITI-1001-UNITE platform generates strong cellular and humoral immune responses, triggering significant antitumor activity, leading to enhanced survival in a mouse model of GBM.
Collapse
Affiliation(s)
| | | | | | - Mike Connolly
- Immunomic Therapeutics, Rockville, MD, United States
| | | | - Teri Heiland
- Immunomic Therapeutics, Rockville, MD, United States
| |
Collapse
|
|
8
|
Daei Sorkhabi A, Sarkesh A, Saeedi H, Marofi F, Ghaebi M, Silvestris N, Baradaran B, Brunetti O. The Basis and Advances in Clinical Application of Cytomegalovirus-Specific Cytotoxic T Cell Immunotherapy for Glioblastoma Multiforme. Front Oncol 2022; 12:818447. [PMID: 35515137 PMCID: PMC9062077 DOI: 10.3389/fonc.2022.818447] [Citation(s) in RCA: 11] [Impact Index Per Article: 3.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/05/2021] [Accepted: 03/24/2022] [Indexed: 01/28/2023] Open
Abstract
A high percentage of malignant gliomas are infected by human cytomegalovirus (HCMV), and the endogenous expression of HCMV genes and their products are found in these tumors. HCMV antigen expression and its implications in gliomagenesis have emerged as a promising target for adoptive cellular immunotherapy (ACT) strategies in glioblastoma multiforme (GB) patients. Since antigen-specific T cells in the tumor microenvironments lack efficient anti-tumor immune response due to the immunosuppressive nature of glioblastoma, CMV-specific ACT relies on in vitro expansion of CMV-specific CD8+ T cells employing immunodominant HCMV antigens. Given the fact that several hurdles remain to be conquered, recent clinical trials have outlined the feasibility of CMV-specific ACT prior to tumor recurrence with minimal adverse effects and a substantial improvement in median overall survival and progression-free survival. This review discusses the role of HCMV in gliomagenesis, disease prognosis, and recent breakthroughs in harnessing HCMV-induced immunogenicity in the GB tumor microenvironment to develop effective CMV-specific ACT.
Collapse
Affiliation(s)
- Amin Daei Sorkhabi
- Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Aila Sarkesh
- Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Hossein Saeedi
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Faroogh Marofi
- Department of Hematology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Mahnaz Ghaebi
- Cancer Gene Therapy Research Center (CGRC), Zanjan University of Medical Sciences, Zanjan, Iran
| | - Nicola Silvestris
- Medical Oncology Unit, Department of Human Pathology "G. Barresi", University of Messina, Messina, Italy
| | - Behzad Baradaran
- Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
- Neurosciences Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
| | - Oronzo Brunetti
- Medical Oncology Unit-Istituto di Ricovero e Cura a Carattere Scientifico (IRCCS) Istituto Tumori “Giovanni Paolo II” of Bari, Bari, Italy
| |
Collapse
|
|
9
|
Francis SS, Ostrom QT, Cote DJ, Smith TR, Claus E, Barnholtz-Sloan JS. The Epidemiology of Central Nervous System Tumors. Hematol Oncol Clin North Am 2022; 36:23-42. [PMID: 34801162 DOI: 10.1016/j.hoc.2021.08.012] [Citation(s) in RCA: 16] [Impact Index Per Article: 5.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/24/2022]
Abstract
This article reviews the current epidemiology of central nervous system tumors. Population-level basic epidemiology, nationally and internationally, and current understanding of germline genetic risk are discussed, with a focus on known and well-studied risk factors related to the etiology of central nervous system tumors.
Collapse
Affiliation(s)
- Stephen S Francis
- Department of Neurological Surgery, Division of Neuro and Molecular Epidemiology, University of California San Francisco School of Medicine, 1450 3rd Street, HD442, San Francisco, CA 94158, USA.
| | - Quinn T Ostrom
- Department of Neurosurgery, Duke University School of Medicine, 571 Research Drive, MSRB-1, Rm 442, Durham, NC 27710, USA
| | - David J Cote
- Department of Neurosurgery, Keck School of Medicine, University of Southern California, 1200 N State Street, Suite 3300, Los Angeles, CA 90033, USA
| | - Timothy R Smith
- Department of Neurosurgery, Computational Neuroscience Outcomes Center, Brigham and Women's Hospital, Harvard Medical School, 60 Fenwood Avenue, Boston, MA 02115, USA
| | - Elizabeth Claus
- Department of Neurosurgery, Yale University, Yale School of Public Health, Brigham and Women's Hospital, 60 College Street, New Haven, CT 06510, USA
| | - Jill S Barnholtz-Sloan
- Center for Biomedical Informatics and Information Technology, Trans-Divisional Research Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute (NCI), NCI Shady Grove, 9609 Medical Center Dr, Rockville, MD 20850, USA
| |
Collapse
|
|
10
|
Metabolic Reprogramming of Glioblastoma Cells during HCMV Infection Induces Secretome-Mediated Paracrine Effects in the Microenvironment. Viruses 2022; 14:v14010103. [PMID: 35062307 PMCID: PMC8777757 DOI: 10.3390/v14010103] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/25/2021] [Revised: 12/22/2021] [Accepted: 01/04/2022] [Indexed: 12/14/2022] Open
Abstract
Glioblastoma (GBM) is an aggressive primary central nervous system neoplasia with limited therapeutic options and poor prognosis. Following reports of cytomegalovirus (HCMV) in GBM tumors, the anti-viral drug Valganciclovir was administered and found to significantly increase the longevity of GBM patients. While these findings suggest a role for HCMV in GBM, the relationship between them is not clear and remains controversial. Treatment with anti-viral drugs may prove clinically useful; however, their results do not explain the underlying mechanism between HCMV infection and GBM progression. We hypothesized that HCMV infection would metabolically reprogram GBM cells and that these changes would allow for increased tumor progression. We infected LN-18 GBM cells and employed a Seahorse Bioanalyzer to characterize cellular metabolism. Increased mitochondrial respiration and glycolytic rates were observed following infection. These changes were accompanied by elevated production of reactive oxygen species and lactate. Due to lactate’s numerous tumor-promoting effects, we examined the impact of paracrine signaling of HCMV-infected GBM cells on uninfected stromal cells. Our results indicated that, independent of viral transmission, the secretome of HCMV-infected GBM cells was able to alter the expression of key metabolic proteins and epigenetic markers. This suggests a mechanism of action where reprogramming of GBM cells alters the surrounding tumor microenvironment to be permissive to tumor progression in a manner akin to the Reverse-Warburg Effect. Overall, this suggests a potential oncomodulatory role for HCMV in the context of GBM.
Collapse
|
|
11
|
Abstract
Glioblastoma has emerged as an immunotherapy-refractory tumor based on negative phase III studies of anti-programmed cell death-1 therapy among newly diagnosed as well as recurrent patients. In addition, although much work on vaccine and cellular approaches is ongoing, therapeutic benefit with these approaches has been underwhelming. Much scientific insight into the multitiered layers of immunosuppression exploited by glioblastoma tumors is emerging that sheds light on the explanation for the disappointing results to date and highlights possible therapeutic avenues that may offer a better likelihood of therapeutic benefit for immune-based therapies.
Collapse
|
|
12
|
Peredo-Harvey I, Rahbar A, Söderberg-Nauclér C. Presence of the Human Cytomegalovirus in Glioblastomas-A Systematic Review. Cancers (Basel) 2021; 13:cancers13205051. [PMID: 34680198 PMCID: PMC8533734 DOI: 10.3390/cancers13205051] [Citation(s) in RCA: 18] [Impact Index Per Article: 4.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/15/2021] [Revised: 09/30/2021] [Accepted: 10/04/2021] [Indexed: 12/29/2022] Open
Abstract
Simple Summary Whether the human cytomegalovirus (HCMV) is present in samples obtained from patients with glioblastoma (GBM) has been a matter under debate during the last two decades. Many investigators have demonstrated the presence of HCMV proteins and nucleic acids in GBM tumors, while some have not been able to detect it. It is important to evaluate current data and resolve these issues to clarify the possible role of the HCMV in GBM tumorigenesis and if this virus can serve as a potential target of therapy for these patients. In the present systematic review, we aim to review published research studies with a focus to identify differences and similarities in methods used for the detection of the HCMV in GBM samples found to be positive or negative for HCMV. Our data suggest that the HCMV is highly prevalent in glioblastomas and that optimized immunohistochemistry techniques are required to detect it. Abstract Glioblastoma is a malignant brain tumor with a dismal prognosis. The standard treatment has not changed in the past 15 years as clinical trials of new treatment protocols have failed. A high prevalence of the human cytomegalovirus (HCMV) in glioblastomas was first reported in 2002. The virus was found only in the tumor and not in the surrounding healthy brain tissue. Many groups have confirmed the presence of the HCMV in glioblastomas, but others could not. To resolve this discrepancy, we systematically reviewed 645 articles identified in different databases. Of these, 81 studies included results from 247 analyses of 9444 clinical samples (7024 tumor samples and 2420 blood samples) by different techniques, and 81 articles included 191 studies that identified the HCMV in 2529 tumor samples (36% of all tumor samples). HCMV proteins were often detected, whereas HCMV nucleic acids were not reliably detected by PCR methods. Optimized immunohistochemical techniques identified the virus in 1391 (84,2%) of 1653 samples. These data suggest that the HCMV is highly prevalent in glioblastomas and that optimized immunohistochemistry techniques are required to detect it.
Collapse
Affiliation(s)
- Inti Peredo-Harvey
- Department of Neurosurgery, Karolinska University Hospital, 171 76 Stockholm, Sweden;
- Department of Medicine, Solna, BioClinicum, Karolinska Institutet, 171 64 Stockholm, Sweden;
| | - Afsar Rahbar
- Department of Medicine, Solna, BioClinicum, Karolinska Institutet, 171 64 Stockholm, Sweden;
- Department of Neurology, Karolinska University Hospital, 171 76 Stockholm, Sweden
| | - Cecilia Söderberg-Nauclér
- Department of Medicine, Solna, BioClinicum, Karolinska Institutet, 171 64 Stockholm, Sweden;
- Department of Neurology, Karolinska University Hospital, 171 76 Stockholm, Sweden
- Correspondence:
| |
Collapse
|
|
13
|
Krenzlin H, Zdioruk M, Nowicki MO, Finkelberg T, Keric N, Lemmermann N, Skubal M, Chiocca EA, Cook CH, Lawler SE. Cytomegalovirus infection of glioblastoma cells leads to NF-κB dependent upregulation of the c-MET oncogenic tyrosine kinase. Cancer Lett 2021; 513:26-35. [PMID: 33989707 PMCID: PMC8209659 DOI: 10.1016/j.canlet.2021.05.005] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/14/2020] [Revised: 04/18/2021] [Accepted: 05/04/2021] [Indexed: 11/22/2022]
Abstract
Cytomegalovirus (CMV) is widespread in humans and has been implicated in glioblastoma (GBM) and other tumors. However, the role of CMV in GBM remains poorly understood and the mechanisms involved are not well-defined. The goal of this study was to identify candidate pathways relevant to GBM that may be modulated by CMV. Analysis of RNAseq data after CMV infection of patient-derived GBM cells showed significant upregulation of GBM-associated transcripts including the MET oncogene, which is known to play a role in a subset of GBM patients. These findings were validated in vitro in both mouse and human GBM cells. Using immunostaining and RT-PCR in vivo, we confirmed c-MET upregulation in a mouse model of CMV-driven GBM progression and in human GBM. siRNA knockdown showed that MET upregulation was dependent on CMV-induced upregulation of NF-κB signaling. Finally, proneural GBM xenografts overexpressing c-MET grew much faster in vivo than controls, suggesting a mechanism by which CMV infection of tumor cells could induce a more aggressive mesenchymal phenotype. These studies implicate the CMV-induced upregulation of c-MET as a potential mechanism involved in the effects of CMV on GBM growth.
Collapse
Affiliation(s)
- Harald Krenzlin
- Harvey Cushing Neurooncology Laboratories, Department of Neurosurgery, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA; Department of Neurosurgery, University Hospital Mainz, Gutenberg University, Mainz, Germany
| | - Mykola Zdioruk
- Harvey Cushing Neurooncology Laboratories, Department of Neurosurgery, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA
| | - Michal O Nowicki
- Harvey Cushing Neurooncology Laboratories, Department of Neurosurgery, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA
| | - Tomer Finkelberg
- Harvey Cushing Neurooncology Laboratories, Department of Neurosurgery, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA
| | - Naureen Keric
- Department of Neurosurgery, University Hospital Mainz, Gutenberg University, Mainz, Germany
| | - Niels Lemmermann
- Institute of Virology, University Hospital Mainz, Gutenberg University, Mainz, Germany
| | - Magdalena Skubal
- Harvey Cushing Neurooncology Laboratories, Department of Neurosurgery, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA
| | - E Antonio Chiocca
- Harvey Cushing Neurooncology Laboratories, Department of Neurosurgery, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA
| | - Charles H Cook
- Department of Surgery, Beth Israel Deaconess Medical Centre, Harvard Medical School, Boston, MA, USA.
| | - Sean E Lawler
- Harvey Cushing Neurooncology Laboratories, Department of Neurosurgery, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA.
| |
Collapse
|
|
14
|
Mihelson N, McGavern DB. Viral Control of Glioblastoma. Viruses 2021; 13:v13071264. [PMID: 34209584 PMCID: PMC8310222 DOI: 10.3390/v13071264] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/02/2021] [Revised: 06/23/2021] [Accepted: 06/24/2021] [Indexed: 12/11/2022] Open
Abstract
Glioblastoma multiforme (GBM) is a universally lethal cancer of the central nervous system. Patients with GBM have a median survival of 14 months and a 5-year survival of less than 5%, a grim statistic that has remained unchanged over the last 50 years. GBM is intransigent for a variety of reasons. The immune system has a difficult time mounting a response against glioblastomas because they reside in the brain (an immunologically dampened compartment) and generate few neoantigens relative to other cancers. Glioblastomas inhabit the brain like sand in the grass and display a high degree of intra- and inter-tumoral heterogeneity, impeding efforts to therapeutically target a single pathway. Of all potential therapeutic strategies to date, virotherapy offers the greatest chance of counteracting each of the obstacles mounted by GBM. Virotherapy can xenogenize a tumor that is deft at behaving like “self”, triggering adaptive immune recognition in an otherwise immunologically quiet compartment. Viruses can also directly lyse tumor cells, creating damage and further stimulating secondary immune reactions that are detrimental to tumor growth. In this review, we summarize the basic immune mechanisms underpinning GBM immune evasion and the recent successes achieved using virotherapies.
Collapse
|
|
15
|
Survey of BK and JC polyomaviruses, human cytomegalovirus and human papillomavirus in different types of brain tumors in Iranian patients. GENE REPORTS 2021. [DOI: 10.1016/j.genrep.2021.101106] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/23/2022]
|
|
16
|
Fulkerson HL, Nogalski MT, Collins-McMillen D, Yurochko AD. Overview of Human Cytomegalovirus Pathogenesis. Methods Mol Biol 2021; 2244:1-18. [PMID: 33555579 DOI: 10.1007/978-1-0716-1111-1_1] [Citation(s) in RCA: 48] [Impact Index Per Article: 12.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/12/2022]
Abstract
Human cytomegalovirus (HCMV) is a betaherpesvirus with a global seroprevalence of 60-90%. HCMV is the leading cause of congenital infections and poses a great health risk to immunocompromised individuals. Although HCMV infection is typically asymptomatic in the immunocompetent population, infection can result in mononucleosis and has also been associated with the development of certain cancers, as well as chronic inflammatory diseases such as various cardiovascular diseases. In immunocompromised patients, including AIDS patients, transplant recipients, and developing fetuses, HCMV infection is associated with increased rates of morbidity and mortality. Currently there is no vaccine for HCMV and there is a need for new pharmacological treatments. Ongoing research seeks to further define the complex aspects of HCMV pathogenesis, which could potentially lead to the generation of new therapeutics to mitigate the disease states associated with HCMV infection. The following chapter reviews the advancements in our understanding of HCMV pathogenesis in the immunocompetent and immunocompromised hosts.
Collapse
Affiliation(s)
- Heather L Fulkerson
- Department of Microbiology & Immunology, Center for Molecular and Tumor Virology, Feist-Weiller Cancer Center, Louisiana State University Health Sciences Center-Shreveport, Shreveport, LA, USA
- Center for Cardiovascular Diseases and Sciences, Louisiana State University Health Sciences Center-Shreveport, Shreveport, LA, USA
| | - Maciej T Nogalski
- Department of Molecular Biology, Princeton University, Princeton, NJ, USA
| | | | - Andrew D Yurochko
- Department of Microbiology and Immunology, Louisiana State University Health Sciences Center-Shreveport, Shreveport, LA, USA.
| |
Collapse
|
|
17
|
Human Cytomegalovirus and Human Herpesvirus-6 and Wilms Tumor: Is There a Link? ARCHIVES OF PEDIATRIC INFECTIOUS DISEASES 2020. [DOI: 10.5812/pedinfect.103904] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/16/2022]
Abstract
Background: Identifying etiologic factors contributing to Wilms tumor (WT) is necessary for its prevention and treatment. Oncogenic viruses cause nearly 20% of all human cancers. Although trials on preventing virus-caused cancers are complex and difficult, but they are not impossible to conduct. Human Cytomegalovirus (HCMV) and human herpes virus-6 (HHV6) can cause different types of cancers. Objectives: The current study aimed to investigate whether HCMV and HHV6-DNA are present in patients with WT. This is the first study of this kind in Iran. Methods: This study was performed on patients with kidney disorders who were referring to Mofid Pediatrics Hospital, Tehran (Iran), during 2010-16. In total, 98 kidney samples (49 patients with WT and 49 normal kidneys (autopsy) and kidneys with benign noninfectious lesions) were investigated to identify HCMV and HHV6-DNA. Qualitative Polymerase Chain reaction (PCR) method and nested polymerase chain reaction (nested-PCR) technique were used to identify HCMV and HHV6, respectively. Results: No significant difference was found between WT patients and controls concerning the HCMV or HHV6. Conclusions: Based on the findings, it can be concluded that there is no association between these viruses and WT.
Collapse
|
|
18
|
Stragliotto G, Pantalone MR, Rahbar A, Söderberg-Nauclér C. Valganciclovir as Add-On to Standard Therapy in Secondary Glioblastoma. Microorganisms 2020; 8:microorganisms8101471. [PMID: 32987955 PMCID: PMC7599902 DOI: 10.3390/microorganisms8101471] [Citation(s) in RCA: 16] [Impact Index Per Article: 3.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/09/2020] [Revised: 09/22/2020] [Accepted: 09/23/2020] [Indexed: 12/28/2022] Open
Abstract
Patients with glioblastoma have a very poor prognosis despite aggressive therapeutic strategies. Cytomegalovirus has been detected in >90% of glioblastoma tumors. This virus can affect tumor progression and may represent a novel glioblastoma therapy target. We report, here, a retrospective survival analysis of patients with secondary glioblastoma who were treated with the anti-viral drug valganciclovir at Karolinska University Hospital in Stockholm. We performed survival analyses of eight patients with secondary glioblastoma who were treated with a standard dose of valganciclovir as an add-on to second-line therapy after their disease progression to glioblastoma. Thirty-six patients with secondary glioblastoma admitted during the same time period who received similar treatment and care served as contemporary controls. The patients treated with valganciclovir showed an increased median overall survival after progression to glioblastoma compared with controls (19.1 versus 12.7 months, p = 0.0072). This result indicates a potential positive effect of valganciclovir in secondary glioblastoma, which is in agreement with our previous observation that valganciclovir treatment improves the outcomes of patients with newly diagnosed glioblastoma. Larger randomized studies are warranted to prove this hypothesis.
Collapse
Affiliation(s)
- Giuseppe Stragliotto
- Department of Medicine, Solna, Microbial Pathogenesis Unit, Karolinska Institutet, 17164 Stockholm, Sweden; (G.S.); (A.R.)
- Division of Neurology, Karolinska University Hospital, 17177 Stockholm, Sweden
| | - Mattia Russel Pantalone
- Department of Medicine, Solna, Microbial Pathogenesis Unit, Karolinska Institutet, 17164 Stockholm, Sweden; (G.S.); (A.R.)
- Division of Neurology, Karolinska University Hospital, 17177 Stockholm, Sweden
- Correspondence: (M.R.P.); (C.S.-N.)
| | - Afsar Rahbar
- Department of Medicine, Solna, Microbial Pathogenesis Unit, Karolinska Institutet, 17164 Stockholm, Sweden; (G.S.); (A.R.)
- Division of Neurology, Karolinska University Hospital, 17177 Stockholm, Sweden
| | - Cecilia Söderberg-Nauclér
- Department of Medicine, Solna, Microbial Pathogenesis Unit, Karolinska Institutet, 17164 Stockholm, Sweden; (G.S.); (A.R.)
- Division of Neurology, Karolinska University Hospital, 17177 Stockholm, Sweden
- Correspondence: (M.R.P.); (C.S.-N.)
| |
Collapse
|
|
19
|
Yuan Z, Ye X, Zhu L, Zhang N, An Z, Zheng WJ. Virome assembly and annotation in brain tissue based on next-generation sequencing. Cancer Med 2020; 9:6776-6790. [PMID: 32738030 PMCID: PMC7520322 DOI: 10.1002/cam4.3325] [Citation(s) in RCA: 8] [Impact Index Per Article: 1.6] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/20/2019] [Revised: 06/20/2020] [Accepted: 07/01/2020] [Indexed: 12/15/2022] Open
Abstract
The glioblastoma multiforme (GBM) is one of the deadliest tumors. It has been speculated that virus plays a role in GBM but the evidences are controversy. Published researches are mainly limited to studies on the presence of human cytomegalovirus (HCMV) in GBM. No comprehensive assessment of the brain virome, the collection of viral material in the brain, based on recently sequenced data has been performed. Here, we characterized the virome from 111 GBM samples and 57 normal brain samples from eight projects in the SRA database by a tested and comprehensive assembly approach. The annotation of the assembled contigs showed that most viral sequences in the brain belong to the viral family Retroviridae. In some GBM samples, we also detected full genome sequence of a novel picornavirus recently discovered in invertebrates. Unlike previous reports, our study did not detect herpes virus such as HCMV in GBM from the data we used. However, some contigs that cannot be annotated with any known genes exhibited antibody epitopes in their sequences. These findings provide several avenues for potential cancer therapy: the newly discovered picornavirus could be a starting point to engineer novel oncolytic virus; and the exhibited antibody epitopes could be a source to explore potential drug targets for immune cancer therapy. By characterizing the virosphere in GBM and normal brain at a global level, the results from this study strengthen the link between GBM and viral infection which warrants the further investigation.
Collapse
Affiliation(s)
- Zihao Yuan
- School of Biomedical InformaticsUniversity of Texas Health Science Center at HoustonHoustonTXUSA
- Texas Therapeutics InstituteInstitute of Molecular MedicineMcGovern Medical SchoolUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - Xiaohua Ye
- Texas Therapeutics InstituteInstitute of Molecular MedicineMcGovern Medical SchoolUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - Lisha Zhu
- School of Biomedical InformaticsUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - Ningyan Zhang
- Texas Therapeutics InstituteInstitute of Molecular MedicineMcGovern Medical SchoolUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - Zhiqiang An
- Texas Therapeutics InstituteInstitute of Molecular MedicineMcGovern Medical SchoolUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| | - W. Jim Zheng
- School of Biomedical InformaticsUniversity of Texas Health Science Center at HoustonHoustonTXUSA
| |
Collapse
|
|
20
|
Limam S, Missaoui N, Hmissa S, Yacoubi MT, Krifa H, Mokni M, Selmi B. Investigation of Human Cytomegalovirus and Human Papillomavirus in Glioma. Cancer Invest 2020; 38:394-405. [PMID: 32643440 DOI: 10.1080/07357907.2020.1793352] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/19/2022]
Abstract
The study investigated the human cytomegalovirus (HCMV) and human papillomavirus (HPV) in gliomas. A retrospective study was conducted on 112 samples. HCMV was investigated by PCR, in situ hybridization (ISH) and immunohistochemistry. HPV was tested by PCR and DNA ISH. HCMV was identified in 60 gliomas, including 55 GBM. However, RNA ISH and immunohistochemistry failed to detect HCMV positivity. HPV was identified in 44 GBM. No significant relationship was identified between HCMV and HPV and tumour characteristics (p > 0.05). Our findings support the HCMV and HPV presence in gliomas. Further assays are required to more explore the potential efficient antiviral management.
Collapse
Affiliation(s)
- Sarra Limam
- Pathology Department, Farhet Hached University Hospital, Sousse, Tunisia
| | - Nabiha Missaoui
- Research Unit UR14ES17, Medicine Faculty, Sousse University, Sousse, Tunisia.,Faculty of Sciences and Techniques of Sidi Bouzid, Kairouan University, Kairouan, Tunisia.,Pathology Department, Sahloul University Hospital, Sousse, Tunisia
| | - Sihem Hmissa
- Pathology Department, Sahloul University Hospital, Sousse, Tunisia
| | | | - Hedi Krifa
- Department of Neurosurgery, Sahloul University Hospital, Sousse, Tunisia
| | - Moncef Mokni
- Pathology Department, Farhet Hached University Hospital, Sousse, Tunisia
| | - Boulbeba Selmi
- Higher Institute of Biotechnology, Monastir University, Monastir, Tunisia
| |
Collapse
|
|
21
|
Kim J, Lee WW, Hwang ES. Human Cytomegalovirus (HCMV)-infected Astrocytoma Cells Impair the Function of HCMV-specific Cytotoxic T Cells. J Korean Med Sci 2020; 35:e218. [PMID: 32657085 PMCID: PMC7358065 DOI: 10.3346/jkms.2020.35.e218] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 02/10/2020] [Accepted: 05/24/2020] [Indexed: 11/23/2022] Open
Abstract
BACKGROUND Human cytomegalovirus (HCMV) infection in glioblastoma multiforme (GBM) is associated with a poor prognosis and may affect the pathogenesis of GBM. In this study, we investigated the role of HCMV-infected astrocytoma cells in impairing the activity of cytotoxic T lymphocytes (CTLs) specific to the HCMV protein. METHODS CTLs specific to HCMV immediate early (IE)-1 were expanded from peripheral blood mononuclear cells of healthy donors by stimulating CD8+ T lymphocytes with U373MG cells (ATCC HTB-17: male) expressing HCMV IE-1. The death rate of the target and the effector cells was determined by the total count of the remaining respective cells after the interaction of them. RESULTS The death rate of the target cells by CTLs increased depending on HLA restriction and the effector:target (E:T) ratio. The death rate of effector cells in the HCMV-infected U373MG cell culture was 37.1% on day 4 post-infection. The removal of the culture supernatant from HCMV-infected U373MG cells prior to adding the effector cells increased target cell death from 8.4% to 40.8% at E:T = 1:1, but not at E:T = 3:1. The transfer of cells from a 24-hour co-culture of the HCMV-infected U373MG cells and CTLs to HCMV IE-1-expressing target cells resulted in decreasing the cell death rate of the target cells from 31.1% to 13.0% at E:T = 1:1, but not at E:T = 3:1. HCMV infection of U373MG cells decreases the activity of CTLs specific to HCMV when the number of CTLs is low. CONCLUSION These results suggest that HCMV could impair CTL activity and facilitate glioblastoma growth unchecked by CTLs.
Collapse
Affiliation(s)
- Jiyeon Kim
- Department of Microbiology and Immunology, Seoul National University College of Medicine, Seoul, Korea
- BK21 Plus Biomedical Science Project, Seoul National University College of Medicine, Seoul, Korea
- Institute of Endemic Diseases, Seoul National University Medical Research Center, Seoul, Korea
| | - Won Woo Lee
- Department of Microbiology and Immunology, Seoul National University College of Medicine, Seoul, Korea
- BK21 Plus Biomedical Science Project, Seoul National University College of Medicine, Seoul, Korea
- Institute of Endemic Diseases, Seoul National University Medical Research Center, Seoul, Korea
| | - Eung Soo Hwang
- Department of Microbiology and Immunology, Seoul National University College of Medicine, Seoul, Korea
- Institute of Endemic Diseases, Seoul National University Medical Research Center, Seoul, Korea.
| |
Collapse
|
|
22
|
Park J, Gill KS, Aghajani AA, Heredia JD, Choi H, Oberstein A, Procko E. Engineered receptors for human cytomegalovirus that are orthogonal to normal human biology. PLoS Pathog 2020; 16:e1008647. [PMID: 32559251 PMCID: PMC7329128 DOI: 10.1371/journal.ppat.1008647] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.4] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/23/2020] [Revised: 07/01/2020] [Accepted: 05/20/2020] [Indexed: 12/12/2022] Open
Abstract
A trimeric glycoprotein complex on the surface of human cytomegalovirus (HCMV) binds to platelet-derived growth factor (PDGF) receptor α (PDGFRα) to mediate host cell recognition and fusion of the viral and cellular membranes. Soluble PDGFRα potently neutralizes HCMV in tissue culture, and its potential use as an antiviral therapeutic has the benefit that any escape mutants will likely be attenuated. However, PDGFRα binds multiple PDGF ligands in the human body as part of developmental programs in embryogenesis and continuing through adulthood. Any therapies with soluble receptor therefore come with serious efficacy and safety concerns, especially for the treatment of congenital HCMV. Soluble virus receptors that are orthogonal to human biology might resolve these concerns. This engineering problem is solved by deep mutational scanning on the D2-D3 domains of PDGFRα to identify variants that maintain interactions with the HCMV glycoprotein trimer in the presence of competing PDGF ligands. Competition by PDGFs is conformation-dependent, whereas HCMV trimer binding is independent of proper D2-D3 conformation, and many mutations at the receptor-PDGF interface are suitable for functionally separating trimer from PDGF interactions. Purified soluble PDGFRα carrying a targeted mutation succeeded in displaying wild type affinity for HCMV trimer with a simultaneous loss of PDGF binding, and neutralizes trimer-only and trimer/pentamer-expressing HCMV strains infecting fibroblasts or epithelial cells. Overall, this work makes important progress in the realization of soluble HCMV receptors for clinical application. Human cytomegalovirus (HCMV) causes severe disease in transplant recipients and immunocompromised patients, and infections in a fetus or neonate are responsible for life-long neurological defects. Cell entry is in part mediated by a trimeric glycoprotein complex on the viral surface, which binds tightly to the host receptor PDGFRα. The soluble extracellular region of PDGFRα can be used as an antiviral agent to potently neutralize the virus in vitro. However, PDGFRα ordinarily binds growth factors in the human body to regulate developmental programs, which will limit the in vivo efficacy and safety of soluble PDGFRα. Using saturation mutagenesis and selections in human cell culture, mutations in PDGFRα are identified that eliminate off-target growth factor interactions while preserving HCMV binding and neutralization.
Collapse
Affiliation(s)
- Jihye Park
- Department of Biochemistry, University of Illinois, Urbana, Illinois, United States of America
| | - Kevin Sean Gill
- Department of Biochemistry, University of Illinois, Urbana, Illinois, United States of America
| | - Ali Asghar Aghajani
- Department of Biochemistry, University of Illinois, Urbana, Illinois, United States of America
| | - Jeremiah Dallas Heredia
- Department of Biochemistry, University of Illinois, Urbana, Illinois, United States of America
| | - Hannah Choi
- Department of Biochemistry, University of Illinois, Urbana, Illinois, United States of America
| | - Adam Oberstein
- Department of Microbiology and Immunology, University of Illinois College of Medicine, Chicago, Illinois, United States of America
| | - Erik Procko
- Department of Biochemistry, University of Illinois, Urbana, Illinois, United States of America
- Cancer Center at Illinois (CCIL), University of Illinois, Urbana, Illinois, United States of America
- * E-mail:
| |
Collapse
|
|
23
|
Cai Z, Yang S, Li X, Chen F, Li W. Viral infection and glioma: a meta-analysis of prognosis. BMC Cancer 2020; 20:549. [PMID: 32532243 PMCID: PMC7291690 DOI: 10.1186/s12885-020-06796-3] [Citation(s) in RCA: 14] [Impact Index Per Article: 2.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/23/2019] [Accepted: 03/27/2020] [Indexed: 01/02/2023] Open
Abstract
Background Glioma is the most common primary brain tumor, occurring due to the carcinogenesis of glial cells in the brain and spinal cord. Many aspects of the mechanism of its tumorigenesis remain unknown. The relationship between viral infection and glioma is one of the most important research aspects in this field. Currently, there is a lack of systematic reviews and meta-analyses to evaluate the effect of viral infection on the prognosis of glioma patients. The purpose of this study was to evaluate the relationship between viral infection and the prognosis of glioma patients, aimed at evaluating the prognostic value of the detection of viral infection. Methods Through careful and comprehensive retrieval of results from the PubMed, Embase, and Cochrane databases, eligible articles were selected strictly according to the inclusion and exclusion criteria. The regional sources, detection methods, detection indicators, patient survival, and other data from the samples in the papers were extracted, and the integrated analysis was conducted using Stata 15.1. We conducted a subgroup analysis of the relationship between the degree of infection and prognosis in cytomegalovirus (CMV) patients. Results A total of 11 studies were included in the analysis. Among them, 7 studies involved the relationship between CMV infection and the prognosis of patients with glioma, 2 studies involved human papillomavirus (HPV), 2 studies involved human herpesvirus-6 (HHV-6), and one study involved simian virus 40 (SV40), woolly monkey sarcoma virus (WMSV) and human endogenous retrovirus K113 (HERV-K113). In the CMV study, the pooled Hazard ratio (HR) of Overall survival (OS) was 1.024 (CI: 0.698–1.501), with a P value of 0.905. The pooled HR of Progression free survival (PFS) was 1.067 (CI: 0.770–1.478), with a P value of 0.697. The pooled HR value of low-degree infection versus high-degree infection was 1.476 (CI: 0.799–2.727), with a P value of 0.213. In the HPV study, the pooled HR of OS was 1.467 (CI: 0.552–3.901), with a P value of 0.443. Conclusion CMV infection has no significant effect on the prognosis of glioma patients. Using the IEA as the detection index, the degree of CMV infection was found to have a significant impact on the prognosis of glioma patients; it was not found to possess a significant prognostic value after the integration of different indicators. Neither HPV nor HHV-6 infection has a significant effect on the prognosis of glioma patients. SV40 and WMSV infection are associated with poor prognosis in patients with low-grade glioma. Trial Registration This meta-analysis registered in https://www.crd.york.ac.uk/PROSPERO/, PROSPERO ID: CRD42019127648.
Collapse
Affiliation(s)
- Zehao Cai
- Department of neurosurgery, Beijing Tiantan Hospital, Capital Medical University, No.119 West Nansihuan Road, Beijing, 100071, China
| | - Shoubo Yang
- Department of neurosurgery, Beijing Tiantan Hospital, Capital Medical University, No.119 West Nansihuan Road, Beijing, 100071, China
| | - Xiaoyan Li
- Department of neurosurgery, Beijing Tiantan Hospital, Capital Medical University, No.119 West Nansihuan Road, Beijing, 100071, China
| | - Feng Chen
- Department of neurosurgery, Beijing Tiantan Hospital, Capital Medical University, No.119 West Nansihuan Road, Beijing, 100071, China
| | - Wenbin Li
- Department of neurosurgery, Beijing Tiantan Hospital, Capital Medical University, No.119 West Nansihuan Road, Beijing, 100071, China.
| |
Collapse
|
|
24
|
Garcia-Fabiani MB, Ventosa M, Comba A, Candolfi M, Nicola Candia AJ, Alghamri MS, Kadiyala P, Carney S, Faisal SM, Schwendeman A, Moon JJ, Scheetz L, Lahann J, Mauser A, Lowenstein PR, Castro MG. Immunotherapy for gliomas: shedding light on progress in preclinical and clinical development. Expert Opin Investig Drugs 2020; 29:659-684. [PMID: 32400216 DOI: 10.1080/13543784.2020.1768528] [Citation(s) in RCA: 13] [Impact Index Per Article: 2.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/12/2022]
Abstract
INTRODUCTION Gliomas are infiltrating brain tumors associated with high morbidity and mortality. Current standard of care includes radiation, chemotherapy, and surgical resection. Today, survival rates for malignant glioma patients remain dismal and unchanged for decades. The glioma microenvironment is highly immunosuppressive and consequently this has motivated the development of immunotherapies for counteracting this condition, enabling the immune cells within the tumor microenvironment to react against this tumor. AREAS COVERED The authors discuss immunotherapeutic strategies for glioma in phase-I/II clinical trials and illuminate their mechanisms of action, limitations, and key challenges. They also examine promising approaches under preclinical development. EXPERT OPINION In the last decade there has been an expansion in immune-mediated anti-cancer therapies. In the glioma field, sophisticated strategies have been successfully implemented in preclinical models. Unfortunately, clinical trials have not yet yielded consistent results for glioma patients. This could be attributed to our limited understanding of the complex immune cell infiltration and its interaction with the tumor cells, the selected time for treatment, the combination with other therapies and the route of administration of the agent. Applying these modalities to treat malignant glioma is challenging, but many new alternatives are emerging to by-pass these hurdles.
Collapse
Affiliation(s)
- Maria B Garcia-Fabiani
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Department of Cell and Developmental Biology, University of Michigan Medical School , Ann Arbor, MI, USA
| | - Maria Ventosa
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Department of Cell and Developmental Biology, University of Michigan Medical School , Ann Arbor, MI, USA
| | - Andrea Comba
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Department of Cell and Developmental Biology, University of Michigan Medical School , Ann Arbor, MI, USA
| | - Marianela Candolfi
- Instituto de Investigaciones Biomédicas (INBIOMED, UBA-CONICET), Facultad de Medicina, Universidad de Buenos Aires , Buenos Aires, Argentina
| | - Alejandro J Nicola Candia
- Instituto de Investigaciones Biomédicas (INBIOMED, UBA-CONICET), Facultad de Medicina, Universidad de Buenos Aires , Buenos Aires, Argentina
| | - Mahmoud S Alghamri
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Department of Cell and Developmental Biology, University of Michigan Medical School , Ann Arbor, MI, USA
| | - Padma Kadiyala
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Department of Cell and Developmental Biology, University of Michigan Medical School , Ann Arbor, MI, USA
| | - Stephen Carney
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Cancer Biology Graduate Program, University of Michigan Medical School , Ann Arbor, MI, USA
| | - Syed M Faisal
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Department of Cell and Developmental Biology, University of Michigan Medical School , Ann Arbor, MI, USA
| | - Anna Schwendeman
- Department of Pharmaceutical Sciences, University of Michigan , Ann Arbor, MI, USA.,Biointerfaces Institute, University of Michigan , Ann Arbor, MI, USA
| | - James J Moon
- Department of Pharmaceutical Sciences, University of Michigan , Ann Arbor, MI, USA.,Biointerfaces Institute, University of Michigan , Ann Arbor, MI, USA.,Department of Biomedical Engineering, University of Michigan , Ann Arbor, MI, USA
| | - Lindsay Scheetz
- Department of Pharmaceutical Sciences, University of Michigan , Ann Arbor, MI, USA.,Biointerfaces Institute, University of Michigan , Ann Arbor, MI, USA
| | - Joerg Lahann
- Biointerfaces Institute, University of Michigan , Ann Arbor, MI, USA.,Department of Chemical Engineering, University of Michigan , Ann Arbor, MI, USA
| | - Ava Mauser
- Biointerfaces Institute, University of Michigan , Ann Arbor, MI, USA.,Department of Chemical Engineering, University of Michigan , Ann Arbor, MI, USA
| | - Pedro R Lowenstein
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Department of Cell and Developmental Biology, University of Michigan Medical School , Ann Arbor, MI, USA.,Biointerfaces Institute, University of Michigan , Ann Arbor, MI, USA
| | - Maria G Castro
- Department of Neurosurgery, University of Michigan Medical School , Ann Arbor, MI, USA.,Department of Cell and Developmental Biology, University of Michigan Medical School , Ann Arbor, MI, USA.,Biointerfaces Institute, University of Michigan , Ann Arbor, MI, USA
| |
Collapse
|
|
25
|
Diagnosis of human cytomegvirus association with malignant gliomas and pro- and anti-inflammatories. CURRENT ISSUES IN PHARMACY AND MEDICAL SCIENCES 2020. [DOI: 10.2478/cipms-2020-0004] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/21/2022] Open
Abstract
Abstract
The study was conducted on seventy individuals of both genders who have been exposed to human cytomegalovirus, a common illness in Iraq. Total cases of human cytomegvirus associated with malignant brain tumors were detected by a real time PCR technique. This resulted in only thirty-six cases of true infection. Of these 24 cases were female, while 12 cases of male infected. The titer to assay the presence of anti- and pro-inflammatories was assessed in sera of all patients by using ELISA kits to evaluate cytokines. This indicated that the pro-inflammatory IL12, after seven days increased (1.67±0.23 pg/ml), while IL4, an anti-inflammatory, decreased to reach (0.39±0.16 pg/ml) (at p<0.05) in the plasm of the experimental patients compared with the control group.
Collapse
|
|
26
|
Maleki F, Sadigh ZA, Sadeghi F, Muhammadnejad A, Farahmand M, Parvin M, Shirkoohi R. Human cytomegalovirus infection in Iranian glioma patients correlates with aging and tumor aggressiveness. J Med Virol 2020; 92:1266-1276. [PMID: 31944314 DOI: 10.1002/jmv.25673] [Citation(s) in RCA: 12] [Impact Index Per Article: 2.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/19/2019] [Accepted: 01/08/2020] [Indexed: 12/18/2022]
Abstract
Human cytomegalovirus (HCMV), as a ubiquitous and opportunistic virus, is a matter for consideration in broad-spectrum diseases, specifically in immunocompromised individuals. In recent decades, many studies that have evaluated the role of HCMV in inflammation and malignancies, especially in high-grade gliomas, have reported inconsistent results. Thus, this study was conducted to analyze 97 primary gliomas for human CMV UL83 gene and protein through TaqMan real-time polymerase chain reaction and immunohistochemistry, respectively. The results were positive for the UL83 gene and pp65 protein in 71% and 24% of samples, respectively. The frequency of HCMV was significantly higher in glioblastomas than other glioma grades (P < .01 and P < .05 for the UL83 gene and protein, respectively). In addition, the association between the prevalence of HCMV and aging strengthened the virus reactivation hypothesis in gliomas. In conclusion, a high frequency of HCMV infection was found in gliomas that correlated with tumor aggressiveness and age. This study recommends a thorough investigation to determine HCMV infection in gliomas to improve the existing knowledge of its role in glial tumors, its prognostic value, and possible efficient antiviral target therapy.
Collapse
Affiliation(s)
- Faezeh Maleki
- Human Viral Vaccine Department, Razi Vaccine and Serum Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Karaj, Alborz Province, Iran
| | - Zohreh-Azita Sadigh
- Human Viral Vaccine Department, Razi Vaccine and Serum Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Karaj, Alborz Province, Iran
| | - Farzin Sadeghi
- Department of Microbiology, Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol, Iran
| | - Ahad Muhammadnejad
- Department of Molecular Genetics, Cancer Biology Research Center, Cancer Institute of Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran
| | - Mohammad Farahmand
- Department of Virology, School of Public Health, Tehran University of Medical Sciences, Tehran, Tehran Province, Iran
| | - Mahmoud Parvin
- Department of Pathology, Shahid Labbafinejad Medical Center, Shahid Beheshti University of Medical Sciences, Tehran, Tehran Province, Iran
| | - Reza Shirkoohi
- Department of Molecular Genetics, Cancer Biology Research Center, Cancer Institute of Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran.,Department of Molecular Genetics, Cancer Research Center, Cancer Institute of Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran
| |
Collapse
|
|
27
|
Mohebbi A, Mamizadeh Z, Bagheri H, Sharifnezhad F, Tabarraei A, Yazdi M. Prevalent latent human cytomegalovirus genotype b2 in biopsy samples of gastric cancer. Future Virol 2020. [DOI: 10.2217/fvl-2019-0117] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.2] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/19/2022]
Abstract
Aim: Genotyping and prevalence of human cytomegalovirus (HCMV) in gastrointestinal tract remains unclear. Objective: Characterization of HCMV and its viral load in samples of patients with gastric cancer (GC) in northeast Iran. Methods: A total of 21 biopsies were collected from patients with GC. HCMV was detected and genotyped using multiplex nested PCR. Quantitative real-time PCR has been used to determine the viral load. Staining was performed to detect viral inclusions. Results: 76.19% of the samples had HCMV genotypic b2 with viral load <0.1 IU/μl. 66.67% of patients were positive for H. pylori. Conclusion: Multiplex nested-PCR method can detect CMV populations with low viral loads in GC biopsies. For the first time, it was determined that the genotype b2 of HCMV is prevalent in the gastrointestinal tract.
Collapse
Affiliation(s)
- Alireza Mohebbi
- Stem Cell Research Center, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran
- Department of Microbiology, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran
| | - Zoleikha Mamizadeh
- Stem Cell Research Center, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran
| | - Hanieh Bagheri
- Department of Microbiology, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran
| | - Farzad Sharifnezhad
- Student Research Committee, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran
| | - Alijan Tabarraei
- Department of Microbiology, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran
| | - Mahsa Yazdi
- Department of Microbiology, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran
| |
Collapse
|
|
28
|
Agnarsdóttir M, Popova S, Alafuzoff I. Expression of CMV protein pp65 in cutaneous malignant melanoma. PLoS One 2019; 14:e0223854. [PMID: 31603931 PMCID: PMC6788690 DOI: 10.1371/journal.pone.0223854] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/10/2019] [Accepted: 09/30/2019] [Indexed: 11/23/2022] Open
Abstract
Human cytomegalovirus (CVM) has been detected by immunohistochemistry (IHC) in brain tumours; however, whether CMV antigen is seen in melanomas has not yet been elucidated. Applying IHC, melanoma tissue was assessed for the expression of pp65, a tegument protein of CMV. Two cohorts were available, cohort-I and II, the latter included also related metastasis. In addition to IHC, in situ hybridisation (ISH) was carried out to assess whether CMV related genetic sequences were detectable in a subset of cases. Seventy per cent of the 142 cases in cohort-I and 50% of the 37 cases in cohort-II displayed immunoreactivity (IR). In both cohorts, the IHC outcome correlated with T-stage (Cohort I: Spearman 0.22, p = 0.01, Cohort II: Fisher exact text 0.04). In 30 of cohort-II cases, when IHC staining was carried out on both the primary tumour and the corresponding metastasis, no change in IR was noted in 53%; in 20%, the IR was lower and in 27% higher in the metastasis when compared with the primary tumour. These results were significant (Fisher exact test 0.03). Applying ISH technique on four tumour cases with detectable pp65 protein, CMV related genetic sequence was not detected. Here, we demonstrate, congruent with observations published for brain tumours, that the protein pp65 is indeed observed in substantial number of melanoma cases with IHC; however, no signal was detected with ISH technique. These findings are in line with previously reported studies, demonstrating that the role of CMV in tumours is still debatable.
Collapse
Affiliation(s)
- Margrét Agnarsdóttir
- Department of Immunology, Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Uppsala, Sweden
- Department of Clinical Pathology, Akademiska University Hospital, Uppsala, Sweden
| | - Svetlana Popova
- Department of Immunology, Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Uppsala, Sweden
- Department of Clinical Pathology, Akademiska University Hospital, Uppsala, Sweden
| | - Irina Alafuzoff
- Department of Immunology, Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Uppsala, Sweden
- Department of Clinical Pathology, Akademiska University Hospital, Uppsala, Sweden
| |
Collapse
|
|
29
|
Blaylock RL. Accelerated cancer aggressiveness by viral oncomodulation: New targets and newer natural treatments for cancer control and treatment. Surg Neurol Int 2019; 10:199. [PMID: 31768279 PMCID: PMC6826277 DOI: 10.25259/sni_361_2019] [Citation(s) in RCA: 6] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/17/2019] [Accepted: 06/19/2019] [Indexed: 12/12/2022] Open
Abstract
An infectious etiology for a number of cancers has been entertained for over 100 years and modern studies have confirmed that a number of viruses are linked to cancer induction. While a large number of viruses have been demonstrated in a number of types of cancers, most such findings have been dismissed in the past as opportunistic infections, especially with persistent viruses with high rates of infectivity of the world’s populations. More recent studies have clearly shown that while not definitely causing these cancers, these viruses appear capable of affecting the biology of these tumors in such a way as to make them more aggressive and more resistant to conventional treatments. The term oncomodulatory viruses has been used to describe this phenomenon. A number of recent studies have shown a growing number of ways these oncomodulatory viruses can alter the pathology of these tumors by affecting cell-signaling, cell metabolism, apoptosis mechanisms, cell-cell communication, inflammation, antitumor immunity suppression, and angiogenesis. We are also learning that much of the behavior of tumors depends on cancer stem cells and stromal cells within the tumor microenvironment, which participate in extensive, dynamic crosstalk known to affect tumor behavior. Cancer stem cells have been found to be particularly susceptible to infection by human cytomegalovirus. In a number of studies, it has been shown that while only a select number of cells are actually infected with the virus, numerous viral proteins are released into cancer and stromal cells in the microenvironment and these viral proteins are known to affect tumor behavior and aggressiveness.
Collapse
|
|
30
|
Foster H, Piper K, DePledge L, Li HF, Scanlan J, Jae-Guen Y, Boeckh M, Cobbs C. Human cytomegalovirus seropositivity is associated with decreased survival in glioblastoma patients. Neurooncol Adv 2019; 1:vdz020. [PMID: 32642656 PMCID: PMC7212888 DOI: 10.1093/noajnl/vdz020] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/26/2022] Open
Abstract
Background Human cytomegalovirus (HCMV) is an oncomodulatory human herpesvirus that has been detected in glioblastoma (GBM) and is associated with worse prognosis in patients with the disease. The effects of HCMV systemic infection on survival in GBM patients, however, are largely unknown. We aimed to determine the association between HCMV serostatus at diagnosis and survival via a retrospective cohort study of GBM patients. Methods Plasma from 188 GBM patients treated at the Ben and Catherine Ivy Center (Seattle, WA) was tested for HCMV serostatus via enzyme-linked immunosorbent assays of anti-HCMV immunoglobulin (Ig)G. HCMV IgG serostatus was analyzed with respect to each patient’s progression-free and overall survival (OS) via log-rank and multivariable Cox regression analysis. Results Ninety-seven of 188 (52%) patients were anti-HCMV IgG seropositive. Median OS was decreased in the IgG+ cohort (404 days) compared to IgG− patients (530 days; P = .0271). Among O6-methylguanine-DNA methyltransferase (MGMT) unmethylated patients (n = 96), median OS was significantly decreased in IgG+ patients (336 days) compared to IgG− patients (510 days; P = .0094). MGMT methylation was associated with improved OS in IgG+ patients versus those who were unmethylated (680 vs 336 days; P = .0096), whereas no such association was observed among IgG− patients. Conclusions In this study, HCMV seropositivity was significantly associated with poorer OS in GBM patients. This finding suggests prior infection with HCMV may play an important role in GBM patient outcomes, and anti-HCMV antibodies may, therefore, prove a valuable prognostic tool in the management of GBM patients.
Collapse
Affiliation(s)
- Haidn Foster
- Ben and Catherine Ivy Center for Advanced Brain Tumor Treatment, Swedish Neuroscience Institute, Seattle, Washington.,University of Cincinnati College of Medicine, Cincinnati, Ohio
| | - Keenan Piper
- Ben and Catherine Ivy Center for Advanced Brain Tumor Treatment, Swedish Neuroscience Institute, Seattle, Washington
| | - Lisa DePledge
- Ben and Catherine Ivy Center for Advanced Brain Tumor Treatment, Swedish Neuroscience Institute, Seattle, Washington
| | - Hsin-Fang Li
- Medical Data Research Center, Providence St. Joseph Health, Portland, Oregon
| | - James Scanlan
- Swedish Center for Research and Innovation, Seattle, Washington
| | - Yoon Jae-Guen
- Ben and Catherine Ivy Center for Advanced Brain Tumor Treatment, Swedish Neuroscience Institute, Seattle, Washington
| | - Michael Boeckh
- Vaccine and Infectious Disease Division, Fred Hutchinson Cancer Research Center, Seattle, Washington.,Department of Medicine, University of Washington, Seattle, Washington
| | - Charles Cobbs
- Ben and Catherine Ivy Center for Advanced Brain Tumor Treatment, Swedish Neuroscience Institute, Seattle, Washington
| |
Collapse
|
|
31
|
Ding D, Zhao A, Sun Z, Zuo L, Wu A, Sun J. Is the presence of HCMV components in CNS tumors a glioma-specific phenomenon? Virol J 2019; 16:96. [PMID: 31370833 PMCID: PMC6670132 DOI: 10.1186/s12985-019-1198-5] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/27/2019] [Accepted: 07/17/2019] [Indexed: 11/11/2022] Open
Abstract
Background Human cytomegalovirus (HCMV) has been associated with malignant gliomas. The purpose of the present study was to investigate the presence of HCMV in common non-glial tumors of the central nervous system (CNS) and to determine whether it is a glioma-specific phenomenon. Methods Using HCMV-specific immunohistochemical staining, HCMV proteins IE1–72 and pp65 were examined in 65 meningiomas (benign, atypical and malignant), 45 pituitary adenomas, 20 cavernous hemangiomas, and 30 metastatic carcinomas specimens. HCMV DNA was also measured in these tumor tissues and the peripheral blood from patients using nested PCR. Results In meningioma, IE1–72 was detected in 3.1% (2/65) and pp65 was detected in 4.6% (3/65), whereas no IE1–72 and pp65 were detected in atypical and malignant meningioma. A low level of IE1–72 immunoreactivity 6.7% (2/30) was detected in metastatic carcinoma; pp65 was not detected. No HCMV components were detected in pituitary adenoma and cavernous hemangioma. The results of immunohistochemical staining were confirmed by HCMV-specific PCR. HCMV DNA was not detected in the peripheral blood of the non-glial CNS tumors patients. Conclusions Our results demonstrate that the presence of HCMV components is not an entirely glioma-specific phenomenon, and that HCMV is present in a low percentage in some non-glioma CNS tumors. Comparing HCMV-positive non-glial CNS tumors with HCMV-positive gliomas may cast light on the mechanism and role of HCMV in CNS tumors. Electronic supplementary material The online version of this article (10.1186/s12985-019-1198-5) contains supplementary material, which is available to authorized users.
Collapse
Affiliation(s)
- Daling Ding
- Department of Neurosurgery, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, 450052, Henan, China
| | - Ailing Zhao
- Department of Infant Ward, Children's Hospital Affiliated of Zhengzhou University, Zhengzhou, 450052, China
| | - Zhi Sun
- Department of Pharmacy, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, 450052, China
| | - Lihua Zuo
- Department of Pharmacy, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, 450052, China
| | - Anhua Wu
- Department of Neurosurgery, The First Affiliated Hospital of China Medical University, Shenyang, 110001, China
| | - Jianrui Sun
- Department of Neurosurgery, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, 450052, Henan, China.
| |
Collapse
|
|
32
|
Nauclér CS, Geisler J, Vetvik K. The emerging role of human cytomegalovirus infection in human carcinogenesis: a review of current evidence and potential therapeutic implications. Oncotarget 2019; 10:4333-4347. [PMID: 31303966 PMCID: PMC6611507 DOI: 10.18632/oncotarget.27016] [Citation(s) in RCA: 50] [Impact Index Per Article: 8.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/20/2019] [Accepted: 05/29/2019] [Indexed: 12/12/2022] Open
Abstract
It is well-established that infections with viruses harboring oncogenic potential increase the cancer risk. Virus induced oncogenic processes are influenced by a complex and unique combination of host and environmental risk factors that are currently not fully understood. Many of the oncogenic viruses exhibit a prolonged, asymptomatic latency after a primary infection, and cause cancer in only a minority of carriers. From an epidemiologic point of view, it is therefore difficult to determine their role in cancer development. However, recent evidence suggests a neoplastic potential of one additional ubiquitous virus; human Cytomegalovirus (HCMV). Emerging data presents HCMV as a plausible cancer-causing virus by demonstrating its presence in >90% of common tumor types, while being absent in normal tissue surrounding the tumor. HCMV targets many cell types in tumor tissues, and can cause all the ten proposed hallmarks of cancer. This virus exhibits cellular tumor-promoting and immune-evasive strategies, hijacks proangiogenic and anti-apoptotic mechanisms and induces immunosuppressive effects in the tumor micro-environment. Recognizing new cancer-causing mechanisms may increase the therapeutic potential and prophylactic options for virus associated cancer forms. Such approaches could limit viral spread, and promote anti-viral and immune controlling strategies if given as add on to standard therapy to potentially improve the prognosis of cancer patients. This review will focus on HCMV-related onco-viral mechanisms and the potential of HCMV as a new therapeutic target in HCMV positive cancer forms.
Collapse
Affiliation(s)
- Cecilia Söderberg Nauclér
- Department of Medicine, Unit of Microbial Pathogenesis, Center for Molecular Medicine, Karolinska Institutet, Solna, Stockholm, Sweden
| | - Jürgen Geisler
- Department of Oncology, Akershus University Hospital (AHUS), Lørenskog, Norway.,Institute of Clinical Medicine, University of Oslo, Oslo, Norway
| | - Katja Vetvik
- Institute of Clinical Medicine, University of Oslo, Oslo, Norway.,Department of Breast and Endocrine Surgery, AHUS, Lørenskog, Norway
| |
Collapse
|
|
33
|
De Groof TWM, Mashayekhi V, Fan TS, Bergkamp ND, Sastre Toraño J, van Senten JR, Heukers R, Smit MJ, Oliveira S. Nanobody-Targeted Photodynamic Therapy Selectively Kills Viral GPCR-Expressing Glioblastoma Cells. Mol Pharm 2019; 16:3145-3156. [PMID: 31244224 PMCID: PMC6728091 DOI: 10.1021/acs.molpharmaceut.9b00360] [Citation(s) in RCA: 55] [Impact Index Per Article: 9.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/10/2023]
Abstract
![]()
Photodynamic
therapy (PDT) eradicates tumors by the local activation
of a photosensitizer with near-infrared light. One of the aspects
hampering the clinical use of PDT is the poor selectivity of the photosensitizer.
To improve this, we have recently introduced a new approach for targeted
PDT by conjugating photosensitizers to nanobodies. Diverse G protein-coupled
receptors (GPCRs) show aberrant overexpression in tumors and are therefore
interesting targets in cancer therapy. Here we show that GPCR-targeting
nanobodies can be used in targeted PDT. We have developed a nanobody
binding the extracellular side of the viral GPCR US28, which is detected
in tumors like glioblastoma. The nanobody was site-directionally conjugated
to the water-soluble photosensitizer IRDye700DX. This nanobody–photosensitizer
conjugate selectively killed US28-expressing glioblastoma cells both
in 2D and 3D cultures upon illumination with near-infrared light.
This is the first example employing a GPCR as target for nanobody-directed
PDT. With the emerging role of GPCRs in cancer, this data provides
a new angle for exploiting this large family of receptors for targeted
therapies.
Collapse
Affiliation(s)
- Timo W M De Groof
- Division of Medicinal Chemistry, Amsterdam Institute for Molecules Medicines and Systems (AIMMS) , Vrije Universiteit Amsterdam , De Boelelaan 1108 , 1081 HZ Amsterdam , The Netherlands
| | - Vida Mashayekhi
- Division of Cell Biology, Department of Biology , Utrecht University , 3584 CH Utrecht , The Netherlands
| | - Tian Shu Fan
- Division of Medicinal Chemistry, Amsterdam Institute for Molecules Medicines and Systems (AIMMS) , Vrije Universiteit Amsterdam , De Boelelaan 1108 , 1081 HZ Amsterdam , The Netherlands
| | - Nick D Bergkamp
- Division of Medicinal Chemistry, Amsterdam Institute for Molecules Medicines and Systems (AIMMS) , Vrije Universiteit Amsterdam , De Boelelaan 1108 , 1081 HZ Amsterdam , The Netherlands
| | - Javier Sastre Toraño
- Chemical Biology and Drug Discovery, Department of Pharmaceutical Sciences , Utrecht University , 3584 CG Utrecht , The Netherlands
| | - Jeffrey R van Senten
- Division of Medicinal Chemistry, Amsterdam Institute for Molecules Medicines and Systems (AIMMS) , Vrije Universiteit Amsterdam , De Boelelaan 1108 , 1081 HZ Amsterdam , The Netherlands
| | - Raimond Heukers
- Division of Medicinal Chemistry, Amsterdam Institute for Molecules Medicines and Systems (AIMMS) , Vrije Universiteit Amsterdam , De Boelelaan 1108 , 1081 HZ Amsterdam , The Netherlands.,QVQ B.V. , Yalelaan 1 , 3484 CL Utrecht , The Netherlands
| | - Martine J Smit
- Division of Medicinal Chemistry, Amsterdam Institute for Molecules Medicines and Systems (AIMMS) , Vrije Universiteit Amsterdam , De Boelelaan 1108 , 1081 HZ Amsterdam , The Netherlands
| | - Sabrina Oliveira
- Division of Cell Biology, Department of Biology , Utrecht University , 3584 CH Utrecht , The Netherlands.,Pharmaceutics, Department of Pharmaceutical Sciences , Utrecht University , 3584 CG Utrecht , The Netherlands
| |
Collapse
|
|
34
|
Das P, Hasan MH, Mitra D, Bollavarapu R, Valente EJ, Tandon R, Raucher D, Hamme AT. Design, Synthesis, and Preliminary Studies of Spiro-isoxazoline-peroxides against Human Cytomegalovirus and Glioblastoma ∥. J Org Chem 2019; 84:6992-7006. [PMID: 31066280 DOI: 10.1021/acs.joc.9b00746] [Citation(s) in RCA: 11] [Impact Index Per Article: 1.8] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/27/2023]
Abstract
The association between glioblastoma (GBM) and human cytomegalovirus (HCMV) infection has been the intensely debated topic over the decades for developing new therapeutic options. In this regard, the peroxides from natural and synthetic sources served as potential antiviral and anticancer agents in the past. Herein, a concise and efficient strategy has been demonstrated to access a novel class of peroxides containing a spiro-isoxazoline to primarily investigate the biological activities. The synthetic compounds were evaluated for in vitro antiviral and antiproliferative activity against HCMV and glioblastoma cell line (GBM6), respectively. While compound 13m showed moderate anti-CMV activity (IC50 = 19 μM), surprisingly, an independent biological assay for compound 13m revealed its antiproliferative activity against the human glioblastoma cell line (GBM6) with an IC50 of 10 μM. Hence, the unification of an isoxazoline and peroxide heterocycles could be a potential direction to initiate the HCMV-GBM drug discovery program.
Collapse
Affiliation(s)
- Prasanta Das
- Department of Chemistry and Biochemistry , Jackson State University , Jackson , Mississippi 39217 , United States
| | | | | | | | - Edward J Valente
- Department of Chemistry , University of Portland , Portland , Oregon 97203 , United States
| | | | | | - Ashton T Hamme
- Department of Chemistry and Biochemistry , Jackson State University , Jackson , Mississippi 39217 , United States
| |
Collapse
|
|
35
|
A Characterization of Dendritic Cells and Their Role in Immunotherapy in Glioblastoma: From Preclinical Studies to Clinical Trials. Cancers (Basel) 2019; 11:cancers11040537. [PMID: 30991681 PMCID: PMC6521200 DOI: 10.3390/cancers11040537] [Citation(s) in RCA: 72] [Impact Index Per Article: 12.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/20/2019] [Revised: 04/08/2019] [Accepted: 04/12/2019] [Indexed: 12/25/2022] Open
Abstract
Glioblastoma (GBM) is the most common and fatal primary central nervous system malignancy in adults with a median survival of less than 15 months. Surgery, radiation, and chemotherapy are the standard of care and provide modest benefits in survival, but tumor recurrence is inevitable. The poor prognosis of GBM has made the development of novel therapies targeting GBM of paramount importance. Immunotherapy via dendritic cells (DCs) has garnered attention and research as a potential strategy to boost anti-tumor immunity in recent years. As the “professional” antigen processing and presenting cells, DCs play a key role in the initiation of anti-tumor immune responses. Pre-clinical studies in GBM have shown long-term tumor survival and immunological memory in murine models with stimulation of DC activity with various antigens and costimulatory molecules. Phase I and II clinical trials of DC vaccines in GBM have demonstrated some efficacy in improving the median overall survival with minimal to no toxicity with promising initial results from the first Phase III trial. However, there remains no standardization of vaccines in terms of which antigens are used to pulse DCs ex vivo, sites of DC injection, and optimal adjuvant therapies. Future work with DC vaccines aims to elucidate the efficacy of DC-based therapy alone or in combination with other immunotherapy adjuvants in additional Phase III trials.
Collapse
|
|
36
|
Evidence based on a meta-analysis of human cytomegalovirus infection in glioma. Arch Virol 2019; 164:1249-1257. [DOI: 10.1007/s00705-019-04206-z] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/11/2018] [Accepted: 02/13/2019] [Indexed: 12/16/2022]
|
|
37
|
Choi BD, Maus MV, June CH, Sampson JH. Immunotherapy for Glioblastoma: Adoptive T-cell Strategies. Clin Cancer Res 2018; 25:2042-2048. [PMID: 30446589 DOI: 10.1158/1078-0432.ccr-18-1625] [Citation(s) in RCA: 80] [Impact Index Per Article: 11.4] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/31/2018] [Revised: 10/16/2018] [Accepted: 11/12/2018] [Indexed: 12/11/2022]
Abstract
Glioblastoma (GBM) is a devastating disease with an extremely poor prognosis. Immunotherapy via adoptive cell transfer (ACT), especially with T cells engineered to express chimeric antigen receptors (CAR), represents a particularly promising approach. Despite the recent success of CAR T cells for blood cancers, the question remains whether this powerful anticancer therapy will ultimately work for brain tumors, and whether the primary immunologic challenges in this disease, which include antigenic heterogeneity, immune suppression, and T-cell exhaustion, can be adequately addressed. Here, we contextualize these concepts by reviewing recent developments in ACT for GBM, with a special focus on pioneering clinical trials of CAR T-cell therapy.
Collapse
Affiliation(s)
- Bryan D Choi
- Cellular Immunotherapy Program, Cancer Center, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts.,Department of Neurosurgery, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts
| | - Marcela V Maus
- Cellular Immunotherapy Program, Cancer Center, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts.,Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts
| | - Carl H June
- Center for Cellular Immunotherapies and Department of Pathology and Laboratory Medicine, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania
| | - John H Sampson
- Duke Brain Tumor Immunotherapy Program, Duke University Medical Center and Duke University, Durham, North Carolina. .,Departments of Neurosurgery, Pathology, and Biomedical Engineering, Duke University Medical Center and Duke University, Durham, North Carolina
| |
Collapse
|
|
38
|
Rahman M, Dastmalchi F, Karachi A, Mitchell D. The role of CMV in glioblastoma and implications for immunotherapeutic strategies. Oncoimmunology 2018; 8:e1514921. [PMID: 30546954 PMCID: PMC6287786 DOI: 10.1080/2162402x.2018.1514921] [Citation(s) in RCA: 40] [Impact Index Per Article: 5.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/24/2018] [Revised: 08/09/2018] [Accepted: 08/17/2018] [Indexed: 12/27/2022] Open
Abstract
Controversy surrounds the role of cytomegalovirus (CMV) in glioblastoma (GBM). However, several studies have shown that CMV nucleic acids and proteins are present within GBM tumor tissue. CMV has been implicated in GBM pathogenesis by affecting tumor stem cell factors, angiogenesis and immune pathways. Anti-viral therapy has not been found to definitively improve outcomes for patients with GBM. Several studies have leveraged CMV by targeting CMV antigens using ex-vivo expanded T cells or dendritic cell vaccines. The initial results from these studies are promising and larger studies are underway.
Collapse
Affiliation(s)
- Maryam Rahman
- Lillian S. Wells Department of Neurosurgery, UF Brain Tumor Immunotherapy Program, Preston A. Wells, Jr. Center for Brain Tumor Therapy, University of Florida, Gainesville, FL, USA
| | - Farhad Dastmalchi
- Lillian S. Wells Department of Neurosurgery, UF Brain Tumor Immunotherapy Program, Preston A. Wells, Jr. Center for Brain Tumor Therapy, University of Florida, Gainesville, FL, USA
| | - Aida Karachi
- Lillian S. Wells Department of Neurosurgery, UF Brain Tumor Immunotherapy Program, Preston A. Wells, Jr. Center for Brain Tumor Therapy, University of Florida, Gainesville, FL, USA
| | - Duane Mitchell
- Lillian S. Wells Department of Neurosurgery, UF Brain Tumor Immunotherapy Program, Preston A. Wells, Jr. Center for Brain Tumor Therapy, University of Florida, Gainesville, FL, USA
| |
Collapse
|
|
39
|
Krishna BA, Miller WE, O'Connor CM. US28: HCMV's Swiss Army Knife. Viruses 2018; 10:E445. [PMID: 30127279 PMCID: PMC6116241 DOI: 10.3390/v10080445] [Citation(s) in RCA: 43] [Impact Index Per Article: 6.1] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/06/2018] [Revised: 08/08/2018] [Accepted: 08/17/2018] [Indexed: 12/13/2022] Open
Abstract
US28 is one of four G protein coupled receptors (GPCRs) encoded by human cytomegalovirus (HCMV). The US28 protein (pUS28) is a potent signaling molecule that alters a variety of cellular pathways that ultimately alter the host cell environment. This viral GPCR is expressed not only in the context of lytic replication but also during viral latency, highlighting its multifunctional properties. pUS28 is a functional GPCR, and its manipulation of multiple signaling pathways likely impacts HCMV pathogenesis. Herein, we will discuss the impact of pUS28 on both lytic and latent infection, pUS28-mediated signaling and its downstream consequences, and the influence this viral GPCR may have on disease states, including cardiovascular disease and cancer. We will also discuss the potential for and progress towards exploiting pUS28 as a novel therapeutic to combat HCMV.
Collapse
Affiliation(s)
- Benjamin A Krishna
- Genomic Medicine, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195, USA.
| | - William E Miller
- Department of Molecular Genetics, Biochemistry, & Microbiology, University of Cincinnati, Cincinnati, OH 45267, USA.
| | - Christine M O'Connor
- Genomic Medicine, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195, USA.
| |
Collapse
|
|
40
|
Giles AJ, Hutchinson MKND, Sonnemann HM, Jung J, Fecci PE, Ratnam NM, Zhang W, Song H, Bailey R, Davis D, Reid CM, Park DM, Gilbert MR. Dexamethasone-induced immunosuppression: mechanisms and implications for immunotherapy. J Immunother Cancer 2018; 6:51. [PMID: 29891009 PMCID: PMC5996496 DOI: 10.1186/s40425-018-0371-5] [Citation(s) in RCA: 325] [Impact Index Per Article: 46.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/20/2018] [Accepted: 05/30/2018] [Indexed: 12/18/2022] Open
Abstract
Background Corticosteroids are routinely utilized to alleviate edema in patients with intracranial lesions and are first-line agents to combat immune-related adverse events (irAEs) that arise with immune checkpoint blockade treatment. However, it is not known if or when corticosteroids can be administered without abrogating the efforts of immunotherapy. The purpose of this study was to evaluate the impact of dexamethasone on lymphocyte activation and proliferation during checkpoint blockade to provide guidance for corticosteroid use while immunotherapy is being implemented as a cancer treatment. Methods Lymphocyte proliferation, differentiation, and cytokine production were evaluated during dexamethasone exposure. Human T cells were stimulated through CD3 ligation and co-stimulated either directly by CD28 ligation or by providing CD80, a shared ligand for CD28 and CTLA-4. CTLA-4 signaling was inhibited by antibody blockade using ipilimumab which has been approved for the treatment of several solid tumors. The in vivo effects of dexamethasone during checkpoint blockade were evaluated using the GL261 syngeneic mouse intracranial model, and immune populations were profiled by flow cytometry. Results Dexamethasone upregulated CTLA-4 mRNA and protein in CD4 and CD8 T cells and blocked CD28-mediated cell cycle entry and differentiation. Naïve T cells were most sensitive, leading to a decrease of the development of more differentiated subsets. Resistance to dexamethasone was conferred by blocking CTLA-4 or providing strong CD28 co-stimulation prior to dexamethasone exposure. CTLA-4 blockade increased IFNγ expression, but not IL-2, in stimulated human peripheral blood T cells exposed to dexamethasone. Finally, we found that CTLA-4 blockade partially rescued T cell numbers in mice bearing intracranial gliomas. CTLA-4 blockade was associated with increased IFNγ-producing tumor-infiltrating T cells and extended survival of dexamethasone-treated mice. Conclusions Dexamethasone-mediated T cell suppression diminishes naïve T cell proliferation and differentiation by attenuating the CD28 co-stimulatory pathway. However, CTLA-4, but not PD-1 blockade can partially prevent some of the inhibitory effects of dexamethasone on the immune response. Electronic supplementary material The online version of this article (10.1186/s40425-018-0371-5) contains supplementary material, which is available to authorized users.
Collapse
Affiliation(s)
- Amber J Giles
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA.
| | - Marsha-Kay N D Hutchinson
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Heather M Sonnemann
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Jinkyu Jung
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Peter E Fecci
- Department of Neurosurgery, Duke University Medical Center, Durham, NC, USA
| | - Nivedita M Ratnam
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Wei Zhang
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Hua Song
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Rolanda Bailey
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Dionne Davis
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Caitlin M Reid
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Deric M Park
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| | - Mark R Gilbert
- Neuro-Oncology Branch, CCR, NCI, National Institutes of Health, 37 Convent Dr. Bldg. 37, Rm. 1142B, Bethesda, MD, 20892, USA
| |
Collapse
|
|
41
|
Abstract
Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.
Collapse
|
|
42
|
Yang R, Liang J, Xu GX, Ding LM, Huang HM, Su QZ, Yan J, Li YC. Human cytomegalovirus glycoprotein B inhibits migration of breast cancer MDA-MB-231 cells and impairs TGF-β/Smad2/3 expression. Oncol Lett 2018; 15:7730-7738. [PMID: 29849800 PMCID: PMC5962863 DOI: 10.3892/ol.2018.8344] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/07/2017] [Accepted: 12/06/2017] [Indexed: 02/07/2023] Open
Abstract
Breast cancer is a leading cause of cancer-associated mortality in females worldwide and evidence suggests that human cytomegalovirus (HCMV) infection may be implicated in the progress of breast cancer. HCMV glycoprotein B (gB) is the most abundant envelope protein and serves an important role in host cell entry. The present study aimed to clarify the role of HCMV gB in breast cancer cells. A HCMV gB construct (UL55) was generated and stable vUL55 gene lentivirus-transfected MDA-MB-231 cells were established. Subsequently, the effect of HCMV gB on the apoptosis and proliferation of MDA-MB-231 cells was measured by flow cytometry and Cell Counting Kit-8 assay. Furthermore, whether HCMV gB may modulate MDA-MB-231 cell migration was examined using Transwell and cell scratch assays. In addition, alterations in HCMV gB-modulated protein levels of transforming growth factor-β (TGF-β) and Mothers against decapentaplegic homologs 2/3 (Smad2/3) were detected using western blot analysis. The results indicated that UL55 cDNA was stably transfected into MDA-MB-231 cells, and that HCMV gB protein was stably expressed. No significant differences in cell apoptosis and proliferation between transfected (231-GB-OE) and negative control (231-NC) cells were observed, while the rate of cell migration was significantly decreased in the 231-GB-OE cells compared with the 231-NC cells. Additionally, the expression level of TGF-β and phosphorylation level of Smad2/3 were also decreased in 231-GB-OE cells compared with the 231-NC cells. Although certain previous studies indicated that HCMV infection was associated with breast carcinogenesis, the results of the present study indicate that the envelope protein HCMV gB exhibits no effect on cell apoptosis and proliferation, but inhibits breast cancer cell migration. This may be due to downregulated TGF-β/Smad signaling. Taken together, these studies may assist in developing anti-TGF-β agents that contribute to tumor suppression.
Collapse
Affiliation(s)
- Rui Yang
- Department of Laboratory Medicine, Jinshan Hospital, Fudan University, Shanghai 201508, P.R. China
| | - Jie Liang
- Institute of Immunology, University of Heidelberg, Heidelberg D-69120, Germany
| | - Guo-Xiong Xu
- Center Laboratory, Jinshan Hospital, Fudan University, Shanghai 201508, P.R. China
| | - Liu-Mei Ding
- Department of Laboratory Medicine, Jinshan Hospital, Fudan University, Shanghai 201508, P.R. China
| | - Hong-Mei Huang
- Department of Laboratory Medicine, Jinshan Hospital, Fudan University, Shanghai 201508, P.R. China
| | - Qi-Zhu Su
- Department of Laboratory Medicine, Jinshan Hospital, Fudan University, Shanghai 201508, P.R. China
| | - Jing Yan
- Department of Laboratory Medicine, Jinshan Hospital, Fudan University, Shanghai 201508, P.R. China
| | - Yun-Chun Li
- Department of Laboratory Medicine, Jinshan Hospital, Fudan University, Shanghai 201508, P.R. China
| |
Collapse
|
|
43
|
Akhtar S, Vranic S, Cyprian FS, Al Moustafa AE. Epstein-Barr Virus in Gliomas: Cause, Association, or Artifact? Front Oncol 2018; 8:123. [PMID: 29732319 PMCID: PMC5919939 DOI: 10.3389/fonc.2018.00123] [Citation(s) in RCA: 38] [Impact Index Per Article: 5.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/15/2018] [Accepted: 04/04/2018] [Indexed: 12/17/2022] Open
Abstract
Gliomas are the most common malignant brain tumors and account for around 60% of all primary central nervous system cancers. Glioblastoma multiforme (GBM) is a grade IV glioma associated with a poor outcome despite recent advances in chemotherapy. The etiology of gliomas is unknown, but neurotropic viruses including the Epstein–Barr virus (EBV) that is transmitted via salivary and genital fluids have been implicated recently. EBV is a member of the gamma herpes simplex family of DNA viruses that is known to cause infectious mononucleosis (glandular fever) and is strongly linked with the oncogenesis of several cancers, including B-cell lymphomas, nasopharyngeal, and gastric carcinomas. The fact that EBV is thought to be the causative agent for primary central nervous system (CNS) lymphomas in immune-deficient patients has led to its investigations in other brain tumors including gliomas. Here, we provide a review of the clinical literature pertaining to EBV in gliomas and discuss the possibilities of this virus being simply associative, causative, or even an experimental artifact. We searched the PubMed/MEDLINE databases using the following key words such as: glioma(s), glioblastoma multiforme, brain tumors/cancers, EBV, and neurotropic viruses. Our literature analysis indicates conflicting results on the presence and role of EBV in gliomas. Further comprehensive studies are needed to fully implicate EBV in gliomagenesis and oncomodulation. Understanding the role of EBV and other oncoviruses in the etiology of gliomas, would likely open up new avenues for the treatment and management of these, often fatal, CNS tumors.
Collapse
Affiliation(s)
| | - Semir Vranic
- College of Medicine, Qatar University, Doha, Qatar
| | | | - Ala-Eddin Al Moustafa
- College of Medicine, Qatar University, Doha, Qatar.,Biomedical Research Centre, Qatar University, Doha, Qatar.,Oncology Department, McGill University, Montreal, QC, Canada
| |
Collapse
|
|
44
|
Wen L, Qiu Y, Cheng S, Jiang X, Ma YP, Fang W, Wang W, Cui J, Ruan Q, Zhao F, Hu F, Luo MH. Serologic and viral genome prevalence of HSV, EBV, and HCMV among healthy adults in Wuhan, China. J Med Virol 2018; 90:571-581. [PMID: 29091300 DOI: 10.1002/jmv.24989] [Citation(s) in RCA: 12] [Impact Index Per Article: 1.7] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/12/2017] [Accepted: 10/28/2017] [Indexed: 12/27/2022]
Abstract
The worldwide infection rate of herpesvirus is high, but the detailed prevalence in China, especially the central area, remains unclear. In the present study, the prevalence of herpes simplex virus (HSV), Epstein-Barr virus (EBV), and human cytomegalovirus (HCMV) was investigated in 303 healthy adults in Wuhan, a representative city in Central China. Viral-specific IgG and IgM titers were examined in the serum by chemiluminescent immunoassay, and the existence of viral genomic DNA in blood cells was determined by nested PCR. The overall IgG seroprevalences were 81.5%, 95.4%, and 93.7% for HSV, EBV, and HCMV, while the corresponding IgM seroprevalences were only 6.3%, 2.3%, and 0. The viral genomic DNA of HSV, EBV, and HCMV was identified in the blood samples of 5.9%, 14.2%, and 22.8% of the tested donors, respectively. Significantly, less HSV IgM-positive samples were found in the population over 20 years old than below 20 group; female displayed higher chances for HSV IgG and genome positivity; and occupations such as waiters and medical staffs were shown to be with higher risk for HCMV genome positivity. This study provided useful reference data for the HSV, EBV, and HCMV prevalence in central China, and suggested the potential importance of detecting viral genome to complement serum test data.
Collapse
Affiliation(s)
- Le Wen
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology (CEBSIT), Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
- University of Chinese Academy of Sciences, Beijing, China
| | - Yong Qiu
- Wuhan Brain Hospital, Ministry of Transportation, Wuhan, China
| | - Shuang Cheng
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology (CEBSIT), Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
| | - Xuan Jiang
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology (CEBSIT), Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
- Guangzhou Institute of Pediatrics, Guangzhou Women and Children Medical Center, Guangzhou, China
| | - Yan-Ping Ma
- Virus Laboratory, The Affiliated Shengjing Hospital, China Medical University, Shenyang, China
| | - Wei Fang
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology (CEBSIT), Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
| | - Wei Wang
- The Third Xiangya Hospital, South Central University, Changsha, China
| | - Jie Cui
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology (CEBSIT), Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
| | - Qiang Ruan
- Virus Laboratory, The Affiliated Shengjing Hospital, China Medical University, Shenyang, China
| | - Fei Zhao
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology (CEBSIT), Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
| | - Fei Hu
- Wuhan Brain Hospital, Ministry of Transportation, Wuhan, China
| | - Min-Hua Luo
- State Key Laboratory of Virology, CAS Center for Excellence in Brain Science and Intelligence Technology (CEBSIT), Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
- University of Chinese Academy of Sciences, Beijing, China
- Guangzhou Institute of Pediatrics, Guangzhou Women and Children Medical Center, Guangzhou, China
| |
Collapse
|
|
45
|
Bai B, Wang X, Chen E, Zhu H. Human cytomegalovirus infection and colorectal cancer risk: a meta-analysis. Oncotarget 2018; 7:76735-76742. [PMID: 27732934 PMCID: PMC5363545 DOI: 10.18632/oncotarget.12523] [Citation(s) in RCA: 40] [Impact Index Per Article: 5.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/10/2016] [Accepted: 10/03/2016] [Indexed: 12/16/2022] Open
Abstract
Human cytomegalovirus infection (HCMV) has been recently considered as a factor for tumorigenesis. The current study used meta-analytical techniques to explore the prevalence of HCMV in tumor tissues and the relationship between human cytomegalovirus and colorectal cancer (CRC) risk. 11 studies detecting HCMV DNA in tumor tissues were included in meta-analysis. The prevalence rate and odds ratio (OR) were two main parameters. The overall prevalence of human cytomegalovirus DNA in tumor tissues were 27.5% (95% CI = 17.2%−37.8%). Binary logistic regression showed that the studies reported before 2010 involving formalin-fixed specimens from patients in developed region represented a lower proportion of HCMV. The tumor tissues had a significantly higher rate of virus infection compared with normal tissues (OR = 6.59, 95% CI = 4.48−9.69, I2 = 0%, P = 0.71). Subgroup analysis revealed the prevalence of the virus didn't differ in patients with different tumor stages, in tumor cells with different histologic grades, also in different kinds of specimen (polyp and adenocarcinoma). The results of current study suggested a statistically association between the virus infection and an increased risk of colorectal cancer.
Collapse
Affiliation(s)
- Bingjun Bai
- Department of Colorectal Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, China.,Key Laboratory of Biotherapy of Zhejiang province, Hangzhou, China
| | - Xingxing Wang
- Department of Colorectal Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, China.,Key Laboratory of Biotherapy of Zhejiang province, Hangzhou, China
| | - Engeng Chen
- Department of Colorectal Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, China.,Key Laboratory of Biotherapy of Zhejiang province, Hangzhou, China
| | - Hongbo Zhu
- Department of Colorectal Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, China.,Key Laboratory of Biotherapy of Zhejiang province, Hangzhou, China
| |
Collapse
|
|
46
|
Korbecki J, Gutowska I, Kojder I, Jeżewski D, Goschorska M, Łukomska A, Lubkowska A, Chlubek D, Baranowska-Bosiacka I. New extracellular factors in glioblastoma multiforme development: neurotensin, growth differentiation factor-15, sphingosine-1-phosphate and cytomegalovirus infection. Oncotarget 2018; 9:7219-7270. [PMID: 29467963 PMCID: PMC5805549 DOI: 10.18632/oncotarget.24102] [Citation(s) in RCA: 14] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/12/2017] [Accepted: 01/02/2018] [Indexed: 11/25/2022] Open
Abstract
Recent years have seen considerable progress in understanding the biochemistry of cancer. For example, more significance is now assigned to the tumor microenvironment, especially with regard to intercellular signaling in the tumor niche which depends on many factors secreted by tumor cells. In addition, great progress has been made in understanding the influence of factors such as neurotensin, growth differentiation factor-15 (GDF-15), sphingosine-1-phosphate (S1P), and infection with cytomegalovirus (CMV) on the 'hallmarks of cancer' in glioblastoma multiforme. Therefore, in the present work we describe the influence of these factors on the proliferation and apoptosis of neoplastic cells, cancer stem cells, angiogenesis, migration and invasion, and cancer immune evasion in a glioblastoma multiforme tumor. In particular, we discuss the effect of neurotensin, GDF-15, S1P (including the drug FTY720), and infection with CMV on tumor-associated macrophages (TAM), microglial cells, neutrophil and regulatory T cells (Treg), on the tumor microenvironment. In order to better understand the role of the aforementioned factors in tumoral processes, we outline the latest models of intratumoral heterogeneity in glioblastoma multiforme. Based on the most recent reports, we discuss the problems of multi-drug therapy in treating glioblastoma multiforme.
Collapse
Affiliation(s)
- Jan Korbecki
- Department of Biochemistry and Medical Chemistry, Pomeranian Medical University in Szczecin, 70-111 Szczecin, Poland.,Department of Biochemistry and Molecular Biology, Faculty of Health Sciences, University of Bielsko-Biała, 43-309 Bielsko-Biała, Poland
| | - Izabela Gutowska
- Department of Biochemistry and Human Nutrition, Pomeranian Medical University in Szczecin, 71-460 Szczecin, Poland
| | - Ireneusz Kojder
- Department of Applied Neurocognitivistics, Pomeranian Medical University in Szczecin, 71-252 Szczecin, Poland.,Department of Neurosurgery, Pomeranian Medical University in Szczecin, 71-252 Szczecin, Poland
| | - Dariusz Jeżewski
- Department of Applied Neurocognitivistics, Pomeranian Medical University in Szczecin, 71-252 Szczecin, Poland.,Department of Neurosurgery, Pomeranian Medical University in Szczecin, 71-252 Szczecin, Poland
| | - Marta Goschorska
- Department of Biochemistry and Medical Chemistry, Pomeranian Medical University in Szczecin, 70-111 Szczecin, Poland
| | - Agnieszka Łukomska
- Department of Biochemistry and Human Nutrition, Pomeranian Medical University in Szczecin, 71-460 Szczecin, Poland
| | - Anna Lubkowska
- Department of Functional Diagnostics and Physical Medicine, Pomeranian Medical University in Szczecin, 71-210 Szczecin, Poland
| | - Dariusz Chlubek
- Department of Biochemistry and Medical Chemistry, Pomeranian Medical University in Szczecin, 70-111 Szczecin, Poland
| | - Irena Baranowska-Bosiacka
- Department of Biochemistry and Medical Chemistry, Pomeranian Medical University in Szczecin, 70-111 Szczecin, Poland
| |
Collapse
|
|
47
|
Maxwell R, Luksik AS, Garzon-Muvdi T, Lim M. The Potential of Cellular- and Viral-Based Immunotherapies for Malignant Glioma-Dendritic Cell Vaccines, Adoptive Cell Transfer, and Oncolytic Viruses. Curr Neurol Neurosci Rep 2017; 17:50. [PMID: 28488122 DOI: 10.1007/s11910-017-0754-x] [Citation(s) in RCA: 9] [Impact Index Per Article: 1.1] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/18/2022]
Abstract
PURPOSE OF REVIEW Malignant gliomas, including glioblastoma and anaplastic astrocytoma, are the most frequent primary brain tumors and present with many treatment challenges. In this review, we discuss the potential of cellular- and viral-based immunotherapies in the treatment of malignant glioma, specifically focusing on dendritic cell vaccines, adoptive cell therapy, and oncolytic viruses. RECENT FINDINGS Diverse cellular- and viral-based strategies have been engineered and optimized to generate either a specific or broad antitumor immune response in malignant glioma. Due to their successes in the preclinical arena, many of these therapies have undergone phase I and II clinical testing. These early clinical trials have demonstrated the feasibility, safety, and efficacy of these immunotherapies. Dendritic cell vaccines, adoptive cell transfer, and oncolytic viruses may have a potential role in the treatment of malignant glioma. However, these modalities must be investigated in well-designed phase III trials to prove their efficacy.
Collapse
Affiliation(s)
- Russell Maxwell
- Department of Neurosurgery, Johns Hopkins University School of Medicine, 600 N. Wolfe Street, Neurosurgery - Phipps 123, Baltimore, MD, 21287, USA
| | - Andrew S Luksik
- Department of Neurosurgery, Johns Hopkins University School of Medicine, 600 N. Wolfe Street, Neurosurgery - Phipps 123, Baltimore, MD, 21287, USA
| | - Tomas Garzon-Muvdi
- Department of Neurosurgery, Johns Hopkins University School of Medicine, 600 N. Wolfe Street, Neurosurgery - Phipps 123, Baltimore, MD, 21287, USA
| | - Michael Lim
- Department of Neurosurgery, Johns Hopkins University School of Medicine, 600 N. Wolfe Street, Neurosurgery - Phipps 123, Baltimore, MD, 21287, USA.
| |
Collapse
|
|
48
|
Garcia-Martinez A, Alenda C, Irles E, Ochoa E, Quintanar T, Rodriguez-Lescure A, Soto JL, Barbera VM. Lack of cytomegalovirus detection in human glioma. Virol J 2017; 14:216. [PMID: 29116009 PMCID: PMC5678593 DOI: 10.1186/s12985-017-0885-3] [Citation(s) in RCA: 21] [Impact Index Per Article: 2.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/16/2017] [Accepted: 10/31/2017] [Indexed: 12/19/2022] Open
Abstract
Gliomas are the most common brain tumors and include a variety of histologic types and grades of malignancy. They arise from glial cells and represent approximately 70% of the primary brain tumors. According to the criteria of the World Health Organization (WHO), the majority of gliomas can be classified into four grades of malignancy (I-IV). Virus infection, especially by DNA viruses and retroviruses, which may cause insertion of viral DNA sequences into the host genome, often triggers the host defense mechanisms. Particularly, the DNA methylation machinery can be activated to cause the methylation of foreign movable viral sequences and, therefore, silence viral gene expression. Several studies have shown the presence of Human Cytomegalovirus (HCMV) in glioblastoma, suggesting that the virus may participate in tumor pathogenesis. But this relationship is controversial because many other studies did not detect HCMV in these tumors. This study aims to detect the presence of HCMV in several samples of human glioma (94 formalin-fixed, paraffin-embedded samples and 28 snap-frozen samples) by different sensitive techniques. We have been unable to detect HCMV DNA and proteins in glioma samples. Therefore, arguments used so far to conclude that HCMV is an oncomodulator virus in gliomas must be, in our view, seriously reconsidered.
Collapse
Affiliation(s)
- Araceli Garcia-Martinez
- Molecular Genetics Laboratory, Elche University General Hospital, Alicante Institute for Health and Biomedical Research (ISABIAL - FISABIO Foundation), Alicante, Spain
| | - Cristina Alenda
- Department of Pathology, Alicante University General Hospital, Alicante Institute for Health and Biomedical Research (ISABIAL - FISABIO Foundation), Alicante, Spain
| | - Esperanza Irles
- Molecular Genetics Laboratory, Elche University General Hospital, Alicante Institute for Health and Biomedical Research (ISABIAL - FISABIO Foundation), Alicante, Spain
| | - Enrique Ochoa
- Molecular Biopathology Unit, Provincial Hospital of Castellón, Castellón, Spain
| | - Teresa Quintanar
- Medical Oncology Department, Elche University General Hospital, Elche, Spain
| | | | - Jose L Soto
- Molecular Genetics Laboratory, Elche University General Hospital, Alicante Institute for Health and Biomedical Research (ISABIAL - FISABIO Foundation), Alicante, Spain
| | - Victor M Barbera
- Molecular Genetics Laboratory, Elche University General Hospital, Alicante Institute for Health and Biomedical Research (ISABIAL - FISABIO Foundation), Alicante, Spain.
| |
Collapse
|
|
49
|
Han S, Deng J, Wang Z, Liu H, Cheng W, Wu A. Decreased human leukocyte antigen A*02:01 frequency is associated with risk of glioma and existence of human cytomegalovirus: a case-control study in Northern China. Cancer Immunol Immunother 2017; 66:1265-1273. [PMID: 28523518 PMCID: PMC11028914 DOI: 10.1007/s00262-017-2018-7] [Citation(s) in RCA: 6] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/24/2016] [Accepted: 05/14/2017] [Indexed: 12/16/2022]
Abstract
BACKGROUND Human leukocyte antigens (HLAs) play an important role in host defense against viral infection and tumorigenesis. Human cytomegalovirus (HCMV) has been linked to glioma development. This study investigated the relationship between HLA distribution, presence of HCMV, and glioma development in a Han Chinese population. METHODS The study population included 150 glioma patients and 150 tumor-free brain injury control subjects (control-A) matched according to geography, ethnicity, age, and gender. HLA allele frequency was compared between the two groups using peripheral blood samples by PCR sequence-based typing. These data were also compared with HLA frequencies obtained from a Northern Chinese Han population database (control-B). HCMV DNA was detected in the peripheral blood of glioma patients and control group-A by nested PCR. The expression of HCMV proteins IE1-72 and pp65 in tumor tissues was evaluated by immunohistochemistry. RESULTS The frequency of HLA-A*02:01 was decreased in glioma patients as compared to control group-A and -B (P < 0.001 and P = 0.001, respectively). The age/sex-adjusted odds ratio for HLA-A*02:01 positivity vs. negativity was 0.392 (95% confidence interval 0.225-0.683). HCMV was more frequently detected in the peripheral blood and tumor tissue of HLA-A*02:01-negative glioma patients. HLA-A*02:01 and HCMV were not associated with overall survival. CONCLUSION There is a correlation between decreased HLA-A*0201 allele frequency and glioma susceptibility.
Collapse
Affiliation(s)
- Sheng Han
- Department of Neurosurgery, The First Hospital of China Medical University, Nanjing Street 155, Heping District, Shenyang, 110001, China
| | - Jian Deng
- Department of Neurosurgery, The First Hospital of China Medical University, Nanjing Street 155, Heping District, Shenyang, 110001, China
| | - Zixun Wang
- Department of Neurosurgery, The First Hospital of China Medical University, Nanjing Street 155, Heping District, Shenyang, 110001, China
| | - Huan Liu
- Department of Neurosurgery, The First Hospital of China Medical University, Nanjing Street 155, Heping District, Shenyang, 110001, China
| | - Wen Cheng
- Department of Neurosurgery, The First Hospital of China Medical University, Nanjing Street 155, Heping District, Shenyang, 110001, China
| | - Anhua Wu
- Department of Neurosurgery, The First Hospital of China Medical University, Nanjing Street 155, Heping District, Shenyang, 110001, China.
| |
Collapse
|
|
50
|
Human Cytomegalovirus-Infected Glioblastoma Cells Display Stem Cell-Like Phenotypes. mSphere 2017; 2:mSphere00137-17. [PMID: 28656174 PMCID: PMC5480031 DOI: 10.1128/msphere.00137-17] [Citation(s) in RCA: 13] [Impact Index Per Article: 1.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/23/2017] [Accepted: 06/07/2017] [Indexed: 12/27/2022] Open
Abstract
A role for HCMV in GBMs remains controversial for several reasons. Some studies find HCMV in GBM tumors, while others do not. Few cells within a GBM may harbor HCMV, making it unclear how the virus could be contributing to the tumor phenotype without infecting every cell. Finally, HCMV does not overtly transform cells in vitro. However, tumors induced by other viruses can be treated with antiviral remedies, and initial results indicate that this may be true for anti-HCMV therapies and GBMs. With such a poor prognosis for GBM patients, any potential new intervention deserves exploration. Our work here describes an evidence-based model for how HCMV could contribute to GBM biology while infecting very few cells and without transforming them. It also illuminates why anti-HCMV treatments may be beneficial to GBM patients. Our observations provide blueprints for future in vitro studies examining how HCMV manipulates stem cell-specific pathways and future clinical studies of anti-HCMV measures as GBM therapeutics. Glioblastoma multiforme (GBM) is the most common brain tumor in adults. Human cytomegalovirus (HCMV) genomes are present in GBM tumors, yielding hope that antiviral treatments could prove therapeutic and improve the poor prognosis of GBM patients. We discovered that GBM cells infected in vitro with HCMV display properties of cancer stem cells. HCMV-infected GBM cells grow more slowly than mock-infected controls, demonstrate a higher capacity for self-renewal determined by a sphere formation assay, and display resistance to the chemotherapeutic drug temozolomide. Our data suggest that HCMV, while present in only a minority of the cells within a tumor, could contribute to the pathogenesis of GBMs by promoting or prolonging stem cell-like phenotypes, thereby perpetuating tumors in the face of chemotherapy. Importantly, we show that temozolomide sensitivity is restored by the antiviral drug ganciclovir, indicating a potential mechanism underlying the positive effects observed in GBM patients treated with antiviral therapy. IMPORTANCE A role for HCMV in GBMs remains controversial for several reasons. Some studies find HCMV in GBM tumors, while others do not. Few cells within a GBM may harbor HCMV, making it unclear how the virus could be contributing to the tumor phenotype without infecting every cell. Finally, HCMV does not overtly transform cells in vitro. However, tumors induced by other viruses can be treated with antiviral remedies, and initial results indicate that this may be true for anti-HCMV therapies and GBMs. With such a poor prognosis for GBM patients, any potential new intervention deserves exploration. Our work here describes an evidence-based model for how HCMV could contribute to GBM biology while infecting very few cells and without transforming them. It also illuminates why anti-HCMV treatments may be beneficial to GBM patients. Our observations provide blueprints for future in vitro studies examining how HCMV manipulates stem cell-specific pathways and future clinical studies of anti-HCMV measures as GBM therapeutics.
Collapse
|