RAD51 135G>C genetic polymorphism and the risk of prostate cancer

doi:10.5528/wjtm.124005

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 12, Issue 3

This Article

(0)

(4)

Peer-Review Report of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Journal Information of This Article

Publication Name

World Journal of Translational Medicine

ISSN

2220-6132

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Observational Study

Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.

World J Transl Med. Sep 28, 2026; 12(3): 124005
Published online Sep 28, 2026. doi: 10.5528/wjtm.124005

Table 2 Details of polymerase chain reaction-restriction fragment length polymorphism of the studied single nucleotide polymorphism

SNP	Primer sequences	Annealing temperature (°C)	Product size (bp)	Enzyme	Genotype	Fragment sizes (bp)
Rs1801320	(F)5’TGGGAACTGCAACTCATCTGG3’, (R)5’GCGCTCCTCTCTCCAGCAG3’	65	157	BstNI	GG	7186
					GC	7186157
					CC	157

SNP: Single nucleotide polymorphism.

Full Size Table

Citation: Pal S, Dahiya K, Dhankhar K, Atri R, Dhankhar R, Maheswari S, Kumar H, Chauhan A, Gaur S. RAD51 135G>C genetic polymorphism and the risk of prostate cancer. World J Transl Med 2026; 12(3): 124005
URL: https://www.wjgnet.com/2220-6132/full/v12/i3/124005.htm
DOI: https://dx.doi.org/10.5528/wjtm.124005

Pal S, Dahiya K, Dhankhar K, Atri R, Dhankhar R, Maheswari S, Kumar H, Chauhan A, Gaur S. RAD51 135G>C genetic polymorphism and the risk of prostate cancer. World J Transl Med 2026; 12(3): 124005 [DOI: 10.5528/wjtm.124005]

All content on this site: Copyright © 1993-2026 Baishideng Publishing Group Inc, its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply.