Toll-like receptor 9 polymorphisms and Helicobacter pylori influence gene expression and risk of gastric carcinogenesis in the Brazilian population.

doi:10.4251/wjgo.v11.i11.998

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 11, Issue 11

This Article

Academic Content and Language Evaluation of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (4543)

All Articles published online

The chart showing PDF series, WORD series, HTML series, Figures (1-3) series, Tables (1-6) series.

Item

Count

PDF

196

WORD

210

HTML

1767

Figures (1-3)

242

Tables (1-6)

178

Sum=2593

Publishing Process of This Article

The chart showing Browse series, Download series.

Item

Count

Browse

811

Download

1139

Sum=1950

Nov 15, 2019 (publication date) through May 12, 2024

Times Cited of This Article

Times Cited (7)

Journal Information of This Article

Publication Name

World Journal of Gastrointestinal Oncology

ISSN

1948-5204

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Case Control Study

World J Gastrointest Oncol. Nov 15, 2019; 11(11): 998-1010
Published online Nov 15, 2019. doi: 10.4251/wjgo.v11.i11.998

Table 1 Nucleotide primer sequences, polymerase chain reaction conditions and minor allele frequency for polymorphisms TLR9-1237 T/C (rs5743836) and -1486 T/C (rs187084)

Genes	Location	MAF	Primers, 5’-3’	Cycles	T melting	Enzyme	Genotypes, bp
TLR9-1237 T/C (rs5743836)	Chromosome 3: 52226766 (intron variant)	0.1725 (C)	F: TGGGAGCAGAGACATAATGGA	35	60 °C	BstNI	CC = 60 + 48 + 27
			R: CTGCTTGCAGTTGACTGTGT				CT = 108 + 60 + 48 + 27
			R: CTGCTTGCAGTTGACTGTGT				TT = 108 + 27
TLR9-1486 C/T (rs187084)	Chromosome 3: 52227015 (intron variant)	0.3776 (C)	F: TCCCAGCAGCAACAATTCATTA	30	60 °C	AflII	CC = 499
			R: CTGCTTGCAGTTGACTGTGT				TC = 499 + 327 + 172
			R: CTGCTTGCAGTTGACTGTGT				TT = 327 + 172

Minor allele frequency was extracted from 1000 Genomes Project Phase 3. MAF: Minor allele frequency.

Table 2 Genotype and allele frequencies of TLR9-1237 T/C and TLR9-1486 C/T SNPs in both case and control groups (GC vs C, CG vs C, and GC vs CG)

Polymorp-hisms	Models	Genotypes/ Alleles	C, n = 200	Cases
Polymorp-hisms	Models	Genotypes/ Alleles	C, n = 200	GC, n = 161	OR (95%CI), P value		CG, n = 248	OR (95%CI), P value
TLR9-1237 T/C (rs5743836)	Dominant	TT	148 (74%)	78 (48.5%)	1.00		188 (75.8%)	1.00
	Dominant	TC + CC	52 (26%)	83 (51.5%)	3.03 (1.95-4.71), < 0.0001		60 (24.2%)	0.91 (0.59-1.40), 0.6600
	Recessive	TT + TC	188 (94%)	122 (75.8%)	1.00		232 (93.5%)	1.00
	Recessive	CC	12 (6%)	39 (24.2%)	5.01 (2.52-9.94), < 0.0001		16 (6.5%)	1.08 (0.50-2.34), 0.8400
	Log-additive				2.37 (1.74-3.23), < 0.0001			0.96 (0.70-1.32), 0.8100
	Alleles	T	336 (0.84)	200 (0.62)	1.00		420 (0.85)	1.00
	Alleles	C	64 (0.16)	122 (0.38)	3.20 (2.25-4.54), < 0.0001		76 (0.15)	0.95 (0.66-1.36), 0.7822
GC vs CG	Dominant			3.46 (2.23-5.37), < 0.0001
OR (95%CI), P	Recessive			4.63 (2.44-8.79), < 0.0001
	Log-additive			2.46 (1.82-3.34), < 0.0001
	Alleles			3.37 (2.41-4.70), < 0.0001
TLR9-1486 C/T (rs187084)	Dominant	CC	58 (29%)	21 (13%)		1.00	46 (18.6%)	1.00
	Dominant	CT + TT	142 (71%)	140 (87%)		2.72 (1.57-4.72), < 0.0001	202 (81.5%)	1.79 (1.15-2.79), 0.0094
	Recessive	CC + CT	164 (82%)	122 (75.8%)		1.00	182 (73.4%)	1.00
	Recessive	TT	36 (18%)	39 (24.2%)		1.46 (0.87-2.43), 0.1500	66 (26.6%)	1.65 (1.05-2.61), 0.0300
	Log-additive					1.70 (1.23-2.37), 0.0013		1.52 (1.15-2.02), 0.0030
	Alleles	C	222 (0.56)	143 (0.44)		1.00	228 (0.46)	1.00
	Alleles	T	178 (0.44)	179 (0.56)		1.56 (1.16-2.09), 0.0035	268 (0.54)	1.46 (1.12-1.91), 0.0048
GC vs CG	Dominant			1.15 (0.72-1.84), 0.5700
OR (95%CI), P	Recessive			0.69 (0.39-1.24), 0.2100
	Log-additive			0.95 (0.69-1.31), 0.7500
	Alleles			0.93 (0.70-1.24), 0.6670

C: Control; OR: Odds ratio; CI: Confidence interval; GC: Gastric cancer; CG: Chronic gastritis.

Table 3 Haplotype frequency distribution of TLR9 polymorphisms between GC, CG and control groups

Haplotypes	GC, %	C, %	X²	P value	CG, %	C, %	X²	P value	GC, %	CG, %	X²	P value
TLR9-1237/-1486	GC, %	C, %	X²	P value	CG, %	C, %	X²	P value	GC, %	CG, %	X²	P value
T-C	35.2	47.7	38.284	≤ 0.0001	40.5	48.4	5.617	0.0178	24.9	39.7	19.098	≤ 0.0001
T-T	36.9	36.3	0.024	0.8772	44.2	35.6	6.778	0.0092	37.3	45.0	4.838	0.0278
C-T	18.7	8.2	17.656	≤ 0.0001	9.8	8.9	0.233	0.6290	18.3	9.0	15.335	≤ 0.0001
C-C	19.2	7.8	20.475	≤ 0.0001	5.5	7.1	1.000	0.3158	19.6	6.3	33.560	≤ 0.0001

C: Control; GC: Gastric cancer; CG: Chronic gastritis.

Table 4 Combined effect of TLR9-1237 T/C and TLR9-1486 C/T polymorphisms on risk of GC and CG

Risk genotype		Groups			OR (95%CI), P value
TLR9-1237	TLR9-1486	C, n = 200	GC, n = 161	CG, n = 248	GC × C	CG × C	GC × CG

TT	CC	50	7	38	1.00	1.00	1.00
TC/CC	CC	5	13	7	18.57 (5.06-68.15), < 0.0001	1.842 (0.54-6.25), 0.3665	10.08 (2.96-34.24). 0.0002
TT	CT/TT	98	70	150	5.102 (2.18-11.92), < 0.0001	7.737(4.72-12.66), < 0.0001	2.533 (1.07-5.95), 0.0307
TC/CC	CT/TT	47	71	53	10.79 (4.50-25.83), < 0.0001	1.484 (0.83-1.64), 0.1911	7.272 (3.01-17.56), < 0.0001

GC: Gastric cancer; CG: Chronic gastritis.

Table 5 Relative gene expression levels of TLR9 for GC and CG

Variables	Cases
Variables	GC, n = 23	CG, n = 48
Median	9.24	1.55
Range	3.64-24.06	1.04-3.87
P value	< 0.0001¹

¹Mann Whitney U Test. GC: Gastric cancer; CG: Chronic gastritis.

Table 6 TLR9 gene expression levels of GC and CG groups to assess influence of polymorphic genotypes

Groups		TLR9-1237T/C (rs5743836)		P value	TLR9-1486 C/T (rs187084)		P value
		TT	TC/CC		CC	CT / TT
		Upregulated cases			Upregulated cases
GC (n = 26)	Median	5.24	13.01	0.0083	7.37	9.90	0.8763
GC (n = 26)	Range	1.72-9.27	7.55-189.00	0.0083	5.74-14.16	2.49-53-75	0.8763
CG (n = 48)	Median	1.47	1.45	0.8442	3.26	1.50	0.1515
CG (n = 48)	Range	0.77-4.19	0.75-3.82	0.8442	1.39-8.46	0.75-3.00	0.1515

GC: Gastric cancer; CG: Chronic gastritis.

Citation: Susi MD, Lourenço Caroline M, Rasmussen LT, Payão SLM, Rossi AFT, Silva AE, Oliveira-Cucolo JG. Toll-like receptor 9 polymorphisms and Helicobacter pylori influence gene expression and risk of gastric carcinogenesis in the Brazilian population.. World J Gastrointest Oncol 2019; 11(11): 998-1010
URL: https://www.wjgnet.com/1948-5204/full/v11/i11/998.htm
DOI: https://dx.doi.org/10.4251/wjgo.v11.i11.998