©The Author(s) 2020.
World J Gastrointest Oncol. May 15, 2020; 12(5): 526-534
Published online May 15, 2020. doi: 10.4251/wjgo.v12.i5.526
Published online May 15, 2020. doi: 10.4251/wjgo.v12.i5.526
Table 2 Primers used for integrin β6 core promoter reporter construction
| Construct | Primer | Sequence (5’-3’) |
| pGL4-B6 (-350/-85) | Sense -350 | GGGGTACCCAAAGGCACTGATTTGC |
| pGL4-B7 (-286/-85) | Sense -286 | GGGGTACTGACAGGCATTGTCGATTGAG |
| pGL4-B8 (-210/-85) | Sense -210 | GGGGTAGACTGACAATTATTGAGGTGAT |
| pGL4-B9 (-156/-85) | Sense -156 | GGGGTCCTTGCGGATTCCGTAGACGTC |
| Antisense | GGGGTCGGGACAACGAATGTCGGCTTC |
- Citation: Niu W, Bo QY, Niu J, Niu ZC, Peng C, Zou XQ, Zhang ZY. Identification of integrin β6 gene promoter and analysis of its transcription regulation in colon cancer cells. World J Gastrointest Oncol 2020; 12(5): 526-534
- URL: https://www.wjgnet.com/1948-5204/full/v12/i5/526.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v12.i5.526