GATA2 deficiency exacerbates chronic liver injury via disrupting hepatocyte death-regeneration balance: Clinical, histopathological, and molecular evidence

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 18, Issue 2

Peer-Review Report of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Journal Information of This Article

Publication Name

World Journal of Stem Cells

ISSN

1948-0210

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study

©Author(s) (or their employer(s)) 2026. No commercial re-use. See Permissions. Published by Baishideng Publishing Group Inc.

World J Stem Cells. Feb 26, 2026; 18(2): 112940
Published online Feb 26, 2026. doi: 10.4252/wjsc.v18.i2.112940

Table 2 Short hairpin RNA sequences used for in vivo knockdown of Gata2

	Sequences (5’ to 3’)
Gata2 target	GAATCGGAAGATGTCCAGCAA
Gata2 shRNA	GAATCGGAAGATGTCCAGCAACGAATTGCTGGACATCTTCCGATTC
Control shRNA	AAACGTGACACGTTCGGAGAACGAATTCTCCGAACGTGTCACGTTT

shRNA: Short hairpin RNA.

Citation: Chen YF, Li SQ, Zhang J, Ma WT, Zhou Y, Rao JX, Yi Y, Cheng QJ, Zhong WW, Chen H, Chen YH, Luo YW, He YH. GATA2 deficiency exacerbates chronic liver injury via disrupting hepatocyte death-regeneration balance: Clinical, histopathological, and molecular evidence. World J Stem Cells 2026; 18(2): 112940
URL: https://www.wjgnet.com/1948-0210/full/v18/i2/112940.htm
DOI: https://dx.doi.org/10.4252/wjsc.v18.i2.112940

Chen YF, Li SQ, Zhang J, Ma WT, Zhou Y, Rao JX, Yi Y, Cheng QJ, Zhong WW, Chen H, Chen YH, Luo YW, He YH. GATA2 deficiency exacerbates chronic liver injury via disrupting hepatocyte death-regeneration balance: Clinical, histopathological, and molecular evidence. World J Stem Cells 2026; 18(2): 112940 [PMID: 41808888 DOI: 10.4252/wjsc.v18.i2.112940]

All content on this site: Copyright © 1993-2026 Baishideng Publishing Group Inc, its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply.