BPG is committed to discovery and dissemination of knowledge
Home / Archive / Volume 31, Issue 1
  • This Article
Peer-Review Report of This Article
CrossCheck and Google Search of This Article
Academic Rules and Norms of This Article
Supplementary Materials of This Article
Citation of this article
Corresponding Author of This Article
Research Domain of This Article
Article-Type of This Article
Open-Access Policy of This Article
Times Cited Counts in Google of This Article
Journal Information of This Article
Publication Name
World Journal of Gastroenterology
ISSN
1007-9327
Publisher of This Article
Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study
©The Author(s) 2025.
World J Gastroenterol. Jan 7, 2025; 31(1): 98561
Published online Jan 7, 2025. doi: 10.3748/wjg.v31.i1.98561
Table 2 Primers used in this study
Primer name
Forward 5’ to 3’
Reverse 5’ to 3’
ACTA2TAGAACACGGCATCATCACCAACTGTGGGGCAACACGAAGCTCATTG
FNGTGTGGATGTCCTGCCTGTCAACGCTTGCTTTCCCTGCCCTGATG
Collagen ICTCAAGATGTGCCACTCCGACTGGTCTCGCCTGTCTCCATGTTGC
TGF-β1GACCGCAACAACGCAATCTATGACGGCACTGCTTCCCGAATGTCTG
Smad2ATGTCGTCCATCTTGCCATTCACTCTGCTTTCTCACACCACTTCTCTTCC
Smad3TGTCGTCCATCCTGCCCTTCACACTTCTCCTCCTGCCCGTTCTG
GAPDHATGATTCCACCCACGGCAAGTTCAGCACCAGCATCACCCCATTTG
ACTA2: Alpha-smooth muscle actin; FN: Fibronectin; TGF-β1: Transforming growth factor.
Full Size Table
Write to the Help Desk
Copyright © 1993-2026 Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA. All rights reserved, including rights relating to text and data mining, AI training, and similar technologies. For open-access content, the applicable copyright and licensing terms govern.