©The Author(s) 2015.
World J Gastroenterol. Sep 21, 2015; 21(35): 10150-10158
Published online Sep 21, 2015. doi: 10.3748/wjg.v21.i35.10150
Published online Sep 21, 2015. doi: 10.3748/wjg.v21.i35.10150
Table 1 Sequences of primer and PCR conditions
| Polymorphisms | Primers | Temperature, time and cycles for PCR |
| CTLA-4(+49) A/G | Forward: | Initial denaturation for 4min at 94 °C, 35 cycles of 30 s at 94 °C, 30 s at 67 °C and 1 min at 72 °C and final elongation 5 min at 72 °C |
| 5’CAAGGCTCAGCTGAACCTGGGT3’ | ||
| Reverse: | ||
| 5’TACCTTTAACTTCTGGCTTTG3’ | ||
| CTLA-4(+6230) G/A | Forward | Initial denaturation for 5 min at 94 °C, 30 cycles of 40 s at 94 °C, 30 s at 61 °C and 50 s at 72 °C and final elongation 7 min at 72 °C |
| CT60 Sens: | ||
| 5’ CACCACTATTTGGGATATACC 3’ | ||
| Reverse | ||
| CT60 Antis: | ||
| 5’ AGCTCTATATTTCAGGAAGGC 3’ |
- Citation: Ksiaa Cheikhrouhou L, Lakhoua-Gorgi Y, Sfar I, Jendoubi-Ayed S, Aouadi H, Makhlouf M, Ayed K, Ben Abdallah T. Natural evolution of hepatitis C virus infection in hemodialysis Tunisian patients and CTLA-4 SNP's. World J Gastroenterol 2015; 21(35): 10150-10158
- URL: https://www.wjgnet.com/1007-9327/full/v21/i35/10150.htm
- DOI: https://dx.doi.org/10.3748/wjg.v21.i35.10150