©The Author(s) 2015.
World J Gastroenterol. Jul 7, 2015; 21(25): 7730-7741
Published online Jul 7, 2015. doi: 10.3748/wjg.v21.i25.7730
Published online Jul 7, 2015. doi: 10.3748/wjg.v21.i25.7730
Table 2 Polymerase chain reaction-restriction fragment length polymorphism conditions, primers sequences, restriction enzyme and fragment sizes
| Polymorphisms | Primers (5’-3’) | Enzymes | Fragment (bp) | Ref. |
| T°/time | ||||
| TLR2-196 to -174del | F: CACGGAGGCAGCGAGAAA | - | ins: 286 | [59] |
| R: CTGGGCCGTGCAAAGAAG | del: 264 | |||
| TLR4 +896A/G | F: AGCATACTTAGACTACCACCTCGATG | BstXI | A: 131 | [60] |
| (rs4986790) | R: GTTGCCATCCGAAATTATAAGAAAAG | 37 °C/3 h | G: 108; 23 | |
| TLR4 -1607T/C | F: TTTGTATAATTTGACTACCATTGCGT | HhaI 37 °C/3 h | T: 139 | [30] |
| (rs10759932) | R: CATTTTTTCACATCTTCACCAGC | C: 117; 22 |
-
Citation: Proença MA, de Oliveira JG, Cadamuro ACT, Succi M, Netinho JG, Goloni-Bertolo EM, Pavarino &C, Silva AE.
TLR2 andTLR4 polymorphisms influence mRNA and protein expression in colorectal cancer. World J Gastroenterol 2015; 21(25): 7730-7741 - URL: https://www.wjgnet.com/1007-9327/full/v21/i25/7730.htm
- DOI: https://dx.doi.org/10.3748/wjg.v21.i25.7730