©2014 Baishideng Publishing Group Inc.
World J Gastroenterol. Jun 7, 2014; 20(21): 6560-6572
Published online Jun 7, 2014. doi: 10.3748/wjg.v20.i21.6560
Published online Jun 7, 2014. doi: 10.3748/wjg.v20.i21.6560
Table 3 List of primers used for RT qPCR assays
| Primer name | Sequence (5’-3’) | Region specific for | Ref. |
| mmu-26s-FW | TGTCATTCGGAACATTGTAG | S26 | This study |
| mmu-26s-RV | GGCTTTGGTGGAGGTC | ||
| mmu-PCNA-FW | CCACATTGGAGATGCTGTTG | PCNA | |
| mmu-PCNA-RV | CAGTGGAGTGGCTTTTGTGA |
-
Citation: Raisch J, Buc E, Bonnet M, Sauvanet P, Vazeille E, de Vallée A, Déchelotte P, Darcha C, Pezet D, Bonnet R, Bringer MA, Darfeuille-Michaud A. Colon cancer-associated B2
Escherichia coli colonize gut mucosa and promote cell proliferation. World J Gastroenterol 2014; 20(21): 6560-6572 - URL: https://www.wjgnet.com/1007-9327/full/v20/i21/6560.htm
- DOI: https://dx.doi.org/10.3748/wjg.v20.i21.6560