©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Dec 28, 2012; 18(48): 7251-7261
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7251
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7251
Table 1 Primer sequences and fragment sizes of polymerase chain reaction products
| Gene | SNPs site (refSNP ) | Primer sequence(5’-3’) | Fragment sizes of PCR products (bp) |
| CDH17 | c.343A>G (rs2243518) | Forward primer: CCAACATGGTTTCCTTTTCCTC | 159 |
| Reverse primer: GTTCTGCCTTACTGAGCCTTCG | |||
| c.2216A>C (rs1051624) | Forward primer: AATCCAGGGTCTGAAGTTGTA | 198 | |
| Reverse primer: TACTAGCCTGAGTTGCCTATA |
-
Citation: Chen RY, Cao JJ, Chen J, Yang JP, Liu XB, Zhao GQ, Zhang YF. Single nucleotide polymorphisms in the
CDH17 gene of colorectal carcinoma. World J Gastroenterol 2012; 18(48): 7251-7261 - URL: https://www.wjgnet.com/1007-9327/full/v18/i48/7251.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i48.7251