©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Dec 21, 2012; 18(47): 7093-7099
Published online Dec 21, 2012. doi: 10.3748/wjg.v18.i47.7093
Published online Dec 21, 2012. doi: 10.3748/wjg.v18.i47.7093
Table 1 Primer sequences, polymerase chain reaction and denaturing high-performance liquid chromatography conditions for detection of gene polymorphisms
| Gene | Primer sequence | PCR annealing temperature (°C) | PCR product size (bp) | DHPLC application type | Oven temperature (°C) |
| IL-1B-31 | F: AGAAGCTTCCACCAATACTC | 60 | 240 | Mutation | 59 |
| R: AGCACCTAGTTGTAAGGAAG | |||||
| IL-1B-511 | F: TGGCATTGATCTGGTTCATC | 58.5 | 306 | Mutation | 60.5 |
| R: GTTTAGGAATCTTCCCACTT | |||||
| IL-1 RN | F: CCCCTCGAGCAACATCC | 59 | 270-442 | VNTR | 50.0 |
| R: GGTCAGAAGGGCAGAGA |
- Citation: Zhao JD, Geng PL, Li ZQ, Cui S, Zhao JH, Wang LJ, Li JZ, Ji FX, Li GY, Shen GS, Lin MZ, Shen CF, Cao CZ. Associations between interleukin-1 polymorphisms and gastric cancers among three ethnicities. World J Gastroenterol 2012; 18(47): 7093-7099
- URL: https://www.wjgnet.com/1007-9327/full/v18/i47/7093.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i47.7093