©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Oct 21, 2012; 18(39): 5542-5550
Published online Oct 21, 2012. doi: 10.3748/wjg.v18.i39.5542
Published online Oct 21, 2012. doi: 10.3748/wjg.v18.i39.5542
Table 1 Genes analyzed by real-time polymerase chain reaction in liver
| Gene symbol | Synonym | Accession number | Primer (forward/reverse) |
| Vegfa | Vascular endothelial growth factor A | NM031836 | CAGTTCGAGGAAAGGGAAAGGCAAATGCTTTCTCCGCTCTG |
| Hmox1 | Heme oxygenase (decycling) 1 | NM012580 | AGAGGCTAAGACCGCCTTCC AGGCCTCTGGCGAAGAAAC |
| Cdkn1a | Cyclin-dependent kinase inhibitor 1A | U24174 | CTTGCACTCTGGTGTCTCACG ATCGGCGCTTGGAGTGATAG |
| Timp1 | TIMP metallopeptidase inhibitor 1 | BC099821 | CCTGGTTCCCTGGCATAATC TTGCAAGGGATGGCTGAAC |
| Srebf1 | Sterol regulatory element binding protein-1 | AF286470 | AGAAGGCCAGTGGGTACCTG TGCGGGCCACAAGAAGTAG |
- Citation: Siaj R, Sauer V, Stöppeler S, Spiegel HU, Köhler G, Zibert A, Schmidt HH. Dietary copper triggers onset of fulminant hepatitis in the Long-Evans cinnamon rat model. World J Gastroenterol 2012; 18(39): 5542-5550
- URL: https://www.wjgnet.com/1007-9327/full/v18/i39/5542.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i39.5542