ApoB-100, ApoE and CYP7A1 gene polymorphisms in Mexican patients with cholesterol gallstone disease

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 16, Issue 37

This Article

Citation of this article

Corresponding Author of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

All Articles published online

Item

Count

PDF

373

HTML

2764

Tables (1-3)

123

Sum=3260

Oct 7, 2010 (publication date) through May 15, 2024

Times Cited of This Article

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Brief Article

World J Gastroenterol. Oct 7, 2010; 16(37): 4685-4690
Published online Oct 7, 2010. doi: 10.3748/wjg.v16.i37.4685

Table 1 Conditions and products of polymerase chain reaction followed by restriction fragment length polymorphism

Gene	Primers	Tm (°C)	RE	bp	Alleles
ApoB	Forward: GGAGACTATTCAGAAGCTAA	55	XbaI	710	X-: 710 bp
ApoB	Reverse: GAAGAGCCTGAAGACTGACT	55	XbaI	710	X+: 433 and 277 bp
ApoE	Forward: ACAGAATTCGCCCCGGCCTGGTACAC	60	HhaI	252	E2: 91 and 84 bp
	Reverse: TAAGCTTGGCACGGCTGTCCAAGGA				E3: 91, 48 and 36 pb
					E4: 72, 48 and 36 bp
CYP7A1	Forward: CAGAGCATGGACAGGGAGCAG	55	BsaI	948	A: 581, 367 bp
CYP7A1	Reverse: GCAACTCCTCATGGCTGAGGTT	55	BsaI	948	C: 542, 367 and 39 bp

Forward and reverse primers in 5’ to 3’ directions. Tm: Annealing temperature; RE: Restriction enzyme.

Citation: Jaime SC, Maribel AM, Eliakym AM, José RN, Julio G, Laura SM, Rosalío RP. ApoB-100, ApoE and CYP7A1 gene polymorphisms in Mexican patients with cholesterol gallstone disease. World J Gastroenterol 2010; 16(37): 4685-4690
URL: https://www.wjgnet.com/1007-9327/full/v16/i37/4685.htm
DOI: https://dx.doi.org/10.3748/wjg.v16.i37.4685