Copyright
©2009 The WJG Press and Baishideng.
World J Gastroenterol. Oct 28, 2009; 15(40): 5035-5043
Published online Oct 28, 2009. doi: 10.3748/wjg.15.5035
Published online Oct 28, 2009. doi: 10.3748/wjg.15.5035
Table 1 Sequences of γ-synuclein gene-specific primers
| Primer | Sequence (5’-3’) | Product size (bp) |
| γ-synuclein-5′ | GGAGGACTTGAGGCCATCTG | 73 (339 to 411) |
| γ-synuclein -3′ | CTCCTCTGCCACTTCCTCTTTC | |
| GAPDH-5′ | GGACCTGACCTGCCGTCTAG | 100 (831 to 930) |
| GAPDH-3′ | GTAGCCCAGGATGCCCTTGA |
- Citation: Ye Q, Feng B, Peng YF, Chen XH, Cai Q, Yu BQ, Li LH, Qiu MY, Liu BY, Zheng MH. Expression of γ-synuclein in colorectal cancer tissues and its role on colorectal cancer cell line HCT116. World J Gastroenterol 2009; 15(40): 5035-5043
- URL: https://www.wjgnet.com/1007-9327/full/v15/i40/5035.htm
- DOI: https://dx.doi.org/10.3748/wjg.15.5035