©2009 The WJG Press and Baishideng.
World J Gastroenterol. Mar 21, 2009; 15(11): 1381-1387
Published online Mar 21, 2009. doi: 10.3748/wjg.15.1381
Published online Mar 21, 2009. doi: 10.3748/wjg.15.1381
Table 1 Detail of the primers and cycling parameters
| p53 exons | Sequence (5’-3’) | Cycling parameters1 | PCR product (bp) |
| 5 | Sp5F: TGTTCACTTGTGCCCTGACT | 45 s denaturation at 94°C, 30 s annealing at 54°C, 1 min extension at 72°C | 266 |
| Sp5R: CAGCCCTGTCGTCTCTCCAG | |||
| 6 | Sp6F: GCCTCTGATTCCTCACTGAT | 45 s denaturation at 94°C, 30 s annealing at 53°C, 1 min extension at 72°C | 160 |
| Sp6R: TTAACCCCTCCTCCCAGAGA | |||
| 7 | Sp7F: ACTGGCCTCATCTTGGGCCT | 45 s denaturation at 94°C, 30 s annealing at 56°C, 1 min extension at 72°C | 180 |
| Sp7R: TGTGCAGGGTGGCAAGTGGC | |||
| 8 | Sp8F: TAAATGGGACAGGTAGGACC | 45 s denaturation at 94°C, 30 s annealing at 54°C, 1 min extension at 72°C | 230 |
| Sp8R: TCCACCGCTTCTTGTCCTGC |
-
Citation: Karim S, Ali A. Correlation of p53 over-expression and alteration in
p53 gene detected by polymerase chain reaction-single strand conformation polymorphism in adenocarcinoma of gastric cancer patients from India. World J Gastroenterol 2009; 15(11): 1381-1387 - URL: https://www.wjgnet.com/1007-9327/full/v15/i11/1381.htm
- DOI: https://dx.doi.org/10.3748/wjg.15.1381