BPG is committed to discovery and dissemination of knowledge
Colorectal Cancer
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Jan 28, 2008; 14(4): 524-531
Published online Jan 28, 2008. doi: 10.3748/wjg.14.524
Table 1 SFRP2 gene primer sequences, annealing temperature and product size for MethyLight assays
CpG statusForward primer (5’-3’)Reverse primer (5’-3’)Annealing temperature (°C)Product size (bp)
MGGGTCGGAGTTTTTCGGAGTTGCGCCCGCTCTCTTCGCTAAATACGACTCG62138
UTTTTGGGTTGGAGTTTTTTGGAGTTGTGTAACCCACTCTCTTCACTAAATACAACTCA50145


Write to the Help Desk