BPG is committed to discovery and dissemination of knowledge
Rapid Communication
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Mar 28, 2008; 14(12): 1891-1897
Published online Mar 28, 2008. doi: 10.3748/wjg.14.1891
Table 1 Primer sequences used for KIT and PDGFRA PCR
Kit exon 9F tttggaaagctagtggttcaKit exon 9R atggtagacagagcctaaac
Kit exon11F ctatttttccctttctccccKit exon11R tacccaaaaaggtgacatgg
Kit exon 13F cttgacatcagtttgccagKit exon 13R aaaggcagcttggacacggcttta
Kit exon 17F tttctcctccaacctaatagKit exon 17R cctttgcaggactgtcaagc
PDGFRA exon 12aF ccagttacctgtcctggtcatPDGFRA exon 12aR tggaaactcccatcttgagtc
PDGFRA exon 12bF aaattcgctggagggtcattPDGFRA exon 12bR ggaggttaccccatggaagt
PDGFR exon 18F agtgtgtccaccgtgatctgPDGFRA exon 18R gtgtgggaagtgtggaggta


Write to the Help Desk