Copyright
©2006 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 28, 2006; 12(24): 3814-3820
Published online Jun 28, 2006. doi: 10.3748/wjg.v12.i24.3814
Published online Jun 28, 2006. doi: 10.3748/wjg.v12.i24.3814
Table 1 Primers for typing polymorphisms IL-1B-31 and IL-1B-511
| Polymorphism | Primer sequences |
| IL-1B-31 | P1-1 5’- tcaactgcacaacgattgtca -3’ |
| P1-2 5’- tcccttagcacctagttgtaa -3’ | |
| S1-1 5’- ttctccctcgctgtttttGta -3’ | |
| S1-2 5’- ctacttctgcttttgaaaCcc -3’ | |
| IL-1B-511 | P2-1 5’-ggaagggcaaggagtagcaaac-3’ |
| P2-2 5’-ggcagagctcatctggcattga-3’ | |
| S2-1 5’-ctgcaattgacagagagctGcc-3’ | |
| S2-2 5’-ttgggtgctgttctctgccAca-3’ |
- Citation: Huang H, Bu Y, Zhou GH. Single-tube-genotyping of gastric cancer related SNPs by directly using whole blood and paper-dried blood as starting materials. World J Gastroenterol 2006; 12(24): 3814-3820
- URL: https://www.wjgnet.com/1007-9327/full/v12/i24/3814.htm
- DOI: https://dx.doi.org/10.3748/wjg.v12.i24.3814