©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 28, 2005; 11(48): 7615-7619
Published online Dec 28, 2005. doi: 10.3748/wjg.v11.i48.7615
Published online Dec 28, 2005. doi: 10.3748/wjg.v11.i48.7615
Table 2 Oligonucleotide probes used in the present study
| No. | Sequence (5' to 3') | Target |
| 1 | gtacaaggcccgggaacgtattcacc | All known eubacteria (universal bacterial probe) |
| 2 | gacataaggggcatgatgatttgacgt | All Gram-positive bacteria |
| 3 | gtcgtaagggccatgatgacttgacgt | All Gram-negative bacteria |
| 4 | gtcatgaatcacaaagtggtaagcgc | All enteric bacterial |
| 5 | acgacgcactttatgaggtccgcttg | Escherichia coli, Shigella sp. and Salmonella sp. |
| 6 | gctcctaaaaggttactccaccggct | Staphylococcus aureus |
| 7 | cgacggctagctccaaatggttactg | Coagulase-negative Staphylococcus |
| 9 | tcacggtcttgcgtcttattgtacctac | Clostridium botulinum |
| 11 | gaactgagactggtttttaagtttggct | Clostridium perfringens |
| 15 | cgaactgggacatattttatagatttgc | Campylobacter jejuni |
| 16 | aggtcgccccttcgccgccctctgtatc | Legionella pneumophila |
| 17 | cgatccgaactgagaccggcttttaagg | Mycobacterium tuberculosis |
| 18 | tactcgtaagggccatgatacgacttaa | Proteus sp. |
| 19 | cgcggcttggcaaccctttgtaccgacc | Pseudomonas aeruginosa |
| 20 | actgagaatagttttatgggattagg | Listeria monocytogenes |
| 21 | gctccaccttcgcggtattcgctgccct | Vibrio cholerae |
| 22 | tcactttcgcaagttggccgccctctgt | Vibrio fluvialis |
| 23 | tggtaagcgtccccccgtagttgaaac | Vibrio parahaemolyticus |
| 24 | tacgacagactttatgtggtccgcttgc | Yersinia enterocolitica |
| 25 | cctcgcggtctagcagctcgttgtgctt | Enterococcus faecalis |
| 26 | ggattcgctcactatcgctagcttgcag | Aeromonas hydrophila |
| 27 | ccgacttcgggtgttacaaactctcg | Bacillus cereus, P. |
| 28 | gcttcatgcactcgagttgcagagtg | cocovenenans subsp. farinofermentans |
| 30 | atccccaccttcctccagtt | Positive control |
| 31 | cccccagaggcagagattgca | virA gene of Shigella sp. |
| 32 | cgccaataacgaattgcccga | invA gene of Salmonella sp. |
- Citation: Jin LQ, Li JW, Wang SQ, Chao FH, Wang XW, Yuan ZQ. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays. World J Gastroenterol 2005; 11(48): 7615-7619
- URL: https://www.wjgnet.com/1007-9327/full/v11/i48/7615.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i48.7615