Effects of thalidomide on angiogenesis and tumor growth and metastasis of human hepatocellular carcinoma in nude mice

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 11, Issue 2

This Article

Citation of this article

Corresponding Author of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

- Full Article with Cover (PDF)
- Full Article (XML)

Liver Cancer

©2005 Baishideng Publishing Group Co., Limited. All rights reserved.

World J Gastroenterol. Jan 14, 2005; 11(2): 216-220
Published online Jan 14, 2005. doi: 10.3748/wjg.v11.i2.216

Table 1 Primer sequences and PCR reaction conditions.

Gene	Primers	Products size	Annealing Temp/Time	Cycles
VEGF (all isoforms)	Upper: CCTGGTGGACATCTTCCAGGAGTACC	196 bp	58°C/30 s	30
	Lower: GAAGCTCATCTCTCCTATGTGCTGGC
G3PDH	Upper: ACCACAGTCCATGCCATCAC	450 bp	58°C/30 s	30
	Lower: TCCACCACCCTGTTGCTGTA

Full Size Table

Citation: Zhang ZL, Liu ZS, Sun Q. Effects of thalidomide on angiogenesis and tumor growth and metastasis of human hepatocellular carcinoma in nude mice. World J Gastroenterol 2005; 11(2): 216-220
URL: https://www.wjgnet.com/1007-9327/full/v11/i2/216.htm
DOI: https://dx.doi.org/10.3748/wjg.v11.i2.216

Write to the Help Desk

Copyright © 1993-2026 Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA. All rights reserved, including rights relating to text and data mining, AI training, and similar technologies. For open-access content, the applicable copyright and licensing terms govern.