Polymorphic variants in GABA-A receptor and their association with epilepsy and drug resistance: A North Indian cohort study

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 15, Issue 11

Peer-Review Report of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Journal Information of This Article

Publication Name

World Journal of Psychiatry

ISSN

2220-3206

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Observational Study

World J Psychiatry. Nov 19, 2025; 15(11): 108964
Published online Nov 19, 2025. doi: 10.5498/wjp.v15.i11.108964

Table 1 Primers for single nucleotide polymorphism analysis of rs2279020 A/G and rs211013 A/G polymorphism

SNP	Primers	Sequence	Restriction enzyme
rs2279020 A/G	Forward primer	5’ GCTATGGATTGGTTTATTGCCGTGTG 3’	Ava II
rs2279020 A/G	Reverse primer	5’ ATAATATTGATGTACTACAGGGAC 3’	Ava II
rs211013 A/G	Forward primer	5’ AGAAATTTACCAACTGGTCTAGCCGG 3’	Nci I
rs211013 A/G	Reverse primer	5’ AAATCAAATATTGTGTCATGCTTAGT 3’	Nci I

SNP: Single nucleotide polymorphism.

Citation: Dabla PK, Singh S, Viswas A, Gupta S, Yadav M, Sonkar SC, Koner BC, Serdarevic N. Polymorphic variants in GABA-A receptor and their association with epilepsy and drug resistance: A North Indian cohort study. World J Psychiatry 2025; 15(11): 108964
URL: https://www.wjgnet.com/2220-3206/full/v15/i11/108964.htm
DOI: https://dx.doi.org/10.5498/wjp.v15.i11.108964

Dabla PK, Singh S, Viswas A, Gupta S, Yadav M, Sonkar SC, Koner BC, Serdarevic N. Polymorphic variants in GABA-A receptor and their association with epilepsy and drug resistance: A North Indian cohort study. World J Psychiatry 2025; 15(11): 108964 [PMID: 41281537 DOI: 10.5498/wjp.v15.i11.108964]

All content on this site: Copyright © 1993-2026 Baishideng Publishing Group Inc, its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply.