Relationship between GCKR gene rs780094 polymorphism and type 2 diabetes with albuminuria

doi:10.4239/wjd.v14.i12.1803

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 14, Issue 12

This Article

Academic Content and Language Evaluation of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (1448)

All Articles published online

The chart showing PDF series, WORD series, HTML series, Figures (1-2) series, Tables (1-4) series.

Item

Count

PDF

WORD

HTML

765

Figures (1-2)

Tables (1-4)

Sum=1011

Publishing Process of This Article

The chart showing Browse series, Download series.

Item

Count

Browse

Download

283

Sum=366

Dec 15, 2023 (publication date) through Jun 11, 2024

Times Cited of This Article

Times Cited (1)

Journal Information of This Article

Publication Name

World Journal of Diabetes

ISSN

1948-9358

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Clinical Trials Study

World J Diabetes. Dec 15, 2023; 14(12): 1803-1812
Published online Dec 15, 2023. doi: 10.4239/wjd.v14.i12.1803

Table 1 Probe sequence

Name	SNP site	Primer	Sequence	Modification
Name	SNP site	Primer	Sequence	5’	3’
Human	rs780094	rs780094-F	GGCCCCAGTTTTTTAGACCAT
		rs780094-R	GCCCGGCCTCAACAAAT
		rs780094-PG	CTGACACATGTTTGCT	FAM	MGB
		rs780094-PA	TGACACATATTTGCTG	VIC	MGB

SNP: Single nucleotide polymorphism.

Table 2 Comparison of baseline data among the four groups

Group	I	II	III	IV	Statistics	P value
Number	66	101	81	70	-	-
Sex (male/female)	22/44	57/44^a	36/45	33/37	8.755¹	0.033
Age (yr)	51 (19)	55 (16)^a	55.5 (15.75)^a	58 (13.75)^a	14.314²	0.003
DBP (mmHg)	73 (17.5)	87 (17.75)^a	86 (17.75)^a	92 (17.75)^a^,^b	45.370²	< 0.001
SBP (mmHg)	125 (24.5)	153 (34.5)^a	153.5 (35.5)^a	154 (29)^a	54.376²	< 0.001
Height (cm)	158 (11)	160 (14)	157 (10.75)	158.5 (14.75)	0.674²	0.879
Weight (kg)	54.4 (15.5)	62 (15.5)^a	62 (13)^a	64.5 (17.75)^a	30.99²	< 0.01
BMI (kg/m²)	21.74 (3.91)	25.3 (3.82)^a	25.40 (4.53)^a	25.39 (4.47)^a	40.147²	< 0.01
Course of disease (mo)	-	90 (133.35)^a	111.5 (132.5)^a	118.5 (1332.5)^a	147.932²	< 0.01
HbA1c (%)	5.7 (0.6)	9.6 (3.55)^a	9.7 (3.5)^a	9.35 (2.88)^a	151.947²	< 0.01
FBG (mmol/L)	5.33 (0.75)	7.35 (2.93)^a	8.85 (5.68)^a^,^b	8.85 (3.2)^b	106.139²	< 0.01
2-h PBG (mmol/L)	9.43 (1.83)	12.65 (2.45)^a	13.4 (6.92)^a	13.6 (7.47)^a^,^b	102.209²	< 0.01
INS (mmol/L)	7.47 (5.79)	8.23 (8.54)^a	8.0 (9.26)^a	7.94 (8.01)	5.999²	0.112
Fasting C-peptide (mmol/L)	1.61 (1)	1.73 (1.58)	1.35 (1.62)	1.97 (2.37)	5.645²	0.130
BUN (mmol/L)	4.92 (1.79)	5.85 (2.15)^a	5.67 (1.94)^a	7.82 (2.56)^a^,^b^,^c	56.728²	< 0.01
Cr (μmol/L)	55 (29.05)	58.6 (25.33)	57.4 (22.65)	87.95 (53.78)^a^,^b^,^c	53.938²	< 0.01
UA (μmol/L)	347.6 (122.9)	318.25 (187.6)	298.95 (138.18)	389.1 (189.58)^b	10.817²	0.013
TG (mmol/L)	1.42 (0.75)	1.69 (1.54)^a	1.81 (1.40)^a	1.74 (1.43)^a	14.974²	0.02
TC (mmol/L)	3.77 (1.67)	4.51 (1.66)^a	4.58 (1.53)^a	4.44 (1.91)^a	14.796²	0.02
HDL (mmol/L)	1.14 (0.35)	1.08 (0.40)	1.09 (0.30)	1.09 (0.40)	1.305²	0.728
LDL (mmol/L)	2.55 (1.14)	2.61 (1.45)	2.54 (1.42)	2.69 (1.95)	1.145²	0.766
UCAR (μg/mg)	18.95 (11.92)	21.9 (48.63)^a	67.85 (67.3)^a^,^b	2314.5 (3161.08)^a^,^b^,^c	218.326²	< 0.01
Hypertension (yes/no)	57/9	64/37^a	29/52^a^,^b	31/39^a^,^b	44.444¹	< 0.01
Hyperlipidemia (yes/no)	52/14	62/39^a	48/33^a	46/24	7.301¹	0.063
CHD (yes/no)	63/3	90/11	72/9	66/4	3.482¹	0.323
Stoke (yes/no)	63/3	95/6	72/9	63/7	4.182¹	0.242
Drink (yes/no)	55/11	66/35	60/21	45/35	8.359¹	0.039
Smoke (yes/no)	53/13	68/33^a	57/24	46/24^a	4.305¹	0.230

^aRepresents a statistically significant difference from group I.

^bRepresents a statistically significant difference from group II.

^cRepresents a statistically significant difference from group III.

¹Represents χ² value.

²Represents H value.

DBP: Diastolic blood pressure; SBP: Systolic blood pressure; BMI: Body mass index; HbA1c: Glycosylated hemoglobin; FBG: Fasting blood glucose; 2-h PBG: 2-h postprandial blood glucose; BUN: Blood urea nitrogen; UA: Uric acid; TG: Triglyceride; TC: Total cholesterol; HDL: High-density lipoprotein; LDL: Low-density lipoprotein; UCAR: Urinary albumin/creatinine ratio; CHD: Coronary heart disease.

Table 3 Comparison of genotype frequency and allele frequency among the four groups

Group	n	CC	CT	TT	C	T
I	66	25 (37.9%)	28 (42.4%)	13 (19.7%)	78 (59.1%)	54 (40.9%)
II	101	22 (21.7%)	45 (44.6%)	34 (33.7%)	89 (44.1%)	113 (55.9%)
III	81	18 (22.2%)	37 (45.7%)	26 (32.1%)	73 (45.1%)	89 (54.9%)
IV	70	15 (21.4%)	33 (47.1%)	22 (31.5%)	63 (45.0%)	77 (55.0%)

Table 4 Logistic regression analysis of risk factors for type 2 diabetes mellitus complicated with proteinuria

Variable	B	SE	Wald χ²	P value	OR (95%CI)
DBP (mmHg)	0.077	0.013	35.65	< 0.01	1.080 (1.053-1.017)
SBP (mmHg)	0.036	0.006	36.858	< 0.01	1.037 (1.025-1.049)
Weight (kg)	0.072	0.015	23.121	< 0.01	1.075 (1.044-1.107)
BMI (kg/m²)	0.300	0.051	34.472	< 0.01	1.350 (1.221-1.492)
Hypertension (yes/no)	1.878	0.380	24.391	< 0.01	6.538 (3.103-13.773)
Hyperlipidemia (yes/no)	0.827	0.328	6.358	0.012	2.286 (1.202-4.346)
Drink (yes/no)	0.862	0.357	5.841	0.016	2.368 (1.177-4.766)
HbA1c (%)	4.834	0.904	28.614	< 0.01	125.687 (21.385-738.706)
FBG (mmol/L)	1.258	0.187	45.233	< 0.01	3.517 (2.438-5.074)
2-h PBG (mmol/L)	0.631	0.092	47.502	< 0.01	1.879 (1.571-2.248)
BUN (mmol/L)	0.477	0.099	23.410	< 0.01	1.612 (1.328-1.956)
TG (mmol/L)	0.464	0.159	8.548	0.003	1.591 (1.165-2.171)
TC (mmol/L)	0.470	0.122	14.801	< 0.01	1.600 (1.259-2.032)
CT + TT	0.536	0.192	7.765	0.005	1.710 (1.172-2.493)

OR: Odds ratio; CI: Confidence interval; DBP: Diastolic blood pressure; SBP: Systolic blood pressure; BMI: Body mass index; TG: Triglyceride; TC: Total cholesterol; 2-h PBG: 2-h postprandial blood glucose; HbA1c: Glycosylated hemoglobin; FBG: Fasting blood glucose; BUN: Blood urea nitrogen.

Citation: Liu YY, Wan Q. Relationship between GCKR gene rs780094 polymorphism and type 2 diabetes with albuminuria. World J Diabetes 2023; 14(12): 1803-1812
URL: https://www.wjgnet.com/1948-9358/full/v14/i12/1803.htm
DOI: https://dx.doi.org/10.4239/wjd.v14.i12.1803