©The Author(s) 2025.
World J Diabetes. Apr 15, 2025; 16(4): 96176
Published online Apr 15, 2025. doi: 10.4239/wjd.v16.i4.96176
Published online Apr 15, 2025. doi: 10.4239/wjd.v16.i4.96176
Table 2 Sequences of primers
| Primer name | Primers (5’-3’) | Gengray ID |
| TRPV1 | GTTTACCTCGTCCACCCTGA (forward) | 220629I42 |
| AGAGAGCCATVACCATCCTG (reverse) | 220629I43 | |
| P2X3 | TCTCCAGCAGAGACATCAGCA (forward) | 220629I44 |
| GGGAGCATCTTGGTGAACTCAG (reverse) | 220629I45 | |
| β-actin | CATCCGTAAAGACCTCTATGCCAAC (forward) | 220629I38 |
| ATGGAGCCACCGATCCACA (reverse) | 220629I39 |
- Citation: Li GY, Ren S, Huang BC, Feng JJ, Wang QQ, Peng QJ, Tian HF, Yu LY, Ma CL, Fan SZ, Chen XJ, Al-Qaisi MA, He R. Role and mechanism of Roux-en-Y gastric bypass in the treatment of diabetic urinary bladder hyperactivity by reducing TRPV1 and P2X3. World J Diabetes 2025; 16(4): 96176
- URL: https://www.wjgnet.com/1948-9358/full/v16/i4/96176.htm
- DOI: https://dx.doi.org/10.4239/wjd.v16.i4.96176