Methylation status of leptin gene promoter in relatively lean Chinese adults with prediabetes and type 2 diabetes mellitus

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 16, Issue 12

Peer-Review Report of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Journal Information of This Article

Publication Name

World Journal of Diabetes

ISSN

1948-9358

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study

World J Diabetes. Dec 15, 2025; 16(12): 112789
Published online Dec 15, 2025. doi: 10.4239/wjd.v16.i12.112789

Table 1 Primer sequences, lengths, and annealing temperatures for leptin gene PCR

Primer name primers sequence (5' to 3')		Annealing temperature (°C)	Primer length (bp)
Methylation	Upstream: TTGGCGTTTAGGGTCGTC	62	106
Methylation	Downstream: AACTCCGCGAAACGAACT
Non-methylation	Upstream: TTTTTGGTGTTTAGGGTTGTT	60	112
Non-methylation	Downstream: AAAAACTCCACAAAACAAACT

Citation: Sun SQ, Liang SZ, Huang Q, Sun JZ. Methylation status of leptin gene promoter in relatively lean Chinese adults with prediabetes and type 2 diabetes mellitus. World J Diabetes 2025; 16(12): 112789
URL: https://www.wjgnet.com/1948-9358/full/v16/i12/112789.htm
DOI: https://dx.doi.org/10.4239/wjd.v16.i12.112789

Sun SQ, Liang SZ, Huang Q, Sun JZ. Methylation status of leptin gene promoter in relatively lean Chinese adults with prediabetes and type 2 diabetes mellitus. World J Diabetes 2025; 16(12): 112789 [PMID: 41480608 DOI: 10.4239/wjd.v16.i12.112789]

All content on this site: Copyright © 1993-2026 Baishideng Publishing Group Inc, its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply.