©The Author(s) 2023.
World J Diabetes. Dec 15, 2023; 14(12): 1803-1812
Published online Dec 15, 2023. doi: 10.4239/wjd.v14.i12.1803
Published online Dec 15, 2023. doi: 10.4239/wjd.v14.i12.1803
Table 1 Probe sequence
| Name | SNP site | Primer | Sequence | Modification | |
| 5’ | 3’ | ||||
| Human | rs780094 | rs780094-F | GGCCCCAGTTTTTTAGACCAT | ||
| rs780094-R | GCCCGGCCTCAACAAAT | ||||
| rs780094-PG | CTGACACATGTTTGCT | FAM | MGB | ||
| rs780094-PA | TGACACATATTTGCTG | VIC | MGB | ||
- Citation: Liu YY, Wan Q. Relationship between GCKR gene rs780094 polymorphism and type 2 diabetes with albuminuria. World J Diabetes 2023; 14(12): 1803-1812
- URL: https://www.wjgnet.com/1948-9358/full/v14/i12/1803.htm
- DOI: https://dx.doi.org/10.4239/wjd.v14.i12.1803