Identification of miR-802-5p and its involvement in type 2 diabetes mellitus

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 11, Issue 12

Peer-Review Report of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Journal Information of This Article

Publication Name

World Journal of Diabetes

ISSN

1948-9358

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Field of Vision

World J Diabetes. Dec 15, 2020; 11(12): 567-571
Published online Dec 15, 2020. doi: 10.4239/wjd.v11.i12.567

Table 1 Represents the characteristics of mature miR- 802-5p

Source miRNA	Source organism	PL	MFE ∆ G	MS	Strand	A + U, %
hsa-miR-802	Homo sapiens	94	-22.90	CAGUAACAAAGAUUCAUCCUUGU	3’	70

PL: Pre-miRNA length; MFE: Minimal free energy; MS: Mature sequence.

Citation: Rajkumar KV, Lakshmanan G, Sekar D. Identification of miR-802-5p and its involvement in type 2 diabetes mellitus. World J Diabetes 2020; 11(12): 567-571
URL: https://www.wjgnet.com/1948-9358/full/v11/i12/567.htm
DOI: https://dx.doi.org/10.4239/wjd.v11.i12.567

Rajkumar KV, Lakshmanan G, Sekar D. Identification of miR-802-5p and its involvement in type 2 diabetes mellitus. World J Diabetes 2020; 11(12): 567-571 [PMID: 33384764 DOI: 10.4239/wjd.v11.i12.567]

All content on this site: Copyright © 1993-2026 Baishideng Publishing Group Inc, its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply.