|
Hai Song, Shuang-Luo Xia, Cheng
Liao, Tsai-Ping Li, Mu-Jun Zhao, State Key Laboratory of Molecular
Biology, Institute of Biochemistry and Cell Biology, Shanghai Institues
for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031,
China Yi-Liang Li, East China Normal University,
Shanghai 200062, China Yi-Fei Wang, Department of
Mathematics, Shanghai University, Shanghai 200436, China
Supported by the grants from National High Technology
Research and Development Program of China (863 Program), No. 2001AA221021
and No. 2002BA711A02 Correspondence to: Professor
Mu-Jun Zhao, P.O. Box 35, State Key Laboratory of Molecular Biology,
Institute of Biochemistry and Cell Biology, Shanghai Institues for
Biological Sciences, Chinese Academy of Sciences, 320 Yue-Yang Road,
Shanghai 200031, China.
mjzhao@sibs. ac.cn Telephone: +86-21-54921115 Fax:
+86-21-54921011 Received: 2003-08-23 Accepted:
2003-10-07
Abstract AIM: To
reveal new tumor markers and target genes from differentially expressed
genes of primary tumor samples using cDNA microarray.
METHODS: The 33P labeled
cDNAs were synthesized by reverse transcription of message RNA from the
liver cancerous tissue and adjacent non-cancerous liver tissue from the
same patient and used to hybridize to LifeGrid 1.0 cDNA microarray blot
containing 8400 known and unique human cDNA gene targets, and an
expression profile of genes was produced in one paired human liver tumor
tissue. After a global analysis of gene expression of 8400 genes, we
selected some genes to confirm the differential expression using Northern
blot and RT-PCR.
RESULTS: Parallel analysis of the
hybridized signals enabled us to get an expression profile of genes in
which about 500 genes were differentially expressed in the paired liver
tumor tissues. We identified 4 genes, the expression of three (Beclin 1,
RbAp48 and Pir51) were increased and one (aldolase b) was decreased in
liver tumor tissues. In addition, the expression of these genes in 6
hepatoma cell lines was also showed by RT-PCR analysis.
CONCLUSION: cDNA microarray permits a
high throughput identification of changes in gene expression. The genes
encoding Beclin 1, RbAp48, Pir51 and aldolase b are first reported that
may be related with hepatocarcinoma.
Song H, Xia SL, Liao C, Li YL, Wang
YF, Li TP, Zhao MJ. Genes encoding Pir51, Beclin 1, RbAp48 and aldolase b
are up or down-regulated in human primary hepatocellular carcinoma. World
J Gastroenterol 2004; 10(4):
509-513 http://www.wjgnet.com/1007-9327/10/509.asp
INTRODUCTION Hepatocellular
carcinoma (HCC), an aggressive malignancy with poor prognosis and one of
the most common tumors in human beings, has become a leading cause of
cancer-related death in adults from Asia and
sub-Saharan-Africa[1]. The multiple pathogenic factors,
including food contamination with aflatoxin B1 and infection with
hepatitic B virus and hepatitic C virus and the subsequent multistage
pathogenesis of HCC have been extensively studied. In addition, tumor
suppressor genes, such as Rb and p53[2], may play a significant
role in hepatocarcinogenesis. However it is not clear how these disorders
result in HCC. Recent advances in molecular genetics have identified
various genetic abnormalities in tumors. However, little is known about
the genetic alterations responsible for specific phenotypes of HCC.
With the advent of cDNA microarray technology, genome-wide
expression of hundreds of genes can be simultaneously analyzed,
facilitating differential expression monitoring of a large number of
activated or suppressed genes under various biological conditions,
including carcinogenesis[3-5], drug discovery and
development[6]. With cDNA microarrays, it is now possible to
perform a large-scale expression survey to identify candidate target
genes[7]. Efforts to classify human HCC based on gene
expression profile using cDNA microarray have been successfully processed
in recent year[8-12]. Shirota et al. found that 10 genes
were up-regulated and 9 genes were down-regulated in >50% HCC and
identified the changes of 22 genes associated with the degree of
differentiation of HCC[8]. Kawai et al showed that
AFP-producing hepatoma cell lines shared a distinct expression profile of
genes in various categories compared with those of AFP-negative hepatoma
cell lines and non-hepatotic cancer cell lines[10]. Xu et
al identified that 156 genes were down-regulated and up-regulated in
>50% of cancer samples of HCC[12]. So much work has focused
on HCC expression profile, however the data are still far less.
In this study, we used
cDNA microarray representing 8400 cDNA clusters to analyze HCC specific
expression profile. The aims were to identify complex alterations of genes
expression responsible for the development of HCC and to identify
differentially expressed genes and differentially expressed novel genes of
potentially biological or medical importance for HCC. In this report, we
showed that 523 genes were differentially expressed over 4 folds in the
microarray analysis. We confirmed 4 genes which were consistently up or
down-regulated in >50% of HCC samples.
MATERIALS AND METHODS
Tumor materials and cell lines All
samples were obtained from Eastern Hepatobiliary Surgery Hospital and
Zhongshan Hospital (Shanghai, China). All patients were diagnosed as HCC.
Tissue specimens were quickly frozen shortly after surgical resection and
stored in liquid nitrogen. Tissue for cDNA microarray hybridization was
obtained from a 47-year-old male patient with primary hepatocellular
carcinoma stage III, HBV positive. The HCC
cell lines HepG2, SMMC-7721, Bel-7404, Bel-7402, HuH7and the line of
normal liver cells L02 were obtained from the Cell Bank of the Chinese
Academy of Sciences (Shanghai, P.R. China). HepG2, HuH7, Bel-7404 and
Bel-7402 cells were cultured in Dulbecco�s Modified Eagle Medium (DMED;
Life Technologies Inc., Grand Island NY, U.S.A.) supplemented with 10%
fetal calf serum (FCS; Life Technologies Inc.) and L02 and SMMC-7721 cells
were cultured in RPMI medium 1640 (Life Technologies Inc.) plus 10%
FCS.
Table
1 Primer sequences and PCR
conditions used for synthesis of amplicons applied as probes in Northern
blot and RT-PCR
| Genes name |
Primer (5'-3') |
PCR fragment size (bp) |
Annealing
temperature�C |
Number of cycles |
| Pir51 |
F
gtggaagatgatgttggtggtg |
527 |
58 |
32 |
| |
R
aaggcggagactctgattgg |
|
|
|
| RbAp48 |
F gaactgcctttctttcaatc |
826 |
58 |
30 |
| |
R atggctcagacacctacctc |
|
|
|
| Beclin 1 |
F cttaccacagcccaggcgaaac |
814 |
58 |
30 |
| |
R
gccagagcatggagcagcaa |
|
|
|
| Aldolase b |
F gccactctcaacctcaatgc |
423 |
55 |
32 |
| |
R
tctccttcccaacctaccac |
|
|
|
| b-actin |
F
tgacggggtcacccacactgtgcc |
666 |
60 |
25 |
| |
R cttagaagcattgcggtggacgatg |
|
|
|
RNA preparation and poly A+ mRNA
preparation Total RNA was extracted with TRIZOL
reagent (Life Technologies, Inc., N.Y., USA). Tissue samples were
homogenized in 1ml of TRIZOL reagent per 50-100 mg of tissue and incubated
for 5 min at room temperature, then 200 ml chloroform was added and
mixed vigorously and incubated at room temperature for 2-3 min. After
centrifugation at 1 2000 rpm for 15 min at 4�C, the aqueous phase was transferred to a fresh tube,
mixed with an equal volume of isopropanol, and incubated at room
temperature for 10 min. Total RNA was collected and washed in 75% ethanol.
Total RNA was run on a denaturing formaldehyde agarose gel to check
quality. Poly A+ RNA was isolated using the oligotex mRNA mini
kit (Qiagen, Hilden, Germany) according to the manufacture�s instructions.
Two hundred micrograms of total RNA was routinely used for mRNA
isolation.
cDNA microarray
hybridization Gene
expression was analyzed using the Human Life Grid 1.0 array (Incyte
Genomics Inc. California, USA). Approximately 8 400 human PCR products
chosen from Incyte Genomics�s library of proprietary clones were girded
onto a 12�22
cm nylon membrane in a double-spotted pattern at a density of
approximately 16 800 spots and 27 controls. 33P-labeled cDNA
probe was generated by reverse transcription of 1 mg of each analyzed polyA+ RNA
sample in the presence of a-33P dCTP and the percent label
incorporation was not less than 40%. Each cDNA probe was then hybridized
to a microarray. Overnight incubation was followed by stringent washing as
recommended by the manual. Membranes were exposed to phosphor screen
overnight. The data were analyzed by Incyte Genomics.
Northern blot and
semi-quantitative RT-PCR All probes were obtained
by amplification of gene fragments by PCR under conditions listed in Table
1. For conventional Northern blot analysis, 15 mg total RNA was fractionated
by electrophoresis through 1% agarose gel containing formaldehyde and
blotted in 20�SSC onto Hybond-N+ nylon membrane (Amersham Pharmacia
Biotech, Ltd. Buckinghamshire, UK) by capillary force overnight. The
blotted RNA was immobilized by incubating at 80�C for 1 h. Hybridization was performed at 68�C in ExpressHyb hybridization buffer (CLONTECH Inc.,
California, USA) for 3 h. Membranes were washed once in 2�SSC, 0.1% SDS at
room temperature, twice in 0.1�SSC, 0.1% SDS at 68�C for 20 min and exposed to X-ray film (Eastman Kodak
Co., Rochester MA) at -80�C for 1-6 d. Three mg total RNA was reverse
transcribed in 20 ml reaction mixture with SuperscripTM II (Life
Technologies Inc., NY., USA). The PCR cycle number at the linear phase of
amplification was chosen to compare differential gene expression among
different genes.
RESULTS Global
gene expression analysis of HCC by high density cDNA microarray
The 33P labeled cDNAs were synthesized by RT
of message RNA from one liver cancerous tissue and adjacent normal liver
tissue from the same patient and used to hybridize to Life Grid 1.0 cDNA
microarray blot. General expression profile of 8400 genes was obtained
(Figure 1A). We first performed a global analysis of gene expression of
8400 genes and compared the gene expression profiles for normal liver and
liver tumor tissues. To eliminate data with low reliability, genes whose
expression was regarded as absent in both normal liver and liver tumor by
software analysis were excluded, and genes for which two spots were
greater than 2.5 fold different and one of the spots was not 2 fold above
background were also excluded. There were 6542 remaining genes in normal
liver and liver tumor tissues. Fold changes in gene expression between
normal liver and liver tumor are shown in Figure 1B. About 92% genes had
no significant expression change. The result reflected the reliability of
the gene expression profile. The scatter plot of intensity of all genes on
arrays of liver tumor and adjacent normal liver was statistically examined
to evaluate the accuracy of experiment (Figure 1C). A high correlation was
observed. This result suggested a high reliability of the experiment for
analysis of differentially displayed genes by cDNA microarray analysis of
this sample.
Characterization of expression
profile of HCC Among the 6542 genes expressed in
paired liver tumor tissue, 256 genes were up-regulated and 267 genes were
down-regulated, which were greater or less than 4 fold in liver tumor
tissue. Known functioning genes differentially expressed (>4 fold) in
HCC were classified into six functional categories with respect to
selected functional properties of their products. The six categories were
included in cell division; cell, organism defense; metabolic enzymes,
transporters ion channels; nuclear proteins; cell structure, extracellular
matrix; cell signaling, communication. The numbers of classified genes are
shown in Table 2. The group of 'other genes' summarized individual genes that could not be
included in any of the above categories.
Figure 1(PDF)
Parallel analysis of gene expression in paired human liver tumor sample
(A). Histogram analysis of fold change in differentially expressed genes
in cDNA microarray (B). Scatterplot of two cDNA microarray analyses of
normal liver and liver tumor samples. Each point stands for a gene with
the X coordinate value as the gene expression level in the normal liver
microarray and the Y coordinate value as the gene expression level in the
liver tumor microarray. A R of 0.81 was produced and suggested high
reliability of the experiments (C).
Table 2 Classification of number of
known functioning genes differentially expressed (>4 folds) in
HCC
| Gene functions |
Number of down-regulated genes in HCC |
Number of up-regulated genes in HCC |
| Cell division |
17 |
14 |
| Cell, organism defense |
39 |
24 |
| Metabolic enzymes,transporters
ion channels |
17 |
9 |
| Nuclear proteins (transcription
factors, DNA processing enzymes) |
21 |
20 |
| Cell structure, extracellular
matrix |
10 |
6 |
| Cell signalling,
communication |
37 |
26 |
| EST |
41 |
53 |
| Other genes |
84 |
102 |
Verification of differentially
expressed genes in cDNA microarray To verify the
data, we then performed Northern blot analysis and RT-PCR analysis. Only
genes with expression levels that were altered by >4 fold between
normal and tumor tissues were selected. These analyses were carried out
with a total 10 paired HCC samples. We identified 4 genes that were
differential expression in >50% paired samples. Three genes were
up-regulated and one was down-regulated. Northern blot analysis of Beclin
1 and RbAp48 mRNA showed a significantly increased expression level in 50%
paired tumor samples (Figure 2), which could not be detected in normal
liver tissues. Northern blot analysis of aldolase b mRNA showed a
significantly decreased expression level in 70% paired tumor samples.
Northern blotting signal of Pir51 was difficult to obtain, the
semi-quantitative RT-PCR carried out in the linear detection range was
used to estimate the relative amount of mRNA. Pir51 mRNA was up-regulated
by RT-PCR analysis in 60% paired tumor samples (Figure 2).
Figure
2(PDF) Northern blots of
RbAp48, Beclin 1 and aldolase b genes in paired liver tumor (T) and normal
liver tissues (N). RT-PCR analysis of Pir51 in the same paired HCC
samples. 18S rRNA shown as a loading control.
In contrast we
investigated the expression of Beclin 1, RbAp48, Pir51 and aldolase b in
one hepato (L02) and 5 hepatoma cells lines by RT-PCR analysis. RbAp48 was
detected in L02, Bel-7404, HepG2, Bel-7402 and HuH7, was undetectable in
SMMC-7721. Beclin 1 was detected in L02, SMMC-7721, Bel-7404, and HepG2,
was weak or undetectable in Bel-7402 and HuH7. Pir51 was expressed in all
of hepatoma cell lines detected excluding HuH7. The data also showed that
only HepG2 cells, most of cells had not, had a weak expression of aldolase
b, (Figure 3). These results from cells coincided with that from tissues
(Figure 2). The data of 4 genes obtained from microarray and Northern bolt
or RT-PCR are summarized in Table 3. The fold changes of the 4 genes by
Northern blot analysis were significantly consistent with cDNA
microarray.
Table
3 Genes showing differential
expression levels in liver cancerous tissue and adjacent normal liver
tissue
| Gene Name |
GenBank
access number |
Density in filter for tumor liver |
Density in filter for normal liver |
Fold change by microarray |
Fold change by Northern blot |
| Beclin 1 |
AF077301 |
6 971 |
0 |
99 |
99 |
| RbAp48 |
X74262 |
14 029.9 |
0 |
99 |
99 |
| aldolase b |
XM_005563 |
2 765 |
26 589 |
-9.65 |
-4.7 |
| Pir51 |
NM_006479 |
8 654.61 |
323.2 |
26.8 |
5.7 |
GenBank access number, density, fold change verified by cDNA
microarray and Northern blot were described.
Figure
3(PDF) RT-PCR analysis of
RbAp48, Beclin 1, Pir51 and aldolase b expression in one hepato (L02) and
5 hepatoma cell lines (SMMC-7721, Bel-7404, HepG2, Bel-7402, HuH7). b-actin was shown as an internal control.
DISCUSSION In
this study, we used cDNA microarray to identify the genes that may play
roles in hepatocarcinogenesis. We demonstrated up- or down-regulated genes
in liver cancerous tissues commonly found in patients, and compared them
with those in adjacent normal tissues. Then we selected several
differentially displayed genes for further verification by Northern blots
or RT-PCR. Four genes (Beclin 1, RbAp48, Pir51 and aldolase b) were
confirmed to have a differential expression pattern in normal and
cancerous liver tissues. The low percentage appeared to be the
heterogeneity of tumors[12]. The genes identified through this
approach are potential candidates for factors implicated in
carcinogenesis, and are useful in both cancer diagnosis and HCC
therapy. Beclin 1 has
been found to be a novel Bcl-2-interacting cellular protein which was
mono-allelically deleted in 40-75% of sporadic human breast cancers and
ovarian cancers[13], and also a mammalian autophagy gene that
could inhibit tumorigenesis and could be expressed at decreased levels in
human breast carcinoma[14]. It has been considered as a tumor
suppressor gene in breast cancer[14,15]. However, our results
showed that the expression of Beclin 1 mRNA was increased in liver tumor
tissues and HCC cell lines and could not be detected in normal liver
tissues. Beclin 1 has an unknown function in HCC. Overexpression of Beclin
1 in neurons in vivo could inhibit Sindbis virus replication, reduce
central nervous system (CNS) apoptosis, and provide protection against
fatal Sindbis virus infection, which might play a role in host defense
against Sindbis virus infection[16]. 80% of HCC patients were
infected with HBV or HCV, increased expression of Beclin 1 might be
induced by the infection of virus. The enhanced expression of Beclin 1 in
HCC provided us important information to further determine its new
biological role.
RbAp48 was isolated as an Rb binding protein[17]. RbAp48
was found to be one of the three subunits of chromatin assembly factor
1[18,19] and components of histone deacetylase
complexes[20,21]. RbAp48 could also interact with a complex of
CREB binding protein and phosphorylated CREB[22]. RbAp48 was
physically associated in the presence of Rb and HDAC1, suggesting that
RbAp48 could be involved in transcription repression of E2F responsive
genes[23]. Binding of RbAp48 correlated with the ability of Rb
to block cell proliferation[17,24]. Furthermore, the C. elegans
homologues of both Rb and RbAp48 were recently cloned as two proteins that
belong to the same Ras-inhibitory way[25]. However, the
mechanisms by which RbAp48 gene product regulated tumor growth are largely
unknown. RbAp48 mRNA was also shown to increase in HCC tissues. Although
the biological significance of this finding needs further study, our
results showed that altered expression of RbAp48 gene might be related to
HCC development. Aldolase
B, fructose-biphosphate Aldolase, an important enzyme for glucose and
fructose metabolism, is a liver-specific gene. Some hepatic genes, for
instance, albumin, ornitin transcarbamylase and transthyretin, were
down-regulated in carcinogenesis of hepatocytes[26,27]. This
down-regulation was mainly attributed to the diminishing of some of
liver-enriched transcription factors (LETF). Kovalenko et
al.[28] reported AlF-C1 enriched in fetal and regenerating
livers, and down-regulated the aldolase B gene promoter in rat hepatoma
cells. In our results, aldolase B was down-regulated in HCC samples and
HCC cell lines, which may reflect the function change of liver cancer from
metabolism to proliferation. Pir51 protein
could strongly interact with human Rad51 recombinase[29].
Eukaryotic Rad51 protein has been reported to play a central role in
homologous recombination by carrying out the pairing of homologous DNA
molecules and initiating the strand exchange reaction[30,31]
and mammalian Rad51 was essential for cell proliferation. Rad51
activity is regulated by its associated proteins. Pir51 protein could bind
to both single and double stranded DNA and was capable of aggregating
DNA[29]. However, functional significance of biochemical
properties of pir51 is unclear. In
conclusion, our data demonstrate that profiling of HCC samples can help
reveal genes that are commonly expressed in HCC. Information from these
studies may be useful in the development of therapeutic drugs for liver
cancer.
ACKNOWLEDGEMENTS
The authors thank Eastern Hepatobiliary Surgery Hospital for
tumor materials and thank Mr. Sui-Quan Wang for reviewing the manuscript
and helpful discussions.
REFERENCES 1 Chen CJ, Yu MW, Liaw YF.
Epidemiological characteristics and risk factors of hepatocellular
carcinoma. J Gastroenterol Hepatol 1997;
12: S294-308 2 Naka T, Toyota N, Kaneko T,
Kaibara N. Protein expression of p53, p21WAF1, and Rb as prognostic
indicators in patients with
surgically treated hepatocellular carcinoma. Anticancer Res 1998; 18:
555-564 3 Wang HT, Kong JP, Ding F,
Wang XQ, Wang MR, Liu LX, Wu M, Liu ZH. Analysis of gene expression
profile induced by EMP-1 in esophageal
cancer cells using cDNA Microarray. World J Gastroenterol 2003; 9:
392-398 3 Liu LX, Liu ZH, Jiang HC, Qu
X, Zhang WH, Wu LF, Zhu AL, Wang XQ, Wu M. Profiling of differentially
expressed genes in human Gastric
carcinoma by cDNA expression array. World J Gastroenterol 2002; 8:
580-585 4 Tan ZJ, Hu XG, Cao GS, Tang
Y. Analysis of gene expression profile of pancreatic carcinoma using cDNA
microarray. World J Gastroenterol 2003;
9: 818-823 5 Debouck C, Goodfellow PN. DNA
microarrays in drug discovery and development. Nat Gene 1999; 21:
48-50 6 Khan J, Saal LH, Bittner ML,
Chen Y, Trent JM, Meltzer PS. Expression profiling in cancer using cDNA
microarrays. Electrophoresis 1999; 20:
223-229 7 Shirota Y, Kaneko S, Honda M,
Kawai HF, Kobayashi K. Identification of differentially expressed genes in
hepatocellular carcinoma with cDNA
microarrays. Hepatology 2001; 33: 832-840 8 Liu LX, Jiang HC, Liu ZH,
Zhou J, Zhang WH, Zhu AL, Wang XQ, Wu M. Integrin gene expression profiles
of human hepatocellular carcinoma. World
J Gastroenterol 2002; 8: 631-637 9 Kawai HF, Kaneko S, Honda M,
Shirota Y, Kobayashi K. alpha-fetoprotein-producing hepatoma cell lines
share common expression profiles of
genes in various categories demonstrated by cDNA microarray analysis.
Hepatology 2001; 33: 676-691
10
Liu LX, Liu ZH, Jiang HC, Zhang WH, Qi SY, Hu J, Wang XQ, Wu M.
Gene expression profiles of hepatoma cell line
HLE. World J Gastroenterol 2003; 9:
683-687 11 Xu L, Hui L, Wang S, Gong J, Jin Y, Wang
Y, Ji Y, Wu X, Han Z, Hu G. Expression profiling suggested a regulatory
role of liver-enriched
transcription factors in human hepatocellular carcinoma. Cancer Res 2001;
61: 3176-3181 12
Aita VM, Liang XH, Murty VV, Pincus DL, Yu W, Cayanis E, Kalachikov
S, Gilliam TC, Levine B. Cloning and
genomic organization of Beclin 1, a
candidate tumor suppressor gene on chromosome 17q21. Genomics 1999; 59:
59-65 13
Liang XH, Jackson S, Seaman M, Brown K, Kempkes B, Hibshoosh H,
Levine B. Induction of autophagy and inhibition
of tumorigenesis by Beclin 1. Nature
1999; 402: 672-676 14
Liang XH, Yu J, Brown K, Levine B. Beclin 1 contains a leucine-rich
nuclear export signal that is required for its
autophagy and tumor suppressor function.
Cancer Res 2001; 61: 3443-3449 15
Liang XH, Kleeman LK, Jiang HH, Gordon G, Goldman JE, Berry G,
Herman B, Levine B. Protection against fatal
Sindbis virus encephalitis by
Beclin, a novel Bcl-2-interacting protein. J Virol 1998; 72:
8586-8596 16
Qian YW, Wang YC, Hollingsworth RE Jr, Jones D, Ling N, Lee EY. A
retinoblastoma-binding protein related to a
negative regulator of Ras in yeast.
Nature 1993; 364: 648-652 17
Verreault A, Kaufman PD, Kobayashi R, Stillman B. Nucleosome
assembly by a complex of CAF-1 and acetylated
histones H3/H4. Cell 1996; 87:
95-104 18
Tyler JK, Bulger M, Kamakaka RT, Kobayashi R, Kadonaga JT. The p55
subunit of Drosophila chromatin assembly
factor 1 is homologous to a
histone deacetylase-associated protein. Mol Cell Biol 1996; 16:
6149-6159 19
Zhang Y, Iratni R, Erdjument-Bromage H, Tempst P, Reinberg D.
Histone deacetylases and SAP18, a novel
polypeptide, are components of a human
Sin3 complex. Cell 1997; 89: 357-364 20
Taunton J, Hassig CA, Schreiber SL. A mammalian histone deacetylase
related to the yeast transcriptional
regulator Rpd3p. Science 1996; 272:
408-411 21
Zhang Q, Vo N, Goodman RH. Histone binding protein RbAp48 interacts
with a complex of CREB binding protein
and phosphorylated CREB. Mol Cell Biol
2000; 20: 4970-4978 22
Nicolas E, Morales V, Magnaghi-Jaulin L, Harel-Bellan A,
Richard-Foy H, Trouche D. RbAp48 belongs to the
histone deacetylase complex that
associates with the retinoblastoma protein. J Biol Chem 2000; 275:
9797-9804 23
Huang S, Lee WH, Lee EY. A cellular protein that competes with SV40
T antigen for binding to the retinoblastoma
gene product. Nature 1991; 350:
160-162 24
Lu X, Horvitz HR. lin-35 and lin-53, two genes that antagonize a C.
elegans Ras pathway, encode proteins similar to
Rb and its binding protein RbAp48. Cell
1998; 95: 981-991 25 Clayton DF, Weiss M, Darnell JE Jr.
Liver-specific RNA metabolism in hepatoma cells: variations in
transcription rates and mRNA
levels. Mol Cell Biol 1985; 5: 2633-2641 26
Herbst RS, Nielsch U, Sladek F, Lai E, Babiss LE, Darnell JE Jr.
Differential regulation of
hepatocyte-enriched transcription
factors explains changes in albumin and transthyretin gene expression
among hepatoma cells. New Biol
1991; 3: 289-296 27
Yabuki T, Miyagi S, Ueda H, Saitoh Y, Tsutsumi K. A novel
growth-related nuclear protein binds and inhibits rat
aldolase B gene promoter. Gene
2001; 264: 123-129 28
Kovalenko OV, Golub EI, Bray-Ward P, Ward DC, Radding CM. A novel
nucleic acid-binding protein that interacts
with human rad51 recombinase. Nucleic
Acids Res 1997; 25: 4946-4953 29
Kowalczykowski SC. Biochemistry of genetic recombination:
energetics and mechanism of DNA strand exchange.
Annu Rev Biophys Biophys Chem
1991; 20: 539-575 30 Radding CM, Helical interactions in
homologous pairing and strand exchange driven by RecA protein. J Biol
Chem 1991; 266: 5355-5358
31
Tsuzuki T, Fujii Y, Sakumi K, Tominaga Y, Nakao K, Sekiguchi M,
Matsushiro A, Yoshimura Y, MoritaT.
Targeted disruption of the Rad51
gene leads to lethality in embryonic mice. Proc Natl Acad Sci USA 1996;
93: 6236-6240
Edited by Zhang JZ and Wang XL
|
|