Dian-Liang Zhang, Jie-Shou Li, Zhi-Wei Jiang, Bao-Jun Yu, Xing-Ming Tang, Research Institute of General Surgery, Jinling Hospital, School of Medicine, Nanjing University, Nanjing 210093, Jiangsu Province, China
Hong-Mei Zheng, Department of Nephrology, the Hospital affiliated with Binzhou Medical College, Binzhou 256603, Shandong Province, China
Supported by the 10^th five-year plan for medicine and health, PLA, No.013012 and is also supported by the General Hospital of Nanjing Command, No.2002059
Correspondence to: Dian-Liang Zhang and Jie-Shou Li, Research Institute of General Surgery, Jinling Hospital, Nanjing 210093, China. phdzdl@yahoo.com
Telephone: +86-25-4825061 Fax: +86-25-4803956
Received: 2002-10-08 Accepted: 2003-01-02

Abstract
AIM: To investigate TNF-a-308 and TNFB polymorphisms in acute biliary pancreatitis (ABP) and to related them to the plasma TNF-a levels.

METHODS: Genomic DNA was prepared from peripheral blood leukocytes. Genotypes and allele frequencies were determined in patients (n=127) and healthy controls (n=102) using restriction fragment length polymorphism analysis of polymerase chain reaction (PCR) products. Reading the size of digested bands from polyacrylamide gel demonstrated the two alleles TNF1 and TNF2, or the two alleles TNFB1 and TNFB2.

RESULTS: The frequencies of TNF2 polymorphism and TNFB2 polymorphism were both similar in patients with mild or severe pancreatitis, so were in pancreatitis patients and in controls. Patients with septic shock showed a significantly higher prevalence of the TNF2 than those without. No significant differences were found in the genotype distribution of TNF-a-308 and TNFB among different groups. Plasma TNF-a levels did not differ significantly in ASBP patients displaying different alleles of the TNF gene studied.

CONCLUSION: Results indicate that TNF gene polymorphisms studied play no part in determination of disease severity or susceptibility to acute biliary pancreatitis; however, TNF2 polymorphism is associated with septic shock from ASBP. Genetic factors are not important in determining plasma TNF-a levels in ASBP.

Zhang DL, Li JS, Jiang ZW, Yu BJ, Tang XM, Zheng HM. Association of two polymorphisms of tumor necrosis factor gene with acute biliary pancreatitis. World J Gastroenterol 2003; 9(4): 824-828
http://www.wjgnet.com/1007-9327/9/824.htm
　

INTRODUCTION
In China and most other countries, gallstones are the most common cause of acute pancreatitis. There are reports that gallstones account for between one third and two thirds of cases, with an average of 40 to 50 %^[1]. Acute severe pancreatitis (ASP) is a serious disease, with highly persistent morbidity and mortality. Generally speaking, the natural course of severe acute pancreatitis progresses in two phases. The first 14 days are characterized by the systemic inflammatory response syndrome resulting from the release of inflammatory mediators. The second stage, beginning approximately 2 weeks after the onset of the disease, is dominated by septic-related complications resulting from infection of pancreatic necrosis or bacteria translocation. Today, with improvements in the care of the critically ill, many patients with ASP survive over early systemic inflammatory response and enter a second phase of illness dominated by sepsis and the consequences of organ failure. More than two thirds of deaths in ASP are due to late septic organ complications^[2]. However, the susceptibility and mechanism of septic shock related to ASP are still unclear.
   Tumor necrosis factor-a (TNF-a), the early cytokine to be released, is a principal mediator of immune responses to endotoxin. It can be produced in large amounts in several organs during ASP and is also believed to mediate pathophysiological changes^[3,4]. Systemic release of TNF-a is associated with septic shock and fatal outcome. TNF-a levels are increased in patients with ASP and septic shock and appear to correlate with clinical outcome.
   Because of its short half-life, the value of TNF-a as a marker of susceptibility or severity for ASP is limited. The production and response of TNF-a are partly regulated at the transcription level, the role of polymorphisms of TNF promoter in determination inflammatory disease susceptibility or as a marker of severity has been the subject of intense research^[5]. There are many single nuclear polymorphisms within the TNF-a gene promoter. The TNF-a gene shows a polymorphism at position -308 in the promoter region. This polymorphism results in two allele forms, 1 in which a guanine defines the common allele TNF1 and 1 in which an adenosine defines the uncommon allele TNF2^[6]. The TNF2 allele has been associated with a variety of inflammatory disorders, including systemic lupus erythematosus, dermatitis herpetiformis, and celiac disease^[7]. Furthermore, TNF2 allele has been found to be a stronger transcription activator than the TNF1 allele^[8-12], resulting in higher TNF-a levels. Moreover, TNF2 polymorphism has been associated with morbidity and mortality of severe forms of cerebral malaria^[13], mucocutaneous leishmaniasis^[14], meningococcal disease^[15] and septic shock^[16].
   A polymorphism is also found at position +252 located in the first intron of the TNFb gene, with a G in the TNFB1 allele and an A in the TNFB2 allele^[17]. In contrast to TNF-a, which is expressed mainly by macrophages, TNFb is expressed and released by lymphocytes. Genes encoding either cytokine are positioned next to each other within the cluster of human leukocyte antigen class III genes on chromosome 6. With respect to high homology and location in the genome, evolutionary studies suggest a common ancestor for both genes that duplicated during evolution. The TNFB1 allele has been associated with a higher TNFb response at both the mRNA and the protein levels^[17]. Furthermore, some studies have found that the TNFB2 allele results in a higher TNF-a secretory capacity than the TNFB1 allele^[8], and higher plasma TNF-a levels^[18], whereas others could not confirm this observation.
   The present study was focused on ABP. The aim was to investigate TNF-a-308 and TNFB polymorphisms in ABP patients, and to related the polymorphisms studied to plasma TNF-a levels.

MATERIALS AND METHODS
Subjects
127 consecutive patients with a first attack of unequivocal acute biliary pancreatitis (ABP) were prospectively considered from January 2001 to August 2002. The diagnosis of acute pancreatitis was based on clinical criteria, an increased -amylase activity (enzymatic colorimetric test) in serum and CT verification of pancreatitis. Etiology of acute pancreatitis was gallstones, in the presence of appropriate radiological of endoscopic retrograde cholangiopancreatography (ERCP) findings. Pancreatitis is classified as severe when APACHE II score is ≥8^[19] and CT severity index ≥4^[20]. Septic shock was defined according to ACCP/SCCM consensus conference criteria^[21]. The control Group came from 102 healthy volunteers. In order to be eligible for the enrollment, all of the subjects from the two groups had to be yellow Chinese Han. The exclusion criteria were defined as follows: (1) age > 75 years; (2) cardiac failure(class>III); (3) liver insufficiency (Child C); (4) White blood cell counts <0.4?09/L; (5) immunosuppression; (6) there was a delay of more than 36 hours from onset of abdominal pain and hospitalization; (7) patients who had clinical, radiological, or ERCP evidence suggestive of a diagnosis of chronic pancreatitis. The study was approved by the local Ethics Committee and informed consent had been obtained from the patient or a close relative.

Measurement of plasma TNF-a concentrations
Peripheral venous plasma samples were collected (EDTA anticoagulation) from only ASBP patients at admission, centrifuged and stored at -70 ℃ before analysis. Plasma TNF-alpha concentrations were measured by enzyme immunoassay kit (Quantikine HS Human TNF-alpha immunoassay. kit, R & D Systems, Inc, Minneapolis, MN). The limit of sensitivity was 2.5 pg/mL.

TNF-a-308 G to A substitution
Each patient's DNA was extracted from whole blood using Wizard Genomic DNA Purification kit (Promega) according to the manufacture's instruction. PCR was used to amplify a 107 basepairs fragment of the TNF-a genomic sequence using primers. Upstream: 5'AGGCAATAGGTTTTGAGGGCCAT 3' downstream: 5'TCCTCCCTGCTCCGATTCCG 3'(Nanjing Bio Eng Co.Ltd.). The following PCR protocol was used: 94 ℃ for 3 minutes; 35 cycles of 94 ℃ for 45 seconds, 60 ℃ for 45 seconds, 72 ℃ for 45 seconds; 72 ℃ for 5 minutes using reagents purchased from Promega on a Gene CyclerTM (BIO-RAD, Japan). The PCR product was digested directly with 2 U NcoI restriction enzyme (Promega) at 37 ℃ for 6 hours. Digested DNA was analyzed on 5 % polyacrylamide gels. Ethidium bromide staining of the gel demonstrated the original 107 basepairs fragment (homozygous patients for allele TNF2, lacking NcoI site), three fragments of 102, 87 and 20 basepairs (heterozygous patients), or two fragments of 87 and 20 basepairs of size (homozygous patients for the allele TNF1), (Figure 1).

TNF-b NcoI polymorphism
A 782 basepairs fragment of the TNF-b genomic sequence, including the polymorphic NcoI site, was amplified using PCR. The following nucleotide sequences were used for PCR amplification^[18]: 5'CCGTGCTTCGTGCTTTGGACTA 3'and 5'AGAGGGGTGGATGCTTGGGTTC3'(Nanjing Bio Eng Co.). The following PCR protocol was used: 95 ℃ for 3 minutes; 37 cycles of 95℃ for 1 minute, 50 ℃ for 1 minute, 72 ℃ for1 minute; 72 ℃ for 5 minutes using reagents purchased from Promega on a Gene CyclerTM (BIO-RAD, Japan). The PCR product was digested directly with 2 U NcoI restriction enzyme (Promega) at 37 ℃ for 6 hours. Digested DNA was analyzed on 5 % polyacrylamide gels. Ethidium bromide staining of the gel demonstrated the original 782 basepairs fragment (homozygous patients for allele TNFB2), three fragments of 782, 586 and 196 basepairs (heterozygous patients), or two fragments of 586 and 196 basepairs of size (homozygous patients for the allele TNFB1), (Figure 2).

Figure 1 (PDF) Lane1 and 4, TNF2 homozygote; Lane 2, TNF1/TNF2 heterozygote; Lane 3, TNF1 homozygote.
Figure 2 (PDF) Lane 1 and 3, TNFB1/TNFB2 heterozygote; Lane 2, TNFB1 homozygote; Lane 4, TNFB2 homozygote.

Statistical analysis
Comparison of allelic and genotype frequencies was examined for statistical significance with chi-square test. Descriptive data of continuous variables were tested by Student's t-test. Plasma TNF-a levels were reported as median ±SD. Analysis was completed by SPSS 10.0, and a 2-tailed P<0.05 was considered statistically significant.

RESULTS
Characteristics of the patients
According to the selected criteria, 61 patients (36 females, males 25) with acute severe pancreatitis were studied. The mean age (±SD) was 54.6±19 years. APACHE II, 11.5±1; CT, 6±1. Of these, 18 had developed septic shock. The APACHE II score and CT score at the time of admission was similar in both septic shock and no septic shock patients. This study was undertaken in selected patients with acute mild biliary pancreatitis (AMBP, n=66) as defined by APOCHE II score^[19] and CT severity index^[20], and matched with ASBP for age, sex, and cause of pancreatitis. Patients with AMBP had an uneventful recovery. The control group included 102 healthy volunteers, the mean age (±SD) was 44.5±10 years. The distribution of gender was 59 females and 43 males.

Two polymorphisms of tumor necrosis factor gene
The frequency distribution of genotypes for TNF polymorphisms studied is shown in Table 1. There was no significant difference in the TNF-308 or TNFB genotype frequency distributions between patients with mild or severe disease. For the TNF-308 polymorphism, TNF2 was found in 18 (29.5 %) of patients with ASBP compared with 17 (25.8 %) of patients with AMBP (x²=0.223, P=0.636). Likewise TNFB2 occurred in 42 (68.9 %) of patients with ASBP compared with 44 (66.7 %) of patients with AMBP (x²=0.147, P=0.702).
   Further there were no significant differences in the TNF-308 or TNFB genotype frequency distributions between patients with ABP and controls (Table 1). As to TNF2 frequency, it was found in 35 (27.6 %) of patients with ABP compared with 26 (25.5 %) of controls (x²=0.124, P=0.725). Likewise TNFB2 occurred in 86 (67.7 %) of patients with ABP compared with 63 (61.8 %) of controls (x²=0.882, P=0.348 respectively).
   TNF2 was found in 9 (50 %) of ASBP patients who developed septic shock compared with 9 (20.1 %) of ASBP patients with no septic shock (x²=5.155, P=0.023). However, TNFB2 occurred in 13 (72.2 %) of ASBP patients with septic shock compared with 29 (67.4 %) of ASBP patients with no septic shock (x²=0.135, P=0.713), (Table 2).

Table 1 Comparison of TNF Genotype among different groups

Note. Comparison by chi-square test. No significant differences were found in the distribution of each genotype frequency [no.(%)] between any of the two groups.

Table 2 Comparison of TNF2 frequency and TNFB2 frequency between septic shock group and no septic shock group

Patients with septic shock showed a significantly higher prevalence of the TNF2 than those without. No such association was seen in TNFB2.

Baseline concentrations of TNF-a at inclusion in ASBP
Plasma TNF-a levels at inclusion were detectable in all of the patients with ASBP and shown in Figure 3. At inclusion, among the 61 patients who were admitted for ASBP, 31 (50.8 %) had an increased concentration of TNF-a (normal value <20 pg/mL). There was no significant difference in baseline concentrations of TNF-a, between ASBP patients who developed septic shock and ASBP patients who didn't.

Figure 3 (PDF) Baseline concentrations of TNF-a at inclusion in ASBP complicated by septic shock or not. P=0.643. No significant differences were found in baseline TNF-a levels between septic shock group and no septic shock group.

Association of two polymorphisms of TNF gene with TNF-a levels
In ASBP patients, no association was found in baseline TNF-a levels between TNF2 carrier and TNF1 carrier (30.73±23.05 vs 25.65±22.63, P=0.430), neither was found between TNFB2 carrier and TNFB1 carrier (25.53±23.71 vs 30.73±20.38, P=0.412), (Figure 4 and Figure 5).

Figure 4 (PDF) Comparison of TNF-a levels (pg/mL) in ASBP patients based on TNF2 allele. No significant difference was found in TNF-a levels between TNF2 carrier and TNF1 carrier.
Figure 5 (PDF) Comparison of TNF-a levels (pg/mL) in ASBP patients based on TNFB2 allele. No significant difference was found in TNF-a levels between TNFB2 carrier and TNFB1 carrier.

DISCUSSION
In the study we have found no association between either TNF-a-308 or TNFB biallelic polymorphism and ASBP or ABP, and thus no evidence that these loci contribute to ASBP susceptibility or severity. This was in line with previous study^{[22, 23]}. However, the distribution of TNF-a-308 polymorphisms within the ASBP patients varied, and TNF2 allele was found significantly more frequently in the septic sock patients than in no septic shock ones (P<0.05). The association between the septic shock patients and TNF polymorphism was restricted to the TNF-a-308 polymorphism (TNF2 allele), no such association being seen with TNFB2. The finding of an apparent association between the TNF-a-308 polymorphism and the septic shock raises the possibility that genetic factors may play a role in controlling the onset of septic shock related to ASBP.
   In our study an increased TNF-a value was documented in 50.8 % of ASBP patients at inclusion. This finding confirms two previous clinical studies in which TNF-a was documented in 29 % to 78 % of patients studied^{[24, 25]}. However, there was no significant difference in baseline TNF-a levels between patients who developed septic shock and patients who didn't. The result suggested that plasma baseline TNF-a level was of little value predicting whether septic shock would occur in ASP.
   In sepsis and other diseases TNF polymorphisms have been associated with morbidity and mortality of severe forms^[13-16,26]. The present study did not found an association in the distribution of either TNF2 allele frequency or TNFB2 allele frequency between ASBP patients and AMBP patients (x²=0.223, P=0.636 and x²=0.147, P=0.702 respectively). The results showed no correlation between the gene polymorphisms studied and disease severity. Comparison of TNF2 allele frequency or TNFB2 allele frequency in patients with ABP and in healthy controls suggested that these polymorphisms studied did not influence disease susceptibility (x²=0.124, P=0.725 and x²=0.882, P=0.348 respectively). However, significant difference was found in TNF2 allele frequencies between septic shock patients and non-septic shock patients (x²=5.155, P=0.023). Indeed, only in severe forms of cerebral malaria^[13], mucocutaneous leishmaniasis^[14], meningococcal disease^[15] and septic shock^[16], were morbidity and mortality linked with TNF2 allele or TNFB2 allele. In mild conditions, no such relationship was found between sepsis and the TNF2 allele^[27]. As to TNF-a-308 and TNFB genotype, there were no significant difference in the distribution of either type between ASBP patients and AMBP patients, neither was found between ABP patients and controls. It suggested that TNF-a-308 genotype and TNFB genotype were both not related to the susceptibility or severity of ABP.
   Although polymorphisms may only be markers of other functionally significant gene polymorphism, at least one of the TNF gene polymorphisms studied is known to have functional significance. It seems that environmental factors trigger cytokine secretion, genetic factors may be important in determining levels of secretion^[28]. In vitro studies have identified that individuals may demonstrate consistent differences in leukocyte cytokine secretion^[29] and that these difference are probably genetically predetermined^[28]. In our study, plasma TNF-a concentrations of ASBP patients with TNF2 allele or TNFB2 allele were not significantly higher than that of patients without TNF2 allele or TNFB2 allele respectively. It suggested that there was no significant correlation between TNF-a concentration and TNF2 or TNFB2 allele carriage. However, many factors could influence plasma TNF-a concentrations. Of these, an important one is its relatively short half-life^[30], so we were at great risk of missing the intravascular secretion of this cytokine. Another reason for low plasma TNF-a concentrations may be the breakdown of TNF-a by enzyme released from pancreas into circulation^{[31, 32]}. Furthermore, this detectable level does not take into account the membrane-bound form of TNF-a. In addition, in complex biologic systems, the effect of a single gene polymorphism in determining cytokine production may be minimized through the interaction of other factors^[33]. Maybe circulating TNF-a levels do not correspond with the TNF2 and TNFB2 polymorphisms, however, circulating TNF-a levels might be under a multifactoral regulatory process. Local TNF-a levels might be of greater importance and under more control by specific polymorphisms.
   To the best of our knowledge, there have two different studies on the association of two polymorphisms of tumor necrosis factor gene with acute severe pancreatitis^{[23, 35]}, and our results are in line with theirs. However, they both failed to study the association of two polymorphisms with septic shock due to ASBP. The finding of our study for the first time, to our knowledge, raise the possibility that TNF2 allele may play some role in the susceptibility of septic shock related to ASBP. However, the role, if any, of genetic factors in influencing the occurrence of septic shock awaits confirmation in further prospective studies. If the association between TNF2 allele and septic shock is confirmed, it would have implications not only for understanding of mechanisms of septic shock from ASBP, but also in the clinical management of patients, with the possibility that TNF2 carriers at high risk of septic shock may be identifiable early in the disease course, allowing early and aggressive therapy to be instituted. In addition, the study offers new opportunities for studying intervention with anti-TNF therapies. Determining a patient's TNF2 genotype before starting the treatment may permit the selection of a TNF2 group of high-risk patients who could benefit from treatment with anti-TNF. Such a possibility deserves further study, since an effective therapy for ASBP patients with septic shock would have important clinical and economic consequences.
   In conclusion, our study demonstrated that there was no association between acute biliary pancreatitis and the two polymorphisms of tumor necrosis factor gene studued; however, TNF2 allele were associated with the susceptibility to septic shock related to acute sever biliary pancreatitis. Genetic factors are not important in determining plasma TNF-a levels in ASBP.

REFERENCES
1    Forsmark CE. The clinical problem of biliary acute necrotizing pancreatitis: epidemioloty, pathophysiology, and diagnosis
      of biliary necrotizing pancreatitis. J Gastrointest Surg 2001; 5: 235
2    Schmid SW, Buchler MW. The role of infection in acute pancreatitis. Gut 1999; 45: 311-316
3    Xia Q, Jiang JM, Gong X, Chen GY, Li L, Huang ZW. Experimental study of Tong Xia purgative method in ameliorating lung
      injury in acute necrotizing pancreatitis. World J Gastroenterol 2000;6: 115-118
4    Grewal HP, Kotb M, el Din AM, Ohman M, Salem A, Gaber L, Gaber AO. Induction of tumor necrosis factor in severe
      acute pancreatitis and its subsequent reduction after hepatic passage. Surgery 1994; 115: 213-221
5    Chiche JD, Siami S, Dhainaut JF, Mira JP. Cytokine polymorphisms and susceptibility to severe infectious disease. Sepsis
      2001; 4: 209-215
6    Wilson AG, de Vries N, Pociot F, di Giovine FS, van der Putte LB, Duff GW. An allelic polymorphism within the human
      tumor necrosis factor a promoter region is strongly associated with HLA A1, B8, and DR3 alleles. J Exp Med
      1993; 177: 557-560
7    McManus R, Wilson AG, Mansfield J, Weir DG, Duff GW, Kelleher D. TNF2, a polymorphism of the tumor necrosis-a
      gene promoter, is a component of the celiac disease major histocompatibility complex haplotype. Eur J Immunol
      1996; 26: 2113-2118
8    Pociot F, Briant L, Jongeneel CV, Molvig J, Worsaae H, Abbal M, Thomsen M, Nerup J, Cambon-Thomsen A. Association
      of tumor necrosis factor (TNF) and class II major histocompatibility complex alleles with the secretion of TNF-a and TNF-b
      by human mononuclear cells: a possible link to insulin-dependent diabetes mellitus. Eur J Immunol 1993; 23: 224-231
9    Kroeger KM, Carville KS, Abraham LJ. The -308 tumor necrosis factor a promotor polymorphism effects transcription.
      Mol Immunol 1997; 34: 391-399
10  Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor
      a promoter on transcriptional activation. Proc Natl Acad Sci USA 1997; 94: 3195-3199
11  Braun N, Michel U, Ernst BP, Metzner R, Bitsch A, Weber F, Rieckmann P. Gene polymorphism at position -308 of
      the tumor-necrosis-factor-alpha (TNF-alpha) in multiple sclerosis and it抯 influence on the regulation of TNF-alpha
      production. Neruosci Lett 1996; 215: 75-78
12  Brinkman BM, Zuijdeest D, Kaijzel EL, Breedveld FC, Verweij CL. Relevance of the tumor necrosis factor alpha (TNF-a)-
      308 promoter polymorphism in TNF alpha gene regulation. J Inflamm 1996; 46: 32-41
13  McGuire W, Hill AV, Allsopp CE, Greenwood BM, Kwiatkowski D. Variation in the TNF-alpha promoter region associated
      with susceptibility to cerebral malaria. Nature 1994; 371: 508-510
14  Cabrera M, Shaw MA, Sharples C, Williams H, Castes M, Convit J, Blackwell JM. Polymorphism in tumor necrosis factor
      genes associated with mucocutaneous leishmaniasis. J Exp Med 1995; 182: 1259-1264
15  Nadel S, Newport MJ, Booy R, Levin M. Variation in the tumor necrosis factor-alpha gene promoter region may be
      associated with death from meningococcal disease. J Infect Dis 1996; 174: 878-880
16  Mira JP, Cariou A, Grall F, Delclaux C, Losser MR, Heshmati F, Cheval C, Monchi M, Teboul JL, Riche F, Leleu G, Arbibe
      L, Mignon A, Delpech M, Dhainaut JF. Association of TNF2, a TNF-alpha promoter polymorphism, with septic shock
      susceptibility and mortality: a multicenter study. JAMA 1999; 282: 561-568
17  Messer G, Spengler U, Jung MC, Honold G, Blomer K, Pape GR, Riethmuller G, Weiss EH. Polymorphic structure of the
      tumor necrosis factor (TNF) locus: an Ncol polymorphism in the first intron of the human TNF-b gene correlates with a
      variant amino acid in position 26 and a reduced level of TNF-b production. J Exp Med 1991; 173: 209-219
18  Stuber F, Petersen M, Bokelmann F, Schade U. A genomic polymorphism within the tumor necrosis factor locus
      influences plasma tumor necrosis factor-a concentrations and outcome of patients with severe sepsis. Crit Care
      Med 1996; 24: 381-384
19  Dominguez-Munoz JE, Carballo F, Garcia MJ, de Diego JM, Campos R, Yanguela J, de la Morena J. Evaluation of the
      clinical usefulness of APACHEII and SAPS systems in the initial prognostic classification of acute pancreatitis: a
      multicenter study. Pancreas 1993; 8: 682-686
20  Balthazar EJ, Robinson DL, Megibow AJ, Ranson JH. Acute pancreatitis: value of CT in establishing prognosis. Radiology
      1990; 174: 331-336
21  Muckart DJ, Bhagwanjee S. American college of chest physicians/society of critical care medicine consensus
      conference definitions of the systemic inflammatory response syndrome and allied disorders in relation to critically
      injured patients. Crit Care Med 1997; 25: 1789-1795
22  Zhang D, Li J, Jiang Z, Yu B, Tang X. Significance of tumor necrosis factor-alpha gene polymorphism in patients with
      acute severe pancreatitis. Zhonghua Yixue Zazhi 2002; 82: 1529-1531
23  Sargen K, Demaine AG, Kingsnorth AN. Cytokine gene polymorphisms in acute pancreatitis. JOP 2000; 1: 24-35
24  de Beaux AC, Goldie AS, Ross JA, Carter DC, Fearon KC. Serum concentrations of inflammatory mediators related to
      organ failure in patients with acute pancreatitis. Br J Surg 1996; 83: 349-353
25  Brivet FG, Emilie D, Galanaud P. Pro- and anti-inflammatory cytokines during acute severe pancreatitis: an early and
      sustained response, although unpredictable of death. Parisian Study Group on Acute Pancreatitis. Crit Care Med
      1999; 27: 749-755
26  Majetschak M, Flohe S, Obertacke U, Schroder J, Staubach K, Nast-Kolb D, Schade FU, Stuber F. Relation of a TNF
      Gene Polymorphism to Severe Sepsis in Trauma Patients. Ann Surg 1999; 230: 207-214
27  StÜber F, Udalova IA, Book M, Drutskaya LN, Kuprash DV, Turetskaya RL, Schade FU, Nedospasov SA. -308 tumor
      necrosis factor (TNF) polymorphism is not associated with survival in severe sepsis and is unrelated to
      lipopolysaccharide inducibility of the human TNF promotor. J Inflam 1996; 46: 42-50
28  Westendorp RG, Langermans JA, Huizinga TW, Elouali AH, Verweij CL, Boomsma DI, Vandenbroucke JP, Vandenbrouke
      JP. Genetic influence on cytokine production and fatal meningococcal disease. Lancet 1997; 349: 170-173
29  van der Linden MW, Huizinga TW, Stoeken DJ, Sturk A, Westendorp RG. Determination of tumor necrosis factor-alpha
      and interleukin-10 production in a whole blood stimulation system: assessment of laboratory error and individual variation.
      J Immunol Methods 1998; 218: 63-71
30  Kaufmann P, Tilz GP, Lueger A, Demel U. Elevated plasma levels of soluble tumor necrosis factor receptor (sTNFp60)
      reflect severity of acute pancreatitis. Intensive Care Med 1997; 23: 841-848
31  Steer ML. How and where does acute pancreatitis begin? Arch Surg 1992; 127: 1350-1353
32  Dominguez-Munoz JE, Carballo F, Garcia MJ, de Diego JM, Rabago L, Simon MA, de la Morena J. Clinical usefulness
      of polymorphonuclear elastase in predicting the severity of acute pancreatitis: results of a multicentre study. Br J Surg
      1991; 78: 1230-1234
33  Powell JJ, Fearon KC, Siriwardena AK, Ross JA. Evidence against a role for polymorphisms at tumor necrosis factor
      interleukin-1 and interleukin-1 receptor antagonist gene loci in the regulation of disease severity in acute pancreatitis.
      Surgery 2001; 129: 633-640

Edited by Ren SY