P.O.Box 2345, Beijing 100023,China World J Gastroenterol  2003 Mar 15;9(3):513-515
Email:   wjg@wjgnet.com WJG  ISSN 1007-9327  CN 14-1219/ R
http://   www.wjgnet.com Copyright © 2003 by The WJG Press

Expression of RNase H of human hepatitis B virus polymerase in Escherichia coli

Hong Cheng, Hui-Zhong Zhang, Wan-An Shen, Yan-Fang Liu, Fu-Cheng Ma 


Hong Cheng, Yan-Fang Liu, Fu-Cheng Ma, Department of Pathology, Xijing Hospital, Fourth Military Medical University, Xi'an 710033, Shaanxi Province, China
Hui-Zhong Zhang, Wan-An Shen, Orthopedics Oncology Institute of Chinese PLA, Fourth Military Medical University, Tangdu Hospital, Xi'an 710038, Shaanxi Province, China
Correspondence to: Dr. Hong Cheng, Department of Pathology, Xijing Hospital, Fourth Military Medical University, Xi'an 710033, Shaanxi Province, China. nelson@fmmu.edu.cn
Telephone: +86-29-3375497
Received: 2002-10-17 Accepted: 2002-11-16


Abstract
AIM:
To amplify HBV-RNase H gene fragment and expression of RNase H for further use in the studies of HBV associated liver diseases.

METHODS: The encoding gene of HBV-RNase H was separately amplified for the first half and second half (H1 and H2) by PCR from full length HBV gene and cloned into pT7Blue-T vector. Clones were first screened by digestion with XbaI and Hind III enzyme for the correct size, and analyzed further by DNA sequencing. The RNase H1 and H2 fragments isolated from XbaI and Hind III digestion products of pT7 Blue-RNase H plasmid were ligated to the GSTag expressing vectors separately, and expressed in E.coli BL21. The expressed proteins were checked by PAGE gel and Western blot.

RESULTS: Both H1 and H2 nucleotide seqences consisting of known genes and proteins, in correct size, were further confirmed by Western blot to be the GST and RNase H1 or H2 fusion proteins.

CONCLUSION: The successful cloning and expression of HBV-RNase H will contribute to further research and application in HBV-associated diseases.

Cheng H, Zhang HZ, Shen WA, Liu YF, Ma FC. Expression of RNase H of human hepatitis B virus polymerase in Escherichia coli. World J Gastroenterol 2003; 9(3): 513-515
http://www.wjgnet.com/1007-9327/9/513.htm
 

INTRODUCTION
Human hepatitis B virus (HBV) infection has a wide range of clinical outcomes, from self-limited silent or acute infection to fulminant hepatitis. It has been estimated that over 300 million cases of chronic HBV infection exist globally[1]. In China, nearly 100 million people have a persistent infection with HBV, who are at risk of developing chronic hepatitis leading to liver cirrhosis and hepatocellular carcinoma[2-6]. Significant advances have been made during the last few years in the treatment of chronic hepatitis B[7-13]. Several new antiviral agents have been shown to be safe and effective in inhibiting HBV replication[14-20]. However, it has remained refractory to the treatment since not all patients respond properly and still there is no breakthrough results in therapeutic vaccine[21-23]. The increase of chronic hepatitis and hepatocellular carcinoma associated with the HBV infection has become a worldwide medical problem.
   HBV replication is accomplished by its own polymerase. Hepadnavirus polymerases are multifunctional enzymes that play critical roles during the viral life cycle[24]. Ribonuclease H (RNase H), the HBV RNaseH domain of HBV polymerase, is one of the four domains (Terminal, Spacer, Reverse Transcriptase and RNase H) encoded by HBV polymerase gene. With 480 bp in full length and encoding a 16ku protein which is responsible for degrading RNA from RNA-DNA intermediate, HBV-RNase H plays a pivotal role in the HBV life cycle. Although the rest of HBV encoded antigen rather than RNase H has been studied in detail[25-30], there is less paper about HBV-RNase H which is intimately related with HBV replication. To explore the potential use of HBV-RNase H in the diagnosis and treatment of HBV associated liver diseases, we cloned and expressed RNase H of the HBV polymerase.

MATERIALS AND METHODS
Materials
pTKHH2 plasmid containing the full length HBV genomic DNA of subtype adw2 was kindly provided by Dr. Lingxun Duan in Thomas Jefferson University (Philadelphia PA). The primers with restriction enzyme site XbaI at 5'end and HindIII at 3'end used to amplify HBV-RNase H gene was synthesized in Gibco Inc. pT7Blue cloning vector, DH5a competent cells, GSTag expression vector and anti-GST antibody were products of Novagen Inc.

Plasmid construction[31,32]
Two pairs of primers were used in PCR reactions to amplify the first half (H1 1-240) and the second half (H2 241-480) fragments of RNase H gene from pTKHH2 plasmid (P1: 5'TTCTAGACCGGCCAGGTCTGTGCCAAGTG-3' P2: 5'AAG CTTACCAGTTGGCAGCACAGCCTAG-3'for H1; and P3: 5'TTCTAGACA TCCTGCGCGGGACGTCCTTTG-3' P4: 5'AAGCTTAATGCGGTGGTCTCCA TGCG-3'for H2). The amplified H1 and H2 fragments were purified on a 15 g/L low-melting agarose gel, utilizing the PCR purification system (Promega Inc). The purified PCR products were directly ligated into the pT7 Blue-T vector respectively. After transformation of the Escherichia coli strain DH5a, recombinants were selected on x-Gal plates. Ten white colonies were selected for minipreparation and the insert evaluation was by enzyme digestion and DNA sequncing. The plasmids with proper inserts were recut with XbaI and HindIII enzyme and ligated into pGSTag vector. The pGSTag containing H1 or H2 fragment were transformed into BL21 Escherichia coli strain and propogated in LB midium.

Expression[33] and identification of HBV-RNaseH
Picked the recombinant colonies and grew them overnight at 37 in 3 mL of LB medium. Removed 1 mL culture and inoculated into 100 mL of fresh LB medium and grew at 37 to an A600 of 0.6. Added 100 mmol/L IPTG to the bacterial culture to a final concentration of 0.3 mmol/L and incubated the culture for an additional 3-4 h. Pelletized the cells by centrifuging at 12 000 g for 3 min and resuspending the bacterial pellet in 3 mL lysis buffer. After the bacteria lysised by ultrasonic machine, the fusion proteins were purified with glutathione Sepharose 4B column and identified by PAGE gel stained with Coomassie blue and further confirmed by Western blot.

RESULTS
Recombinant expression vectors of pGSTag containing Cloned HBV RNase H1 and H2 fragments were identified by restriction enzyme digestion and DNA sequencing and the results showed that the inserted DNA fragment were expected known sequences. The expressed proteins could be seen in Coomassie blue stained PAGE gel with 34 ku band (Figure 1) which were further confirmed by Western blot as GST and HBV RNase H fusion protein.

Figure 1 (PDF) PAGE Electrophoresis stained with Coomassie brilliant blue light. 1: Protein MW standards; 2: RNaseH1 protein (34 ku); 3: RNaseH2 protein (34 ku).

DISCUSSION
Genome replication of hepadnavirus proceeds by reverse transcription from a viral pregenomic RNA template by a virally encoded polymerase, a polypeptide of 90 to 97 ku[34]. The genome of all hepadnaviruses has the open reading frame, the polymerase gene, and the product or products of this polymerase gene are involved in multiple functions of the viral life cycle. These functions include a priming activity which initiates minus-strand DNA synthesis, a polymerase activity which synthesizes DNA by using either RNA or DNA templates (reverse transcriptase), a nuclease activity which degrades the RNA strand of RNA-DNA hybrids (RNase H), and involvement in packaging the RNA pregenome into nucleocapsids[35].
   Molecular genetic studies have revealed that the human HBV polymerase protein, a polypeptide of about 94 ku, which plays a critical role in the HBV life cycle, contains four domains. These are the 5'-terminal protein (TP), spacer, RNA reverse transcriptase (RT)/DNA polymerase, and RNase H, respectively, from the amino (N) to carboxy (C) terminus[36-42]. All of the TP and RT and RNase H, rather than spacer protein, play an important role in the process of HBV replication. The RNase H, as it functions in all other retrovirus, can degrade the RNA of DNA-RNA hybrid which plays a role in optimizing the priming of minus-strand DNA synthesis[43]. We had constructed an expression vector containing full length of HBV RNase H DNA and we failed to propogate the transformed bacteria, which might be caused by the toxic effect of RNase H activation as Lee Yi reported[44] earlier. So we redesigned two pairs of primers to clone and expressed with two separate fragments of the RNase H. The successfully expressed RNase H and its function which will be performed in our next experiment will contribute to further generating anti-RNase H antibody producing hybridoma cells for the purpose of HBV related liver diseases gene therapy. It has been confirmed that RNase H can be used as a marker to reflect the low level virus replication without other positive markers[45], so to investigate and analyze the results of anti-HBV RNase H might be able to provide a new marker for the early diagnosis of HBV infection and to assess the effects of clinical therapy of HBV infection diseases.

REFERENCES
1    Pramoolsinsup C. Management of viral hepatitis B. J Gastroenterol Hepatol 2002; 17 (Suppl): S125-145
2    Wang PZ, Zhang ZW, Zhou YX, Bai XF. Quantitative PCR detection of HBV-DNA in patients with chronic hepatitis B and
      its significance. Shijie Huaren Xiaohua Zazhi 2000; 8: 755-758
3    Shi H, Wang FS. Host factors in chronicity of hepatitis B virus infection and their significances clinic alh. Shijie Huaren
      Xiaohua Zazhi 2001; 9: 66-69
4    Wang Y, Liu H, Zhou Q, Li X. Analysis of point mutation in site 1896 of HBV precore and its detection in the tissues and
      serum of HCC patients. World J Gastroenterol 2000; 6: 395-397
5    Li Y, Su JJ, Qin LL, Yang C, Luo D, Ban KC, Kensler TW, Roebuck BD. Chemopreventive effect of oltipraz on AFB1-
      induced hepatocarcino- genesis in tree shrew model. World J Gastroenterol 2000; 6: 647-650
6    De Clercq E. Highlights in the development of new antiviral agents. Mini Rev Med Chem 2002; 2: 163-175
7    Du DW, Zhou YX, Feng ZH, Li GY, Yao ZQ. Study on immunization of anti-subcutaneous transplanting tumor induced by
      gene vaccine. Shijie Huaren Xiaohua Zazhi 1999; 7: 955-957
8    Du DW, Zhou YX, Feng ZH, Yao ZQ, Li GY. Immune responses to interleukin 12 and hepatitis B gene vaccine in H2 d
      mice. Shijie Huaren Xiaohua Zazhi 2000; 8: 128-130
9    Wang QC, Zhou YX, Yao ZQ, Feng ZH. Effects of DNA vector constructs and different genes on the induction of
      immune responses by HBV DNA based vaccine. Shijie Huaren Xiaohua Zazhi 2000; 8: 289-291
10  Huang ZH, Zhuang H, Lu S, Guo RH, Xu GM, Cai J, Zhu WF. Humoral and cellular immunogenecity of DNA vaccine based
      on hepatitis B core gene in rhesus monkeys. World J Gastroenterol 2001; 7: 102-106
11  Liu HB, Meng ZD, Ma JC, Han CQ, Zhang YL, Xing ZC, Zhang YW, Liu YZ, Cao HL. A 12-year cohort study on the efficacy
      of plasma-derived hepatitis B vaccine in rural newborns. World J Gastroenterol 2000; 6: 381-383
12  Li H, Wang L, Wang SS, Gong J, Zeng XJ, Li RC, Nong Y, Huang YK, Chen XR, Huang ZN. Research on optimal
      immunization strategies for hepatitis B in different endemic areas in China. World J Gastroenterol 2000; 6: 392-394
13  Zeng XJ, Yang GH, Liao SS, Chen AP, Tan J, Huang ZJ, Li H. Survey of coverage, strategy and cost of hepatitis B vaccination
      in rural and urban areas of China. World J Gastroenterol 1999; 5: 320-323
14  Liu P, Hu YY, Liu C, Zhu DY, Xue HM, Xu ZQ, Xu LM, Liu CH, Gu HT, Zhang ZQ. Clinical observation of salvianolic acid B
      in treatment of liver fibrosis in chronic hepatitis B. World J Gastroenterol 2002; 8: 679-685
15  Jin J, Yang JY, Liu J, Kong YY, Wang Y, Li GD. DNA immunization with fusion genes encoding different regions of hepatitis
      C virus E2 fused to the
 gene for hepatitis B surface antigen elicited immune responses to both HCV and HBV. World
      J Gastroenterol 2002; 8: 505-510
16  Guan XJ, Guan XJ, Wu YZ, Jia ZC, Shi TD, Tang Y. Construction and characterization of an experimental ISCOMS-
      based hepatitis B polypeptide vaccine. World J Gastroenterol 2002; 8: 294-297
17  Hussain M, Lok AS. Mutations in the hepatitis B virus polymerase gene associated with antiviral treatment for hepatitis B.
      J Viral Hepat 1999; 6: 183-194
18  Stuyver L, Van Geyt C, De Gendt S, Van Reybroeck G, Zoulim F, Leroux-Roels G, Rossau R. Line probe assay for
      monitoring drug resistance in hepatitis B virus-infected patients during antiviral therapy. J Clin Microbiol 2000; 8: 702-707
19  Liu P, Liu C, Xu LM, Xue HM, Liu CH, Zhang ZQ. Effects of Fuzheng Huayu 319 recipe on liver fibrosis in chronic hepatitis
      B. World J Gastroenterol 1998; 4: 348-353
20  Zoulim F. Detection of hepatitis B virus resistance to antivirals. J Clin Virol 2001; 21: 243-253
21  Honorati MC, Facchini A. Immune response against HBsAg vaccine. World J Gastroenterol 1998; 4: 464-466
22  Li H, Li RC, Liao SS, Yang JY, Zeng XJ, Wang SS. Persistence of hepatitis B vaccine immune protection and response
      to hepatitis B booster immunization. World J Gastroenterol 1998; 4: 493-496
23  Gao FG, Sun WS, Cao YL, Zhang LN, Song J, Li HF, Yan SK. HBx DNA probe preparation and its application in study
      of hepatocarcinogenesis. World J Gastroenterol 1998; 4: 320-322
24  Zu Putlitz J, Lanford RE, Carlson RI, Notvall L, de la Monte SM, Wands JR. Properties of monoclonal antibodies directed
      against hepatitis B virus polymerase protein. J Virol 1999; 73: 4188-4196
25  Lin X, Yuan ZH, Wu L, Ding JP, Wen YM. A single amino acid in the reverse transcriptase domain of hepatitis B virus
      affects virus replication efficiency. J Virol 2001; 75: 11827-11833
26  Lott L, Beames B, Notvall L, Lanford RE. Interaction between hepatitis B virus core protein and reverse transcriptase.
      J Virol 2000; 74: 11479-11489
27  Laras A, Koskinas J, Hadziyannis SJ. In vivo suppression of precore mRNA synthesis is associated with mutations in
      the hepatitis B virus core promoter. Virology 2002; 295: 86-96
28  Laras A, Koskinas J, Avgidis K, Hadziyannis SJ. Incidence and clinical significance of hepatitis B virus precore gene
      translation initiation mutations in e antigen-negative patients. J Viral Hepat 1998; 5: 241-248
29  Stuyver LJ, Locarnini SA, Lok A, Richman DD, Carman WF, Dienstag JL, Schinazi RF. Nomenclature for antiviral-
      resistant human hepatitis B virus mutations in the polymerase region. Hepatology 2001; 33: 751-757
30  Kim Y, Hong YB, Jung G. Hepatitis B virus: DNA polymerase activity of deletion mutants. Biochem Mol Biol
      Int 1999; 47: 301-308
31  Cheng H, Liu YF, Zhang HZ, Zhang SZ. Construction and expression of anti-HCC immunotoxin of sFv-TNF-
a and GFP
      fusion proteins. Shijie Huaren Xiaohua Zazhi 2001; 9: 640-644
32  Cheng H, Liu YF, Zhang HZ, Shen WA. Construction of the recombinant retroviral vector encoding anti-HCC single-
      chain bifunctional antibody and establishment of a stable virus producing PA317 cell line. Shijie Huaren Xiaohua
      Zazhi 2000; 8: 708-709
33  Lee YI, Hong YB, Kim Y, Rho HM, Jung G. RNase H activity of human hepatitis B virus polymerase expressed in Escherichia
      coli. Biochem Biophys Res Commun 1997; 233: 401-407
34  Li Z, Tyrrell DL. Expression of an enzymatically active polymerase of human hepatitis B virus in an
      coupled transcription-translation system. Biochem Cell Biol 1999; 77: 119-126
35  Chen KL, Chen CM, Shih CM, Huang HL, Lee YH, Chang C, Lo SJ. Hepatitis B viral polymerase fusion proteins are
      biologically active and can interact with the hepatitis C virus core protein in vivo. J Biomed Sci 2001; 8: 492-503
36  Villamil FG. Hepatitis B: Progress in the last 15 years. Liver Transpl 2002; 8(10 Suppl 1): S59-66
37  Chen Y, Marion PL.Amino acids essential for RNaseH activity of hepadnaviruses are also required for efficient elongation
      of minus-strand viral DNA. J Virol 1996; 70: 6151-6156
38  Lok AS, Hussain M, Cursano C, Margotti M, Gramenzi A, Grazi GL, Jovine E, Benardi M, Andreone P. Evolution of hepatitis
      B virus polymerase gene mutations in hepatitis B e antigen-negative patients receiving lamivudine therapy.
      Hepatology 2000; 32: 1145-1153
39  Torresi J. The virological and clinical significance of mutations in the overlapping envelope and polymerase genes of hepatitis
      B virus. J Clin Virol 2002; 25: 97
40  Cerritelli SM, Fedoroff OY, Reid BR, Crouch RJ. A common 40 amino acid motif in eukaryotic Rnases H1 and caulimovirus
      ORF VI proteins binds to duplex RNAs. Nucleic Acids Res 1998; 26: 1834-1840
41  Wakil SM, Kazim SN, Khan LA, Raisuddin S, Parvez MK, Guptan RC, Thakur V, Hasnain SE, Sarin SK. Prevalence and profile
      of mutations associated with lamivudine therapy in Indian patients with chronic hepatitis B in the surface and polymerase
      genes of hepatitis B virus. J Med Virol 2002; 68: 311-318
42  Kim Y, Hong YB, Jung G. Hepatitis B virus: DNA polymerase activity of deletion mutants. Biochem Mol Biol
      Int 1999; 47: 301-308
43  Li Z, Tyrrell DL. Expression of an enzymatically active polymerase of human hepatitis B virus in an
      coupled transcription-translation system.Biochem Cell Biol 1999; 77: 119-126
44  Kim Y, Jung G. Active human hepatitis B viral polymerase expressed in rabbit reticulocyte lysate system.Virus
      Genes 1999; 19: 123-130
45  Yuki N, Hayashi N, Kasahara A, Katayama K, Ueda K, Fusamoto H, Kamada T. Detection of antibodies against the
      polymerase gene product in hepatitis B virus infection. Hepatology 1990; 12: 193-198

Edited by Wu XN