|
Diego
Flichman, Veronica Kott, Rodolfo Campos, Catedra de Virologia,
Facultad de Farmacia y Bioquimica, Universidad de Buenos Aires,
Argentina
Silvia Sookoian, Unidad de Higado, Hospital "Dr.Cosme
Argerich", Argentina
Supported by the grants from the Universidad de Buenos Aires (SECyT-UBA,
TB14), Consejo Nacional de Investigaciones CientÍficas
y Técnicas
(CONICET, PIP723), Agencia Nacional de PromociÓn
Científica
y TecnolÓgica
(ANPCyT, PICT 01610) and Ministerio de Salud PÚblica
de la NaciÓn (Beca
Carrillo-Oñativia)
Correspondence to: Dr. Rodolfo Campos, Facultad de Farmacia y
Bioquimica, Junin 956, 4th floor, (1113), Capital Federal,
Argentina. rcampos@ffyb.uba.ar
Telephone: +5411-49648264
Fax: +5411-45083645
Received: 2003-02-26
Accepted: 2003-03-16
Abstract
AIM: To analyze the molecular evolution of different viral
genomic regions of HCV in an acute HCV infected patient chronically
infected with HIV through a 42-month follow-up.
METHODS:
Serum samples of a chronically HIV infected patient that
seroconverted to anti HCV antibodies were sequenced, from the event
of superinfection through a period of 17 months and in a late sample
(42nd month). Hypervariable genomic regions of HIV (V3
loop of the gp120) and HCV (HVR-1 on the E2 glycoprotein gene) were
studied. In order to analyze genomic regions involved in different
biological functions and with the cellular immune response, HCV core
and NS5A were also chosen to be sequenced. Amplification of the
different regions was done by RT-PCR and directly sequenced.
Confirmation of sequences was done on reamplified material.
Nucleotide sequences of the different time points were aligned with
CLUSTAL W 1.5, and the corresponding amino acid ones were deduced.
RESULTS:
Hypervariable genomic regions of both viruses (HVR1 and gp120 V3
loop) presented several nonsynonymous changes but, while in the
gp120 V3 loop mutations were detected in the sample obtained right
after HCV superinfection and maintained throughout, they occurred
following a sequential and cumulative pattern in the HVR1. In the
NS5A region of HCV, two amino acid changes were detected during the
follow-up period, whereas the core region presented several amino
acid replacements, once the HCV chronic infection had been
established.
CONCLUSION:
During the HIV-HCV superinfection, each genomic region analyzed
shows a different evolutionary pattern. Most of the nucleotide
substitutions observed are non-synonymous and clustered in
previously described epitopes, thus suggesting an immune-driven
evolutionary process.
Flichman
D, Kott V, Sookoian S, Campos R. Acute hepatitis C in a chronically
HIV-infected patient: Evolution of different viral genomic regions.
World J Gastroenterol 2003;
9(7): 1496-1500
http://www.wjgnet.com/1007-9327/9/1496.asp
INTRODUCTION
It has been proven that patients with HIV infection are
frequently coinfected with other viruses, including that of HCV.
Both HIV and HCV share the same route of transmission, and thus,
coinfection with these two viruses is rather common among
intravenous drug users or transfused patients[1, 2]. HCV
infection is considered as an HIV opportunistic disease[3].
The
clinical impact of HIV-HCV coinfection has been widely studied[4].
However, the viral molecular interaction during the establishment of
HCV superinfection is not yet well understood as the acute phase is
frequently a subclinical event.
HCV, an
RNA virus, shows a marked variability but nucleotide substitutions
are unevenly distributed along the entire genome[5]. HCV
diversity is the greatest in the envelope proteins E1 and E2,
especially in a 27 amino-acid segment at the N-terminus of E2
designated hypervariable region 1 (HVR1). The variation of this
region is thought to be related to the maintenance of persistent
infection by emerging escape variants[6] and it is
considered as the main target for humoral immunity as well as an
immunologic decoy[7].
A
similar degree of heterogeneity is found within the gp120 V3 loop
region of HIV, an RNA virus that also causes persistent infections
in the host. This region has been found to elicit neutralizing
antibodies as well as cytotoxic and Th-cell responses, properties
that are also ascribed to the HVR1[8].
NS5A
is an HCV nonstructural protein that is associated with several
functions such as being an in vitro transcriptional repressor[9]
and tightly associated via the "interferon
sensitivity determining region" (ISDR), with the subversion of
the IFN activity. ISDR inhibits the cellular double-stranded
RNA-activated protein kinase R[10], an effector of the
IFN antiviral activity. There is also evidence that the C-terminal
domain of NS5A including the ISDR contains transcriptional activity[11],
suggesting that NS5A might function as a viral transactivator. The
core gene is located in the 5' end of the HCV genome and its primary
function is to form the viral nucleocapsid. The core protein has
many effects on host-cell signalling pathways that includes the
host-cell gene expression[12], apoptosis by interaction
with the cytoplasmic tail of the lymphotoxin receptor and with TNF
receptor[13, 14], transforming activity[15],
modulation of lipid metabolism[16, 17]. Several studies
have shown that the region contains multiple and highly immunogenic
humoral[18, 19] and cellular [19, 20] epitopes.
In a
previous report we described the in vivo down regulation of HIV
replication in an HIV-infected patient after HCV superinfection[21].
Herein we presented a further study of this patient through the
analysis of hypervariable regions of both viruses, and the less
variable core and NS5A regions of HCV.
MATERIALS
AND METHODS
Patient
A 16 year-old HIV patient was referred to the Liver Unit
because of an acute hepatitis-like illness with the manifestations
of jaundice, nausea, abdominal pain, fever, diarrhea, itching and
elevated ALT and AST levels. She was in the 30th week of gestation
and her prenatal course had been uneventful until this episode.
Diagnosis of acute hepatitis C was established by seroconversion of
HCV antibodies by an EIA test (HCV EIA 2.0; Ortho Diagnostics) and
confirmed with a strip immunoblot assay (RIBA HCV 2.0; Chiron
Corporation). HIV and HCV were thought to be acquired by intravenous
drug use. Serum HCV and HIV RNAs were detected by RT-PCR using
primers for the 5NC and the gag regions, respectively[21]
(Table 1).
Thereafter,
the patient was followed up for 42 months and serum samples were
taken monthly during the first 17 months of the analyzed period and
in the 42nd month as a late specimen. Serum samples
before HCV superinfection were also available. Liver function tests
(AST, ALT, g-glutamyl-transferase,
alkaline phosphatase, albumin, gamma globulin, bilirubin and
prothrombin time) were routinely performed using automatic standard
procedures.
A
liver biopsy was obtained at the 15th month of follow-up
showing a histological picture of chronic hepatitis (Knodell score
5) without fibrosis.
No
antiviral therapy was implemented during the study period because of
the patient's refusal.
This study followed the ethical standards of the World Medical
Association Helsinki Declaration adopted in 1964 and amended in 1996
and was approved by the local Ethics Committee. At all times,
written consents were obtained from the woman.
Table 1
Oligonucleotide primers used to amplify various HIV and HCV regions
| Viral
region |
Nucleotide
position |
Primer
sequence (5'→3') |
PCR
cycling parameters |
| HIV |
|
|
5
min at 94 °C, 40 cycles of |
| gag |
|
|
30 s
at 94°C, 30 s at 55°C and |
| OS |
4653-4675 |
CCCTACAATCCCCAAAGTCAAGG |
45 s
at 72°C and a final |
| OA |
4956-4976 |
TACTGCCCCTTCACCTTTCCA |
extension
of 7 min at 72 °C |
| V3
loop |
|
|
|
| OS |
6957
- 6976 |
GTACAATGTACACATGGAAT |
|
| OA |
7357
- 7376 |
GTAGAAAAATTCCCCTCCAC |
Idem
HIV-gag PCR |
| IS |
7010
- 7029 |
TGGCAGTCTAGCAGAAGAAG |
|
| IA |
7319
- 7339 |
ACAATTTCTGGGTCCCCTCCT |
|
| HCV |
|
|
|
| 5UT |
|
|
|
| OS |
44 -
69 |
CCTGTGAGGAACTACTGTCTTCACGC |
Idem
HIV-gag PCR |
| OA |
321
- 341 |
GGTGCACGGTCTACGAGACCT |
|
| HVR1 |
|
|
|
| OS |
1273-1296 |
GCCATATAACGGGTCACCGCATGG |
|
| OA |
1681-1704 |
TCTCAGGACAGCCTGAAGMGTTGA |
Idem
HIV-gag PCR |
| IS |
1296-1379 |
GCATGGGATATGATGATGAACTGG |
|
| IA |
1623-1646 |
GGTGTTGAGGCTATCATTGCARTT |
|
| core |
|
|
5
min at 94 °C, 30 cycles of |
| OS |
272
- 291 |
CGAAAGGCCTTGTGGTACTG |
1
min at 94 °C, 1 min at 50 °C |
| OA |
1020
- 1037 |
CTCGCGRACGCAAGGGAC |
and
2 min at 72 °C and a final |
| IS |
281
- 302 |
TTGTGGTACTGCCTGATAGGGT |
extension
of 10 min at 72 °C |
| IA |
956
- 976 |
ATACTCGAGTTAGGGCAATCA |
|
| NS5A |
|
|
|
| OS |
6716
- 6739 |
TAGATGGGGTGCGCCTGCAYAGGTT |
|
| OA |
7310
- 7332 |
GCTTCTTCCGRGGCGGAGGCACWG |
Idem
HCV core PCR |
| IS |
6734-6753 |
TAGGTTTGCGCCCCCCTGMA |
|
| IA |
7287-7306 |
GGGGACYKTGGAGGTGGAAG |
|
Notes: OS: outer
sense primer; OA: outer antisense; IS: inner sense; IA: inner
antisense. Nucleotide positions were according to HIVHXB2 (K03455)
for the HIV region and to HCV-1 (M62321) for HCV regions. Degenerate
bases were indicated with standard codes of the International Union
of Pure and Applied Chemistry.
Methods
RNA extraction RNA
was recovered from 150 ml
aliquots as described by Chomczynski and Sacchi[22] using
components from a commercially available RNA extraction kit (Trizol,
Life Technologies) and resuspended in 20 ml
dH2O.
cDNA synthesis and PCRs
RNA was used as templates in randomly primed reverse
transcription reactions to produce cDNA in the following conditions:
50 mM TrisHCl (pH 8.3), 25 mM KCl, 3 mM MgCl2, 0.1 mM DTT,
1.0 mM dNTPs, 18 U RNasin ribonuclease inhibitor (Promega) and 100 U
Moloney murine leukemia virus RT (Life Technologies). The reactions
were performed for 90 min at 37 °C. After heat
inactivation at 95 °C for 5 min and
chilling on ice, the cDNA was amplified.
Different
genomic viral regions -gp120 V3 loop region of HIV and the HVR1,
core and NS5A regions of HCV- were amplified and directly sequenced.
The PCR reaction (50 ml)
contained 20 mM TrisHCl, 50 mM KCl, 50 pmol of each primer and 1.25
U Taq DNA polymerase (Promega). Nested PCR was performed with 2 ml
PCR product as a template, using internal primers under the same
conditions as the first round. The first and second round primers
and cycling parameters for each region are shown in Table 1 and were
made according to Kwok and Higuchi's recommendations[23].
Nucleotide sequencing Each
DNA was purified and directly sequenced with a Thermo Sequenase
radiolabeled-terminator-cycle sequencing kit (U.S. Biochemical
Corporation) using the same cycling parameters of the second PCR
round. Confirmatory sequencing was performed on reamplified DNA.
RESULTS
The genomic regions of HCV: HVR1, core and NS5A and the gp120 V3
loop of HIV were sequenced during a 42 month follow-up of a
chronically HIV patient acutely infected with HCV. Phylogenetic
analysis of core and NS5A grouped the HCV sequences into genotype 1a
(data not shown).
After
alignment and comparison of genomic sequences obtained before and
after HCV superinfection, the nucleotide sequence of HIV gp120 V3
loop showed three nonsynonymous mutations (I309L, T317A and E320D)
that appeared in the sample obtained 2 months after HCV
superinfection and maintained thereafter for the rest of the period
(Figure 1).
As far as
HCV sequences were concerned, in the HVR1 three nonsynonymous
mutations were observed (F399L, G393S and A397S) in the acute phase
of the infection, conversely, the mutation dynamics followed a
sequential and cumulative pattern, occurring at the 6th, 8th and
12th follow-up months. Each mutation was associated with an ALT
flare-up (Figure 1). In the last sample, 42 months after HCV
superinfection, two more amino acid changes were selected (G398A and
L399F).
Different
patterns of substitutions were observed in the HCV core and NS5A
regions. In the core, three nonsynonymous substitutions (Q63P, H69R
and R74G) appeared at the 17th month of the follow-up (Figure 2),
once chronic hepatitis was fully established. Late on the follow-up,
four mutations were selected: P63Q, A68V, G74R and G152A. The amino
acids that were resulted from the modifications in positions 63 and
74 were the same as that which was present in the earliest samples.
In the
portion of NS5A sequenced (nt 6632-7077), one amino acid
substitution was observed in the acute phase (E2227Q) and remained
thereafter, and another one was selected at the end of the follow-up
(V2251I).
The
sequences were submitted to GenBank and assigned accession numbers:
AF361170 through AF361176 and AF359345 through AF359354.
Figure
1(PDF) (A) Biochemical
profile of the HIV/HCV superinfected patient during the first 17
months of follow-up. Amino acid sequences of consecutive samples
corresponding to V3 loop (B) and HVR1 (C). V3 loop sequence was
obtained in the initial sample (0) and after 2, 17 and 42 months of
follow-up. HVR1 sequences in samples were obtained from 0 to the
17th month of follow-up and in the 42th month of follow-up. The
number at the left of each sequence corresponded to the month of the
follow-up when the samples were sequenced. Nucleotide sequences at
the different time points were aligned with CLUSTAL W 1.5, and the
corresponding amino acid ones were deduced.
Figure
2(PDF) Amino acid
sequences of consecutive samples corresponding to HCV NS5A (A) and
core (B). The number at the left of each one corresponded to the
month of the follow-up when the sequences were done. The black bar
indicated the ISDR. Amino acid positions were according to the HCV-1
(M62321).
DISCUSSION
In this study, we analyzed the evolution of different viral
genomic regions during HCV superinfection of a chronically HIV
infected patient.
Most
of the nucleotide substitutions fixed during the HCV superinfection
process were nonsynonymous and located at described epitopes,
suggesting a positive immune selection mechanism driving their
molecular evolution.
We
found that hypervariable regions of both HCV and HIV had several
amino acid modifications during the acute phase of superinfection.
However, these changes occurred simultaneously on the gp120 V3 loop
whereas they were sequentially selected and showed a cumulative
pattern in the HVR1.
The
selection of an HIV viral population with three amino acid
modifications in the V3 loop region right after HCV superinfection
maybe resulted from the overgrowth of markedly different but minor
HIV quasispecies from the initial sample.
In
contrast, the HVR1 evolved showed a cumulative pattern of mutations
during the 17 month period. Each time of sequential incorporation of
a nonsynonymous mutation was associated with an ALT flare up and
resulted from the selection process, also exerted by the evolving
host immune response[24].
It
has been proposed that the evolution of hypervariable regions may be
caused by the successive accumulation of point substitutions as we
have seen in the HVR1-HCV or, alternatively from the selection of a
pre-existing minor subpopulations, which was different from the
previous one, as observed in V3 loop of HIV[25].
Once
the chronic infection was established, two extra amino acid
mutations were observed in the HVR1, the first one was at position
398 (G→A), and the second one was at position 399 (L→F). F or L
occupied the last position alternatively in most of the HVR
sequences published elsewhere[26] and may be considered
as a return to a previous state of the quasispecies equilibrium.
The
timing of the substitutions observed in the core region, which were
late (after 17 months and 42 months of infection), implied its
involvement in the infection once persistence had been established.
Non-synonymous changes clustered in HCV epitopes that stimulated the
humoral and cellular response and were previously described[18,
20, 27], suggesting an active participation of these epitopes
in the persistence of HCV infection. Moreover, the sample at the end
of the follow-up showed two modifications (aa 63 and 74 of the core
protein) that recovered the early amino acid sequences. As far as
the HVR sequences concerned, this effect that might be due to the
return to a quasispecies equilibrium state favored the outgrowth of
the fittest quasispecies for that particular host conditions, as a
consequence from the interplaying of virus populations in every
situation.
Two
substitutions were selected in the NS5A region. One of them occurred
at the early phase of the infection whereas the second appeared at
the end of the follow-up. The first mutation selected (E2227Q) was
located in the ISDR, described as related to the IFN resistance of
some HCV genotypes by means of its interactions with the cellular
PKR and in a cellular epitope, as previously described[19].
In
conclusion, during the HCV superinfection process, each genomic
region analyzed presents a different pattern of evolution, and is
probably related to their functions in the viral life cycle. The
localization of mutations at described epitopes suggests the
participation of the host immune system drives the balance of the
viral subpopulations towards escape and better fitness ones. In
order to study this hypothesis, a quasispecies analysis is worth to
be done to address the changes showed during the coinfection by
means of the population equilibriums.
REFERENCES
1
Waldrep TW, Summers KK, Chiliade PA. Coinfection with HIV and
HCV: more questions than answers?
Pharmacotherapy 2000;20: 1499-1507
2
Laskus T, Radkowski M, Piasek A, Nowicki M, Horban A,
Cianciara J, Rakela J. Hepatitis C virus in lymphoid cells
of patients coinfected with human
immunodeficiency virus type 1: evidence of active replication
in monocytes/macrophages and
lymphocytes. J Infecti Dis 2000; 181: 442-448
3
Centers for Disease Control and Prevention. 1999 USPHS/IDSA
guidelines for the prevention of oppotunistic infections
in persons infected with human
immunodeficiency virus: disease-specific recommendations. USPHS/IDSA
Prevention
of Opportunistic Infections Working
Group: U.S: Public Health Services/Infectious Diseases Society of
America.
Morbility and Mortality Weekly Report
1999; 48: 1-82
4
Rockstroh JK, Woitas RP, Spengler U. Human immunodeficiency
virus and hepatitis C virus coinfection. Europ J Med
Res 1998; 3: 269-277
5
Rispeter K, Lu M, Behrens SE, Fumiko C, Yoshida T, Roggendorf
M. Hepatitis C virus variability: sequence analysis
of an isolate after 10 years of
chronic infection. Virus Genes 2000; 21: 179-188
6
Smith DB. Evolution of the hypervariable region of hepatitis
C virus. J Viral Hepatitis 1999; 6(Suppl 1): 41-46
7
Ray SC, Wang YM, Laeyendecker O, Ticehurst JR, Villano SA,
Thomas DL. Acute hepatitis C virus structural
gene sequences as predictors of
persistent viremia: hypervariable region 1 as a decoy. J Virol 1999;
73: 2938-2946
8
Hwang SS, Boyle TJ, Lyerly HK, Cullen BR. Identification of
the envelope V3 loop as the primary determinant of
cell tropism in HIV-1. Science 1991;
253: 71-74
9
Ghosh AK, Steele R, Meyer K, Ray R, Ray RB. Hepatitis C virus
NS5A protein modulates cell cycle regulatory genes
and promotes cell growth. J General
Virol 1999; 80: 1179-1183
10
Gale MJ Jr, Korth MJ, Tang NM, Tan SL, Hopkins DA, Dever TE,
Polyak SJ, Gretch DR, Katze MG. Evidence that
hepatitis C virus resistance to
interferon is mediated through repression of the PKR protein kinase
by the
nonstructural 5A protein. Virology
1997; 230: 217-227
11
Kato N, Lan KH, Ono-Nita SK, Shiratori Y, Omata M. Hepatitis
C virus nonstructural region 5A protein is a
potent transcriptional activator. J
Virol 1997; 71: 8856-8859
12
McLauchlan J. Properties of the hepatitis C virus core
protein: a structural protein that modulates cellular
processes.
J Viral Hepat 2000; 7: 2-14
13
Matsumoto M, Hsieh TY, Zhu N, VanArsdale T, Hwang SB, Jeng
KS, Gorbalenya AE, Lo SY, Ou JH, Ware CF, Lai
MM. Hepatitis C virus core protein
interacts with the cytoplasmic tail of lymphotoxin-beta receptor. J
Virol
1997; 71: 1301-1309
14
Zhu N, Khoshnan A, Schneider R, Matsumoto M, Dennert G, Ware
C, Lai MM. Hepatitis C virus core protein binds to
the cytoplasmic domain of tumor
necrosis factor (TNF) receptor 1 and enhances TNF-induced apoptosis.
J Virol
1998; 72: 3691-3697
15
Jin DY, Wang HL, Zhou Y, Chun AC, Kibler KV, Hou YD, Kung H,
Jeang KT. Hepatitis C virus core protein-induced loss
of LZIP function correlates with
cellular transformation. EMBO J 2000; 19: 729-740
16
Barba G, Harper F, Harada T, Kohara M, Goulinet S, Matsuura
Y, Eder G, Schaff Z, Chapman MJ, Miyamura T, Brechot
C. Hepatitis C virus core protein
shows a cytoplasmic localization and associates to cellular lipid
storage droplets.
Proceed Nati Acad Sci USA 1997; 94:
1200-1205
17
Sabile A, Perlemuter G, Bono F, Kohara K, Demaugre F, Kohara
M, Matsuura Y, Miyamura T, Brechot C, Barba G.
Hepatitis C virus core protein binds
to apolipoprotein AII and its secretion is modulated by fibrates.
Hepatology
1999; 30: 1064-1076
18
Akatsuka T, Donets M, Scaglione L, Ching WM, Shih JW, Di
Bisceglie AM, Feinstone SM. B-cell epitopes on the
hepatitis C virus nucleocapsid
protein determined by human monospecific antibodies. Hepatology
1993; 18: 503-510
19
Ward S, Lauer G, Isba R, Walker B, Klenerman P. Cellular
immune responses against hepatitis C virus: the evidence
base 2002. Clin Experimental Immunol
2002; 128: 195-203
20
Koziel MJ, Dudley D, Afdhal N, Choo QL, Houghton M, Ralston
R, Walker BD. Hepatitis C virus (HCV)-specific cytotoxic
T lymphocytes recognize epitopes in
the core and envelope proteins of HCV. J Virol 1993; 67: 7522-7532
21
Flichman D, Cello J, Castano G, Campos R, Sookoian S. In vivo
down regulation of HIV replication after hepatitis
C superinfection. Medicina 1999; 59:
364-366
22
Chomczynski P, Sacchi N. Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-
chloroform extraction. Analytical
Biochemistry 1987; 162: 156-159
23
Kwok S, Higuchi R. Avoiding false positives with PCR. Nature
1989; 339: 237-238
24
Hjalmarsson S, Blomberg J, Grillner L, Pipkorn R, Allander T.
Sequence evolution and cross-reactive antibody
responses to hypervariable region 1
in acute hepatitis C virus infection. J Med Virol 2001; 64: 117-124
25
Lu L, Nakano T, Orito E, Mizokami M, Robertson BH. Evaluation
of accumulation of hepatitis C virus mutations
in a chronically infected chimpanzee:
comparison of the core, E1, HVR1, and NS5b regions. J Virol
2001; 75: 3004-3009
26
Penin F, Combet C, Germanidis G, Frainais PO, Deleage G,
Pawlotsky JM. Conservation of the conformation and
positive charges of hepatitis C virus
E2 envelope glycoprotein hypervariable region 1 points to a role in
cell
attachment. J Virol 2001; 75:
5703-5710
27
Beld M, Penning M, van Putten M, Lukashov V, van den Hoek A,
McMorrow M, Goudsmit J. Quantitative antibody
responses to structural (Core) and
nonstructural (NS3, NS4, and NS5) hepatitis C virus proteins
among
seroconverting injecting drug users:
impact of epitope variation and relationship to detection of HCV RNA
in
blood. Hepatology 1999; 29: 1288-1298
Edited
by Xu
XQ and Wang XL
| |