|
Xiao Song
Chen1, Guo Jun Wang1, Xiong Cai1, Hong Yu Yu2
and Yi Ping Hu3
1Department
of Infectious Diseases, Changzheng Hospital, the Second Military
Medical University, Shanghai 200003, China 2Department of
Pathology, 3Department of Cell Biology, Department of
Basic Medicine, the Second Military Medical University, Shanghai
200433, China
Xiao Song Chen, graduated from Second Military Medical University as
a postgraduate in 1999, specialized in viral hepatitis B.
Supported by Projects of the Science Development Foundation of
Shanghai, No.994919033 and Tackling Key Problems in Science and
Technology from the State Science and Technology Ministry,
TJ99-LA01.
Correspondence to Yi Ping Hu, Department of Cell Biology,
Department of Basic Medicine, the Second Military Medical
University, Shanghai 200433, China
Telephone:
0086-21-25070240 Email. Yphu@smmu.edu.cn
Received: 2000-08-08 Accepted: 2000-09-29
Subject
headings:
hepatitis B virus; antiviral agents; oxymatrine; hepatitis B surface
antigens; hepatitis B core antigens; immunohistochemistry
Chen XS, Wang GJ, Cai X, Yu HY, Hu YP.Inhibition of hepatitis B
virus by oxymatrine in vivo. World J Gastroenterol, 2001;7(1):49-52
Abstract
AIM: To investigate the anti-HBV effect of oxymatrine (oxy)
in vivo.
METHODS: HBV transgenic mice were produced by micro-injection
of a 4.2kb fragment containing the complete HBV genomes. Expression
level of HBsAg and HBcAg in the transgenic mice liver was determined
by immunohistochemical assay.
RESULTS: Four groups (6 mice in each group) were injected
intraperitoneally with oxy at the dosage of 100, 200, and 300mg/kg
or with saline once a day for 30 days. Both HBsAg and HBcAg were
positive in livers of all the six mice in the control group
(injected with saline), and were positive in livers of two mice in
100mg/kg group and 300mg/kg group. In 200mg/kg group, HBsAg and
HBcAg were negative in livers of all the six mice. Based on the
results, 200mg/kg is the ideal dosage to explore the effect of oxy
at different time points. According to the oxy treatment time, mice
were divided into four groups: 10d, 20d, 30d and 60d (4 mice in each
group). Each mouse underwent liver biopsy two weeks before the
treatment of oxy. Down-regulation of HBsAg and HBcAg appeared after
treatment of oxymatrine for 10d and 20d, Dane-like particles
disappeared after the treatment of oxy for 20d under electron
microscopy, however, the expression level of HBsAg and HBcAg
returned to normal 60d later after oxy treatment.
CONCLUSION: oxymatrine can reduce the contents of HBsAg and
HBcAg in transgenic mice liver,longer treatment time and larger
dosage do not yield better effects.
INTRODUCTION
There are about 30 million patients suffering from chronic
hepatitis B in China. Patients with active liver disease carry a
high risk of developing cirrhosis and hepatocellular carcinoma. At
present, the most effective medicine is IFN-α, but it is too
expensive for most patients. Even in the patients treated by IFN-α,
the sera negative convertion rate of HBeAg and HBVDNA is about 40%［1-3］.
Previous works in our department by Cai X et al showed that
the sera negative convertion rates of HBeAg in patients with chronic
active hepatitis B treated with oxymatrine was 61%［4］.
To investigate the inhibiting mechanism of oxymatrine (oxy) on HBV
replication, transgenic mice were employed as animal model to
observe the changes of HBsAg and HBcAg expression in liver tissues.
MATERIALS AND METHODS
Materials
Matrine injection is the product of Ningxia Pharmaceutical Company
Ltd., containing 98% oxymatrine. The restriction enzymes were
purchased from PROMEGA. Taq enzyme purchased from SANGON.
Immunohistochemical kits were purchased from DAKO. Primers of PCR
were designed by ourselves and synthesized by GIBCO. 32P
labeled kit was the product of PROMEGA. Other reagents were
purchased from WASON, HUAMEI and so on.
Methods
Preparation of animals HBV transgenic mice (official
designation: ICR-TgN HBV adr1.2 SMMU) were produced by micro
injection of a 4.2kb fragment containing the complete HBV genome (adr
subtype)［5］.
Structural analysis of the transgene revealed that at least one
complete uninterrupted HBV genome was present. HBsAg and HBeAg were
not detectable in the sera of the mice, but can be detected in
livers by immunohistochemical assay (ABC), which was used to
determine the expression level of HBV.
PCR and Southern blot analysis Total tail genome DNA was
analyzed by PCR using HBV-specific primers 5＇CCCAATGGAACACTCACC［sense］,
5＇
AGGAACCACTGAACAAATGGC ［antisense］),
generating a 380bp fragment. Twenty mililiter of PCR products were
analyzed by electrophoresis on a 1% agarose gel in the presence of
0.5mg of ethidium bromide per mililiter. DNA bands were visualized
by UV fluorescence. Southern blot analysis was performed on total
genomic DNA by agarose gel electrophoresis of 30mg restricted
genomic DNA. Samples added on nylon filters were hybridized with HBV
specific 32P labeled DNA probes.
Histological analysis and electron microscopy were carried out
as routine methods. The expression of HBsAg and HBcAg in liver
tissues were assessed by immunohistochemical analysis according to
Guidotti et al［6］.
RESULTS
Effect of oxy at different doses on the expression of HBsAg and
HBcAg Twenty-four age and sex- matched mice were divided into four
groups. Each group was injected intraperitoneally with oxy at the
dosage of 100, 200 and 300mg/kg or with saline separately once a day
for 30 days. Livers were harvested 2 hours after the last injection
for immunohistochemical assay. Both HBsAg and HBcAg were positive in
livers of all the six mice in the control group (injected with
saline). In 100mg/kg group, HBsAg and HBcAg were positive in two
mice, while HBsAg and HBcAg were negative in the other four mice. In
the 200mg/kg group, both HBsAg and HBcAg were negative in all the
six mice, none of the six mice had detectable HBV antigen in the
livers. In the 300mg/kg group, HBsAg and HBcAg were positive in two
mice, and negative in the other four mice. No pathological changes
were found in the transgenic mice. Based on the results, we
considered that 200mg/kg
is the ideal dosage of
oxy for further study.
The effect of oxy at different time on the expression of HBsAg
and HBcAg
Mice were divided into four groups according to the oxy treatment
time, 10d (group 1),20d
(group 2), 30d and 60d (group 3 and 4). In each group, 4 mice were
randomly entered. Each mouse underwent liver biopsy two weeks before
the treatment of oxy (200mg/kg). The liver samples before and after
oxy treatment were collected, and immunohistochemical analysis was
performed to determine the expression level of HBsAg and HBcAg. All
the samples contained HBsAg and HBcAg positive cells, and the
positive and negative cells were counted in 5 randomly selected high
field vision, and χ2 test was made to compare the
HBV expression level before and after oxy treatment. In group 1, the
number of HBsAg and HBcAg positive cells was significantly lower
than before treatment of oxy in all the four mice livers. In group
2, the similar results were observed （Figures
1 and 2）,
and Dane like particles could be found in the livers before oxy
treatment under electron microscope and such particles could not be
found after the treatment of oxy for 20d （Figure
3）.
In group 3, the expression of HBV was decreased only in two of four
mice. No difference was observed on the expression of HBsAg and
HBcAg between the two liver samples harvested before and after the
treatment of oxy in group 4.
Figure
1
HBsAg in liver of the mice before
(A) and after
(B) treatment with
200mg/kg oxy for 20d.
Figure 2 HBcAg in liver of the mice before
(A) and after
(B) treatment with
200mg/kg oxy for 20d.
Figure 3 Dane＇s
like particles can be seen in the liver of untreated mice
(A) and disappeared
after treatment with 200mg/kg oxy
for 20d
(B).
DISCUSSION
As a traditional Chinese medicine, Sophra Flavescens Ait has been
used for the treatment of many diseases for thousands of years. Its
extract, oxy, has long been extensively used in China. It is
reported that oxy has a lot of pharmacological functions which can
be divided into four classes: ①
Anti-bacterial and anti parasitic actions. It has been reported that
oxy can cure acute dysentery, Trichomonas vaginalis and Giardia
lamblia infection［7-9］,
but the mechanism is still unclear. ②
Regulating immune reaction. Oxy can stimulate immune response at a
low concentration while inhibiting immune response at a high
concentration［10］.
Recently, more researchers have paid attentions to the immune
inhibitory effect of oxy. It has been reported that oxy has many
functions such as anti inflammation, anti-hypersensitive reactions,
inhibiting histamine releasing［11-14］.
The mechanism may be related to the changes of cAMP in the cell［15］
and inhibiting production of
cytokine［16］.
③
Inducing production of cytochrome P450. Oxy can increase the content
of P450 in the rat liver significantly after treatment of oxy at the
dosage of 200mg/kg for 4d［17］.
④
Anti-virus actions. Liu JX reported that oxy could inhibit coxsackie
virus B3 in vivo and in vitro［18,19］.
Cai X found that the sera negative convertion rates of HBVDNA and
HBeAg were 61.9% and 61.0% in chronic active hepatitis treated by
oxy, while such rates in the therapy of IFN-α were 57.9% and
55.3%［4］.
In our study, the content of HBV antigen in livers of transgenic
mice decreased significantly after treatment of oxy for 10 and 20d .
Dane-like particles disappeared in the liver of transgenic mice
after oxy treatment for 20d
. However, HBV expression level returned to normal after treatment
by oxy for 60d . We
concluded that oxy can be used as an effective drug in managing HBV
infection. There are two features of oxy on HBV: ①
HBsAg and HBcAg was down regulated at the same time, ②
longer time and larger dose did not yield better effect.
Our results strongly suggested that oxy can significantly
inhibit the expression of HBV antigen in transgenic mice and the
replication of HBV as well［20］.
But how oxy give play to its effect can not be concluded from our
experiments. However, based on the previous researches, it seems
that oxy may act by two ways: ①
oxy acts as an immune reaction regulator: Since HBV transgenic mice
were first found by Chisari in 1985［21］,
in vivo study of HBV has become convenient and objective.
Different lineage of HBV transgenic mice has also been found in our
country［5,22］.
A serial studies by Chisari et al have shown that certain
soluble products of the immune response, especially IFN-γ, TNF-α,
IFN-α, IL-2 and IL-12［23-28］
could
suppress the steady state content of HBV messenger RNA in the
hepatocytes of transgenic mice. Furthermore, these effects were
found to be mediated by a post-transcriptional mechanism that
selectively accelerates the degradation of cytoplasmic HBV mRNA［27］.
The same events were set in motion when HBsAg-specific CTL secreted
IFN-γ and induced TNF-α after antigen recognition［23,29］.
The interhepatic nucleocapsid particles and replicative
intermediates were also eliminated during unrelated virus infection［30,31］
or during hepatocellular
regeneration after partial hepatectomy［32］.
Oxy is a strong immune
regulator, Wang HX has reported that oxy can inhibit the competence
of LAK cell killing P815 cell by about 70%-80%［33］,
and Shang HS reported that oxy has the same effect of marcophage on
P815 cell［34］,
which proved that oxy may be an agonist of IL-2. Thus, IL-2 could
not be the mediator of oxy inhibiting HBV. Whether other cytokines
may be the mediator remains unclear. ②
Oxy acts as an inducer of cytochrome P450. HBV antigen is exogenous
proteins in mice hepatocytes. mRNA of HBV in hepatocytes may be
degraded by cytochrome P450. Therefore, oxy can induce the
production and enhance the activity of cytochrome P450［17］,
hence accelerating the degradation of HBV mRNA and inhibiting HBV
replication. Further study is needed.
Oxy is a broad-spectrum anti virus drug, at least to HBV and
coxsackie B virus 3 so far. This may give us new hope for the
treatment of chronic hepatitis HBV infection including other viral
infection such as HCV and HIV infection.
Cirrhosis is a servere consequence of chronic HBV infection
and preventing the development of cirrhosis is very difficult［35］.
Gan LW et al reported that oxy can inhibit the liver fibrosis
induced by CCl4 in rats［36］.
Oxy can not only down regulate HBV expression but also inhibit the
liver fibrosis. Based on the two points, we concluded that oxy can
be used as an effective drug in managing HBV infection. However, the
exact mechanism of oxy inhibiting expression of HBV and liver
fibrosis has not yet been fully understood. Further studies both
basicaly and clinically are needed.
REFERENCES
1 Hoofnagle
JH, Peters M, Mullen KD, Jones DB, Rustgi V, Bisceglie AD,Hallahan
C, Park Y, Meschievitz C, Jones EA.
Randomized, controlled
trial of recombinant human -interferon in patients with chronic
hepatitis B. Gastroenterology,
1988;95:1318-1325
2 Zhu Y,
Wang YL, Shi L. Clinical analysis of the efficacy of interferon
alpha treatment of hepatitis. World J Gastroenterol,
1998;4(Suppl 2):85-86
3 Shi JJ,
Miao F, Liu FL. Therapeutic effect of medicinal herbs and western
drugs on hepatitis B virus. World J
Gastroenterol, 1998;4(Suppl
2):61-62
4 Cai
X,Wang GJ, Qu Y, Fan CH, Zhang RQ, Xu WS. Clinical efficacy of
kurorinone in the treatment of chronic hepatitis B.
Dier Junyi Daxue Xuebao,
1997;18:47-49
5 Hu WJ,
Dai DS, Li JX, Wang XM, Sun W, Hao GR, Hu YP. The generation of
hepatitis B virus transgenic mice
homozygote. Dier
Junyi Daxue Xuebao, 1999;20:598-600
6 Guidotti
LG, Matzke B, Schaller H, Chisari FV. High-level hepatitis B virus
replication in transgenic mice. J Virol,
1995;69:6158-6169
7 Tang ZW.
Report of 60 case acute dysentery treated by matrine. Zhonghua Neike
Zazhi, 1960;8:357-358
8
Sun DX. Chinese medicine matrine can cure Trichomonas
vaginalis. Zhonghua Fuchanke Zazhi, 1958;6:544
9 Chen JL,
Yu SZ, Wang HJ, Yang GJ, Wang PH, Shi Y. Report of 100 case Giardia
lamblia infection treated by matrine.
Zhonghua Neike
Zazhi, 1965;13:614
10 Qian YK, Cheung HT, Richardson A. Chinese herbs (SFA,
LLA)act as immunoregulator to immune cells and cytokine
(IL-2,IL-3) in
vitro.Zhonghua Weishengwuxue He Mianyixue Zazhi, 1988;8:312-315
11 Han CL, Chen XR, Ma JJ, Lin ZB. Study of oxymatrine s
pharmacodynamic effect on allergic contact dermatitis. Beijing
Yike Daxue
Xuebao,1996;28:59-61
12 Liao J, Zhang BH. Anti-inflammatory effects of oxymatrine.
Beijing Yike Daxue Xuebao, 1988;20:313-315
13 Ma JJ, Si LP, Ding Y, Lin ZB, Chen XR, Han CL, Peng QS,
Fang Y. Inhibition of type I-I allergic reactions by oxymatrine.
Beijing Yike
Daxue Xuebao.1991;23:445-447
14 Zhang Q, Zhao FS, Hao ZM, Yin JZ, Qian YK. Study of effects
and its mechanisms of oxymatrine on histamine release
from peritoneal
mast cells. Zhonghua Weishengwuxue He Mianyixue Zazhi, 1992;12:41-44
15 Wang HX, Yu XZ, Qian YK. The effects of oxymatrine on
lymphocytes- second messengers. Zhongguo Mianyixue Zazhi,
1993;9:315-317
16 Ding GF, Shang HS, Xu H, Deng YL, Long ZZ, Han GQ. The
study of monokines-the measurement of IL-1 from the
macrophages activated by different
agents. Zhongguo Mianyixue Zazhi, 1986;2:336-339
17 Yuan C, Lu SQ, Yao X. Effect of oxymatrine on the antitumor
activity and toxicity of cyclophosphamide in mice.
Yaoxue Xuebao, 1987;22:245-249
18 Liu JX, Lu DY, Yang ZM, Chen SX, Qian FR. Preliminary
studies on the role of anti coxsackie group B virus of Chinese
medicine sophora
flavescens.Shanghai Dier Yike Daxue Xuebao, 1991;11:140-142
19 Chen FX, Liu JX, Lu DY. The effects of sophora flavescens
alkaloids of coxsackie virus B3 in vitro and a preliminary
study
of its
mechanism. Zhonghua Shiyan He Linchuang Bingduxue Zazhi,
1995;9:115-117
20 Tang RX, Gao FG, Zeng LY, Wang YW, Wang YL. Detection of
HBV DNA and its existence status in liver tissues and
peripheral blood
lymphocytes from chronic hepatitis B patients. World J Gastroenterol,
1999;5:359-361
21 Chisari FV, Pinkert CA, Milich DR, Filippi P, Mclachlan A,
Palmiter RD, Brinster RL. A transgenic mouse model of the
chronic hepatitis B
surface antigen carrier state. Science, 1985;230:1157-1160
22 Hu YP, Yao YC, Li JX, Wang XM, Li H, Wang ZH, Lei ZH. The
cloning of 3 -truncated preS/S gene from HBV genomic
DNA and its
expression in transgenic mice. World J Gastroenterol, 2000;6:734-737
23 Guidotti LG, Ando K, Hobbs MV, Ishikawa T, Runkel L,
Schreiber RD,Chisari FV. Cytotoxic T lymphocytes inhibit
hepatitis
B virus gene
expression by a noncytoly tic mechanism in transgenic mice.Proc Natl
Acad Sci USA,1994;91:3764-3768
24 Gilles PN, Fey G, Chisari FV. Tumor necrosis factor alpha
negatively regulates hepatitis B virus gene expression in
transgenic mice. J
Virol,1992;66:3955-3960
25 Wang JY, Wang XL, Liu P. Detection of serum TNF-a,
IFN-g,
IL-6 and IL-8 in patients with hepatitis B. World J
Gastroentero,
1999;5:38-40
26 Guidotti LG, Guilhot S, Chisari FV. Interleukin-2 and
Alpha/Beta interferon down-regulate hepatitis B virus gene
expression in
vivo by tumor necrosis factor-dependent and independent pathways. J
Virol, 1994;68:1265-1270
27 Guilhot S, Guidotti LG, Chisari FV. Interleukin-2
downregulates hepatitis B virus gene expression in transgenic mice
by
a
posttranscriptional mechanism. J Virol, 1993;67:7444-7449
28 Cavanaugh VJ, Guidotti LG, Chisari FV. Interleukin-12
inhibits hepatitis B virus replication in transgenic mice. J Virol,
1997;71:3236-3243
29 Guidotti LG, Ishikawa T, Hobbs MV, Matzke B, Schreiber R,
Chisari FV. Intracellular inactivation of the hepatitis B
virus
by
cytotoxic T lymphocytes.
Immunity, 1996;4:25-36
30 Cavanaugh VJ, Guidotti LG, Chisari FV. Inhibition of
hepatitis B virus replication during adenovirus and cytomegalovirus
infections in
transgenic mice. J Virol, 1998;72:2630-2637
31 Guidotti LG, Borrow P, Hobbs MV, Matzke B, Gresser I,
Oldstone MBA,Chisari FV.Viral cross talk:intracellular
inactivation
of
the hepatitis B virus
duringan unrelated viral infection of the liver.ProcNatl Acad Sci
USA,1996;93:4589-4594
32 Guidotti LG, Matzke B, Chisari FV. Hepatitis B virus
replication is cell cycle independent during liver regeneration
in
transgenic
mice. J
Virol,1997;71:4804-4808
33 Wang HX, Zhang LH, Huang Y, Qian YK. Effect of oxymatrine
on LAK cell activity. Mianyixue Zazhi, 1994;10:17-19
34 Shang HS, Zhao J, Chen WF. The effect of matrine on
macrophage inhibiting P815 cell proliferation. Beijing Yike
Daxue Xuebao,
1986;18:127-130
35 Cheng ML, Wu YY, Huang KF, Luo TY, Ding YS, Lu YY, Liu RC,
Wu J. Clinical study on the treatment of liver fibrosis due
to hepatitis
B by IFN-a1
and traditional medicine preparation. World J Gastroenterol,
1999;5:267-269
36 Gan LW, Wang GJ, Li YL. Effects of oxymatrine on liver
fibrosis in rats. Dier Junyi Daxue Xuebao, 1999;20:445-448
| |
PubMed
